Fine Mapping of Quantitative Trait Loci (QTL) with Resistance to Common Scab in Diploid Potato and Development of Effective Molecular Markers

Abstract

Potato common scab is one of the major diseases posing a threat to potato production on a global scale. No chemical agents have been found to effectively control the occurrence of this disease, and research on the identification of resistance genes and the development of molecular markers remains relatively limited. In this study, a diploid potato variety H535, which exhibits resistance to the predominant pathogen Streptomyces scabies, was utilized as the male parent, whereas the susceptible diploid potato variety H012 served as the female parent. Building upon the resistance QTL intervals pinpointed through a genome-wide association study, two potential resistance loci were localized on chromosome 2 of the potato genome, spanning the regions between 38–38.6 Mb and 41.3–42.7 Mb. These intervals accounted for 18.03% of the total phenotypic variance and are presumed to be the primary QTLs underlying scab resistance. Building upon this foundation, we expanded the hybrid progeny population, conducted resistance assessments, selected individuals with extreme phenotypes, developed molecular markers, and conducted fine mapping of the resistance gene. A phenotypic evaluation of scab resistance was carried out using a pot-based inoculation test on 175 potato hybrid progenies to characterize the F1 generation population. Twenty lines exhibiting high resistance and thirty lines displaying high susceptibility were selected for investigations. Within the preliminary mapping interval on potato chromosome 2 (spanning 38–43 Mb), a total of 214 SSR (Simple Sequence Repeat) and 133 InDel (Insertion/Deletion) primer pairs were designed. Initial screening with parental lines identified 18 polymorphic markers (8 SSR and 10 InDel) that demonstrated stable segregation patterns. Validation using bulked segregant analysis revealed that 3 SSR markers (with 70–90% linkage) and 6 InDel markers (with 70–90% linkage) exhibited significant co-segregation with the resistance trait. A high-density genetic linkage map spanning 104.59 cm was constructed using 18 polymorphic markers, with an average marker spacing of 5.81 cm. Through linkage analysis, the resistance locus was precisely mapped to a 767 kb interval (41.33–42.09 Mb) on potato chromosome 2, flanked by SSR-2-9 and InDel-3-9. Within this refined interval, four candidate disease resistance genes were identified: RHC02H2G2507, RHC02H2G2515, PGSC0003DMG400030643, and PGSC0003DMG400030661. This study offers novel insights into the genetic architecture underlying scab resistance in potato. The high-resolution mapping results and characterized markers will facilitate marker-assisted selection (MAS) in disease resistance breeding programs, providing an efficient strategy for developing cultivars with enhanced resistance to Streptomyces scabies.

1. Introduction

Potatoes are susceptible to various diseases affecting both their aboveground and belowground parts. One of the most significant soil-borne diseases is potato scab, caused by Streptomyces spp. [1]. In recent years, potato scab has ranked as the fourth most critical potato disease, trailing only late blight, early blight, and blackleg. The pathogen can survive winter in infected tubers, plant debris, and soil, remaining viable for up to a decade. This resilience makes it notoriously hard to control and allows it to act as an ongoing source of infection for future crops. The disease primarily targets the skin of potato tubers and stolons, while symptoms on aboveground plant parts are far less visible [2]. Early infection begins with brown spots on the tuber surface. As the tuber grows, these lesions spread, and the surrounding tissue becomes corky, forming raised or sunken, circular, or irregular scab-like patches. Symptoms vary widely—some tubers show small, shallow scars, while severe infections can cover the entire surface. These lesions are classified as superficial, raised (erumpent), or deep-pitted, ultimately degrading tuber quality and lowering marketable yields [3].

The pathogens responsible for potato scab are highly diverse, with new pathogenic strains appearing every year. This disease is widespread across the United States [4,5], the Netherlands [6], Canada [7], China [8], and 23 other countries. Common species include Streptomyces scabies, S. acidiscabies, and S. turgidiscabies. Of these, *S. scabies is the primary cause of potato scab, severely reducing potato quality and market value, leading to major economic losses for farmers. Infection begins when tubers form at the tips of stolons and lasts approximately 3–4 weeks, primarily targeting immature lenticels or stomata [9]. Studies show that S. scabies can directly breach plant cell walls to colonize the host [10]. Once inside, the pathogen grows inward or between cell layers, feeding on nutrients from dying host cells [11]. In response, the plant forms multiple layers of cork tissue to isolate the pathogen. This tissue eventually sheds, protecting healthy cells [12]. At the same time, this tissue forms a protective periderm. However, the pathogen may invade dead cells, breach the periderm, and trigger additional wound-periderm layers, worsening lesions [13]. Disease severity is linked to variety resistance [14], soil conditions [15], and pathogen population levels [16]. Infection stops once tubers mature, and the disease does not advance during storage.

Current field control strategies for potato scab primarily rely on chemical and biological treatments. However, long-term chemical use leads to pesticide residues, pathogen resistance, environmental harm, and technical limitations. For these reasons, developing resistant potato varieties is now considered the most effective long-term solution. The main challenge lies in the limited availability of resistant genetic material, which hinders breeding efforts [17]. Disease-resistant breeding focuses on introducing resistance genes through hybridization. Breeders select offspring with desired traits and incorporate these into commercial varieties [18]. Hybrid breeding allows intentional pairing of parent plants to combine advantageous genes from both lineages. Leveraging hybrid vigor (heterosis) significantly improves breeding efficiency and success rates [19].

Genetic studies on potato scab disease have shown that in diploid populations, resistance to the disease can be controlled by one or a few genes [20]. In tetraploid potatoes, however, resistance is influenced by multiple genes. Murphy [21] successfully transferred scab resistance from diploids to tetraploids, supporting this hypothesis. In most cases, resistance follows a quantitative inheritance pattern and is genetically relatively simple [22]. Research by Haynes [23] found that the majority of variation in tetraploid potatoes is heritable, with heritability estimates ranging from 89% to 93%. Additionally, Haynes [24] confirmed the feasibility of introducing scab resistance genes from diploid sources into tetraploids. The number of alleles can also affect gene expression levels, leading to diverse phenotypes [25]. Bradshaw [26] constructed the first tetraploid F1 mapping population. They utilized AFLP and SSR markers to generate a molecular marker map for 227 offspring derived from the cross 12601ab1 × Stirling. Two resistance-related QTLs were detected: one on chromosome 2 of 12601ab1 and the other on chromosome 6 of Stirling. Zorrilla [20] constructed a linkage map using single nucleotide polymorphisms (SNPs) from 151 F1 progenies of Atlantic × Superior. Across chromosomes 3 and 11 of Atlantic and chromosomes 1, 2, 5, 6, and 10 of Superior, seven QTLs related to scab disease incidence and severity were identified. Da Silva Pereira [27]. identified a QTL associated with lesion area on linkage group 3 in the Atlantic × B1829-5 F1 population. Braun [28]. constructed a genetic map for the diploid progeny of US-W4 × 524-8 (Solanum chacoense Bitter) using SNP markers. A QTL related to scab lesion type and lesion area was located in the overlapping region on chromosome 11. Fofana B [29]. demonstrated that 58 QTN/QTLs, distributed across all 12 potato chromosomes, were associated with common scab resistance. Among these, 52 showed significant allele effects on three traits. Of the 52 beneficial QTN/QTLs identified, 38 exhibited pleiotropy across at least two traits, while 14 were trait-specific, distributed across three chromosomes. The identified QTN/QTLs exerted varying degrees of impact, emphasizing the quantitative and polygenic nature of common scab resistance. Researchers analyzed the transcriptomes of the resistant variety CS10 and the susceptible variety CS11 following scab pathogen inoculation. Through differential expression analysis, 147 key genes were identified, and three potential resistance genes, LOC102589042, LOC102605863, and LOC102604056, were validated. This study confirmed the association between metabolic pathways and pathogen responses, providing evidence for the molecular resistance mechanism of potato scab disease [30]. Koizumi E [31] identified a new QTL interval for common scab resistance using SNP markers. This QTL, which accounted for up to 14.7% of the total variance, was located between 0.43 Mb and 1.07 Mb on potato chromosome 1. The homozygous recessive allele enhanced the resistance levels. Yuan J [32]. identified three QTLs associated with potato chromosomes 2, 4, and 12. These QTLs explained 21%, 19%, and 26% of the phenotypic variation, respectively. The QTL on chromosome 2 was dominant in a single copy, while dominant QTLs were detected on chromosomes 4 and 12.

This study aims to develop tightly linked markers within the QTL intervals associated with potato scab resistance, construct a genetic linkage map, and conduct fine mapping of resistance genes. The application of molecular marker-assisted breeding will enhance the selection efficiency of hybrid progeny, shorten the breeding cycle, and provide technical support for the development of potato cultivars resistant to scab.

2. Materials and Methods

2.1. Experimental Materials and Pathogen Inoculation

For this study, we used the scab-resistant diploid potato variety H535, the susceptible variety H012, and 175 F1 progeny from their cross. The hybridization was performed in 2022 at the Keshan Farm potato breeding greenhouse in Heilongjiang Province. Resistance evaluation took place in May 2024 in the potted-plant facility at Heilongjiang Bayi Agricultural University. Both parental lines contain wild relatives—specifically, the diploid potato cultivars Phureja (S. phureja, PHU) and Stenotomum (S. stenotomum, STN)—which show significant differences in scab resistance.

The pathogen utilized for inoculation in the experiment is KS28-2, a pathogenic isolate of Streptomyces scabies, which serves as the primary pathogenic strain of potato scab in Heilongjiang Province, China. The yeast malt extract agar (YME) medium is formulated using 4 g of yeast extract, 10 g of maltose, 4 g of glucose, 20 g of agar, and 1000 mL of distilled water, with its pH adjusted to 6.2. The pathogen is inoculated onto the YME medium plate via the streaking technique. Subsequently, the plate is placed in an artificial climate chamber set at a temperature of 28 °C and cultured for 15 days post-inoculation. Prior to use, sterile distilled water is added to the plate, and the mycelia are gently scraped to prepare a spore suspension. By uniformly injecting the suspension into the soil surface, it infects potato stolons and tubers over time.

The potato materials to be tested, along with the parent plants, are first immersed in a 0.1% potassium permanganate solution for 15 min and then rinsed three times with sterile distilled water. The tubers are placed in a 20 °C constant-temperature incubator for sprout induction. Once the sprouts reach approximately 0.5 cm in length, they are potted. Whole tubers are planted, with three biological replicates per individual plant. The growth medium is prepared by mixing vermiculite, perlite, and peat soil in a 1:1:2 ratio and sterilizing the mixture. Each pot, measuring 35 cm × 35 cm, contains 15 cm of the mixed medium, to which 15 g of compound fertilizer (with an N-P-K ratio of 12:24:12) is added. After covering with 0.5 kg of the medium and thoroughly watering, the tubers are placed and then covered with an additional 10 cm of the growth medium. During the plant-growth process, routine management practices, including pest and disease control, are implemented to ensure normal plant growth. When reaching the budding stage, 200 mL of a spore suspension of the pathogen, with a concentration of 1 × 10⁸ colony-forming units per milliliter (CFU/mL), is added to each pot. Subsequently, the watering interval is extended, and moderate drought conditions are maintained. Regular foliar fertilization is applied, and additional fertilization is provided based on the plant-growth conditions.

2.2. Disease Detection and Resistance Evaluation

Potato plants from three independent replicate progenies were harvested at maturity. The harvested tubers were meticulously cleaned, drained, and classified according to the severity of scab symptoms. The resistance evaluation encompassed three primary indicators. The Incidence Rate (IR) was calculated as the percentage of infected tubers relative to the total number of harvested tubers, using the formula IR = (number of infected tubers/total number of harvested tubers) × 100%. The Disease Severity Index (DSI) was determined by assigning weighted values to each disease severity level and calculating the average, with the formula DSI = Σ (number of tubers at each severity level × corresponding severity level)/(total number of tubers × maximum severity level) × 100%. The resistance level (RL) was categorized into five levels based on DSI: High Resistance (HR, 0 ≤ DSI ≤ 10), Resistant (R, 10 < DSI ≤ 30), Intermediate (I, 30 < DSI ≤ 50), Susceptible (S, 50 < DSI ≤ 70), and Highly Susceptible (HS, DSI > 70) [33,34].

2.3. DNA Extraction and Marker Development

Genomic DNA was extracted from fresh leaves using the NuClean Plant Genomic DNA Kit (CWBIO, Nanjing, China). The DNA concentration and quality were evaluated by 1% agarose gel electrophoresis. Subsequently, the working concentration was adjusted to 50 ng/μL with ddH₂O for marker amplification [35].

SSRHunter 1.3, a software for local SSR site search, was employed to identify potential SSR loci within every 1 Mb region [36]. We downloaded the DM1-3v4.03 whole-genome sequence from the Potato Genome Sequencing Consortium (PGSC) database and extracted all sequences of chromosome 2. Then, we divided the chromosomal sequence into 1 Mb segments. Next, we copied each segment into the SSR Hunter software to search for SSR (simple sequence repeat) loci within each 1 Mb region and obtained the predicted SSR locus sequences.

InDel loci, identified from Bulked Segregant Analysis (BSA) sequencing data and located between 38 Mb and 43 Mb on chromosome 2, were selected. These loci had insertion/deletion differences greater than 5 bp, with a spacing of more than 5 kb. For each InDel locus, 150 bp sequences were selected from both the upstream and downstream regions, and a 300 bp sequence was chosen overall. The primer design criteria were as follows: primer length of 21 ± 2 bp, GC content between 40% and 60%, amplicon length between 100 bp and 300 bp, and an annealing temperature of 53 °C to 60 °C. Primers were designed using Premier 6.0 software.

2.4. Primer Amplification and PCR Product Detection

To optimize the PCR amplification conditions, a 10 μL reaction system was adopted, which contained 1.0 μL genomic DNA (50 ng/μL), 5.0 μL of 2× Es Taq Master Mix, 1.0 μL each of forward and reverse primers (10 μM), and sterile double-distilled water to make up the final volume. The PCR reaction program was as follows: pre-denaturation at 94 °C for 2 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 2 min for 30 cycles. The detection methods were selected according to the type of marker. Since the amplicon sizes for both SSR and InDel markers in this experiment did not exceed 400 bp, the PCR products were detected using 10% polyacrylamide gel electrophoresis (SDS-PAGE). A 2 μL sample was loaded into each well, with a marker used as a control. Electrophoresis was carried out at 180 V and 100 mA for 3 h. After electrophoresis, the gel was stained with a nucleic acid dye at a 1:10,000 dilution for 30–60 min for primer screening [37].

2.5. Construction of Genetic Linkage Map

Genotype detection of the parental lines and F1 individuals was conducted using polymorphic primers. In combination with the phenotypic data of F1 individuals, bands showing differences were recorded as “1”, bands without differences as “0”, and ambiguous bands or missing data as “.”. In the Excel spreadsheet, “1” was replaced with “np”, “0” with “nn”, and “.” with “-”. Using composite interval mapping (CIM). Genetic linkage mapping by integrating phenotypic and genotypic data from hybrid progeny. Relevant parameters were adjusted, with the Threshold Value (By LOD) set to 3, the k-Optimality (By LOD, 2-OptMAP, NN Initials) set to 10, and the Window Size (By LOD) appropriately configured. The QTL IciMapping software (version 4.0), developed by the Crop Science Research Institute of the Chinese Academy of Agricultural Sciences (Quantitative Genetics Group), was utilized to construct the genetic linkage map between the molecular markers and the target gene loci.

2.6. Quantitative Real-Time PCR (qRT-PCR) Analysis

During the squaring stage, potato tubers from the disease-resistant parent, the susceptible parent, and hybrid progeny were inoculated with a scab spore suspension. Tubers were collected at four time points: prior to inoculation (0d), and 2, 4, and 7 days post-inoculation. The tuber samples were rapidly frozen in liquid nitrogen, with three biological replicates for each time point. Based on the functional annotations of genes within the candidate region, resistance-related genes were selected, and primers for these genes were designed using the NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 4 June 2025) platform. qRT-PCR was carried out to further explore gene expression. Total RNA was extracted from potato tubers using the OminiPlant RNA kit and reverse-transcribed into cDNA with the HiFiScript cDNA Synthesis Kit (CWBIO, Nanjing, China). The potato Elongation factor 1-alpha (EF1α) gene was employed as the reference gene (Actin). qRT-PCR analysis was performed on a CG-05 real-time PCR system. Each sample had three biological replicates and four technical replicates, and the final analysis was based on the three most reproducible results. Relative expression levels were calculated using the 2−∆∆CT method [38,39].

3. Results

3.1. Resistance Evaluation of the Population Materials

Following inoculation with the pathogen, marked alterations were detected in the three key indicators—Incidence Rate (IR), Disease Severity Index (DSI), and resistance level (RL)—among the hybrid parental lines and 175 hybrid progeny (

Table 1. Resistance Evaluation of Parental Lines and Hybrid Progeny.

Trait	H535 Means	H012 Means	F1 Means	F1 Minimum	F1 Maximum
Incidence rate (%)	10.00%	83.33%	34.58%	5.00%	100.00%
DSI	10	80	40	0	90
RL	HR	HS	I	HR	HS

). In the F1 population, the disease incidence spanned from 5.00% to 100.00%, and the Disease Severity Index ranged from 0 to 90. The resistance of the F1 generation demonstrated transgressive segregation, with some individuals showing resistance levels surpassing that of the resistant parent H535 and susceptibility levels exceeding that of the susceptible parent H012. A total of 20 individuals highly resistant to scab (HR) and 30 individuals highly susceptible to scab (HS) were selected. The phenotypic characteristics of the parental lines and hybrid progeny are presented (Figure 1). As depicted in the figure, the tubers of the resistant parent and resistant progeny were devoid of disease symptoms, while those of the susceptible parent and susceptible progeny manifested symptoms, with the disease symptoms being more pronounced in the susceptible progeny. The resistance disparities between the resistant and susceptible progeny were substantial.

3.2. Development and Identification of Markers

With reference to the genome sequence of the diploid potato cultivar DM1-3, 214 pairs of SSR primers were designed within the 38–43 Mb region of chromosome 2. Through the analysis of Bulked Segregant Analysis (BSA) data for insertion or deletion loci, a total of 133 pairs of InDel primers were devised. Fragment amplification was carried out using the susceptible parent H012 and resistant parent H535 as templates. When the PCR products yielded a distinct single band upon detection by 1% agarose gel electrophoresis, further verification was conducted via polyacrylamide gel electrophoresis to ascertain the presence of polymorphism. In this experiment, 10% polyacrylamide gel electrophoresis was employed to validate the polymorphism of the markers between the parental lines. Among the primers, those with PCR products exhibiting stable and legible band patterns after polyacrylamide gel electrophoresis were selected. SSR primers were initially screened using the resistant and susceptible parental materials, and 8 SSR markers that demonstrated segregation in the genotypes of the resistant and susceptible materials, along with stable and consistent band patterns, were chosen. These markers were designated as SSR-1-19, SSR-1-35, SSR-2-9, SSR-2-29, SSR-2-53, SSR-3-11, SSR-3-19, and SSR-3-65 (Figure 2A). Furthermore, 10 InDel markers that showed genotype segregation and stable band patterns in the resistant and susceptible materials were selected. These markers were named InDel-2-9, InDel-2-11, InDel-2-29, InDel-2-43, InDel-3-9, InDel-3-10, InDel-3-11, InDel-3-12, InDel-3-33, and InDel-3-37 (

Table 2. Information of Polymorphic Primers.

NO.	Primer	Primer Sequence (5′-3′)	Tm (°C)	Size (bp)
1	SSR-1-19	F: AAAGCAGGTAATTGGGCACCTT	55.0	173
		R: AGGCAAAGACGCATTGATAGGG
2	SSR-1-35	F: AAGAGGTATGCCACATCAACTT	53.8	104
		R: AGTGTTACTTGGAGTCTCAACC
3	SSR-2-9	F: GATTCAATCGACAGCACGGTAA	54.0	132
		R: CCTAGGGATTAGGGAATCAGGT
4	SSR-2-29	F: TATACGTGGGCCATTGGTCATC	54.5	182
		R: GAGGTCGGTCAGAAGTACAAGT
5	SSR-2-53	F: CGAGGTAGTGGCAAGGTCTG	55.5	213
		R: GGCATGGCACGAAGTTTCAAA
6	SSR-3-11	F: CGAACCCACAACTCTAGCATGA	55.0	173
		R: CGCTCCGTCACTGCCAATAG
7	SSR-3-19	F: ATCAAGAACATTGGGCAACTCA	54.0	188
		R: TACAGGCTCACAGCTTACTCAC
8	SSR-3-65	F: CCCATAAGGCCATAACCAAACG	53.5	144
		R: CTTCTTCTGCATTCTCTGTCCT
9	InDel-2-9	F: TCCCTATGCTTCTCAGATATGGT	54.0	119
		R: GGGAGAATTTCGTAGCCACATC
10	InDel-2-11	F: CGAATTTCCTTGTGCCGTGATAA	55.0	201
		R: CGAACCAGTGTGGAGCAGTC
11	InDel-2-29	F: CGATGGTTCTGTTCTGTGTTTCT	54.0	206
		R: TCCTACTCACTAATGGCCTACTC
12	InDel-2-43	F: TTCTAGGGTGACAAGTGATAAGC	53.0	170
		R: GGAAAGAAGTAAGATCATGCCAG
13	InDel-3-9	F: CCACTCGTACTCGCTACTGTAAC	55.0	114
		R: TGCCATTAGACGGAGAGAAGTTG
14	InDel-3-10	F: TTGAAGCCCTCTTGATCGTGTT	54.0	186
		R: GATGAATCGTCACAACTGGAGAC
15	InDel-3-11	F: TCCGACGCTTAATCAGTGTTCC	55.0	124
		R: TCTTACCATTTCAGACCACCAGG
16	InDel-3-12	F: GGCCTCCTCTACTTATCTCACAA	54.5	167
		R: TTTGGTTTGCGGTTTCACTCAG
17	InDel-3-33	F: ACCTTCTTTCCCTTTGCTACTCA	54.0	153
		R: TTCAATCGAAGCTGCTCTGTCA
18	InDel-3-37	F: ACTAGCAGAGCGAGCAGAGT	54.0	119
		R: GCAGCTATGAACGCCACAAG

). Validation of the polymorphism of these markers in hybrid progeny disclosed consistent segregation of genotypes and stable band patterns between the resistant and susceptible materials. (Figure 2B)

3.3. Marker Fit Validation in the Population

The developed polymorphic markers were validated in 40 extreme materials. It was revealed that 8 SSR markers demonstrated a fit ranging from 50% to 90% in the extreme resistant genotype and from 55% to 80% in the extreme susceptible genotype (Figure 3A). Moreover, 10 InDel markers exhibited a fit of 55% to 90% in the extreme resistant genotype and 55% to 85% in the extreme susceptible genotype. The genetic regions mapped on chromosome 2 were consistent with the results of the marker analysis, attaining the expected outcome (Figure 3B). Markers SSR-1-19, SSR-2-53, SSR-3-19, InDel-3-10, and InDel-3-33 showed a fit below 60% between resistant and susceptible genotypes, with a relatively low correlation, suggesting that further validation and analysis are required (

Table 3. The Degree of Fit between Markers and Extreme Materials.

Primer	Chromosome	Compatibility with Disease Resistance Traits	Degree of Conformity of Sensitive Traits
SSR-1-19	2	55.0	53.3
SSR-1-35	2	65.0	70.0
SSR-2-9	2	90.0	80.0
SSR-2-29	2	70.0	80.0
SSR-2-53	2	50.0	63.3
SSR-3-11	2	75.0	66.7
SSR-3-19	2	55.0	70.0
SSR-3-65	2	60.0	73.3
InDel-2-9	2	90.0	76.7
InDel-2-11	2	70.0	60.0
InDel-2-38	2	60.0	70.0
InDel-2-43	2	65.0	70.0
InDel-3-9	2	80.0	86.7
InDel-3-10	2	55.0	63.3
InDel-3-11	2	80.0	60.0
InDel-3-12	2	85.0	73.3
InDel-3-33	2	60.0	50.0
InDel-3-37	2	75.0	66.7

). These results indicate that the resistance-related loci associated with chromosome 2 in this experiment are reliable.

3.4. Construction of the Resistance Genetic Linkage Map

Utilizing the phenotypic data of 175 individual plants from the population, a genetic linkage map of the scab resistance gene region was constructed with the QTL IciMapping 4.2 software (Figure 4). The map has a total length of 104.59 cm and encompasses 8 SSR markers, namely SSR-1-19, SSR-1-35, SSR-2-9, SSR-2-29, SSR-2-53, SSR-3-11, SSR-3-19, SSR-3-65, and 10 InDel markers, including InDel-2-9, InDel-2-11, InDel-2-38, InDel-2-43, InDel-3-9, InDel-3-10, InDel-3-11, InDel-3-12, InDel-3-33, InDel-3-37. These markers are evenly dispersed across the linkage physical map, with an average inter-marker distance of 5.81 cm. Based on the newly developed SSR and InDel marker information, the genetic linkage map was further refined through fine-mapping. Currently, the markers at both ends of the region, SSR-2-9 and InDel-3-9, correspond to a physical interval of 41.33 Mb to 42.09 Mb. There are 13 co-segregating markers between these two markers.

3.5. Expression Level Analysis of Resistance Genes

In this study, candidate genes within the mapped interval were prioritized for annotation as NBS-LRR-type disease resistance gene homologs. Through comparative analysis using genomic databases such as NCBI and combined with sequence alignment, eight candidate genes were successfully annotated in the target interval (

Table 4. Genes Related to Resistance Within the Candidate Interval.

Number	ID	Description	Star	End
1	RHC02H2G2507	ATP-binding protein	41463591	41468173
2	RHC02H2G2515	Splicing factor, arginine/serine-rich	41537409	41546211
3	PGSC0003DMG400030643	AAR2 protein family	41772830	41772830
4	PGSC0003DMG401026400	CRS1	41432417	41438525
5	PGSC0003DMG400026379	ATP-binding protein	41527660	41530068
6	PGSC0003DMG400030658	Symbiosis receptor-like kinase	41983220	41988281
7	PGSC0003DMG400030661	ATP-binding protein	42020694	42021506
8	PGSC0003DMG400030625	Receptor protein kinase CLAVATA1	42176629	42180273

).

To determine the response of these candidate genes to scab disease infection in potato, qRT-PCR was performed to verify the expression levels of these four genes. Before inoculation, gene RHC02H2G2507 exhibited no significant differences in expression levels between the resistant and susceptible parents or between the resistant and susceptible progeny materials. After inoculation, the expression levels of the resistant parent H535 and the resistant progeny CS-6 increased significantly at 2 days post-inoculation. Meanwhile, the susceptible progeny CS-12 and CS-18 also showed elevated expression at 2 dpi. The expression in the susceptible parent H012 decreased at 2 and 4 dpi but increased at 7 dpi. Notably, the expression in resistant materials was significantly higher than that in susceptible materials. Gene RHC02H2G2515 showed no significant differences in expression between the resistant and susceptible parents or progeny materials. At 2 dpi after inoculation, the expression level of the resistant parent H535 increased, while that of the susceptible parent H012 decreased. As the stress duration extended, the expression levels remained low in all materials. Before inoculation, gene PGSC0003DMG400030643 demonstrated no significant differences in expression between the resistant and susceptible parents or progeny materials. At 2 dpi post-inoculation, the expression of the resistant parent and the resistant progeny CS-5 increased, while the susceptible progeny CS-18 showed upregulation at 4 dpi. The expression decreased at 2 and 7 dpi. Before inoculation, gene PGSC0003DMG400030661 showed no significant differences in expression levels among all materials. At 2 dpi, the expression in both resistant and susceptible parents and progeny decreased, with a substantial reduction. However, at 4 dpi and 7 dpi, the expression levels in resistant materials increased significantly, and the expression in resistant parents and progeny was significantly higher than that of the susceptible parent H012 and the susceptible materials (Figure 5). The other four genes showed no expression at all four time points.

Bars of different colors denote distinct stress treatment subjects. H18-24535 represents the resistant parent, H18-24012 represents the susceptible parent. CS-5, CS-6, and CS-11 are resistant offspring, whereas CS-12, CS-17, and CS-18 are susceptible offspring.

4. Discussion

4.1. Resistance Gene Mapping

In recent years, the damage inflicted by potato scab disease on the potato industry has been increasingly reported. Existing measures mainly concentrate on chemical and biological control, while reports on fundamental research, such as the chromosomal mapping of potato scab resistance genes, remain relatively scarce. Given the limited number of resistant potato varieties, wild potato relatives have emerged as an important source of novel genes in potato breeding. However, since most wild potato species are diploid, their genetic structures and resistance mechanisms still necessitate in-depth exploration. Studies demonstrate that evaluated scab disease coverage, severity, and incidence in a group of 384 diploid potato clones induced by ethyl methane sulfonate (EMS) under field conditions and conducted a genome-wide association study (GWAS) to analyze the genetic architecture of these traits. They identified 58 quantitative trait nucleotides (QTNs) or quantitative trait loci (QTLs) distributed across all 12 potato chromosomes, with 52 displaying significant allele effects on these three traits. The identified QTN/QTLs exhibited impacts ranging from low to high, highlighting the quantitative and polygenic nature of common scab resistance. Three QTLs/QTNs associated with common scab traits were located in genomic regions harboring 79 candidate genes involved in plant defense, cell-wall biosynthesis and modification, plant-pathogen interactions, and hormone signaling pathways, indicating their quantitative regulation by polygenes [29]. Moreover, evaluated scab disease lesion type and tuber lesion coverage in 198 segregating individuals for common scab resistance. To identify genetic features associated with resistance, they genotyped a tetraploid (4×) potato population and parents and carried out a genome-wide association study. They discovered two significant SNP markers on chromosome 1 associated with both common scab traits and one SNP marker on chromosome 2 associated with tuber lesion coverage. These results were consistent with previous studies that identified a QTL for scab resistance on chromosome 2. Whole-genome sequencing revealed that resistance genes were controlled by micro-effect polygenes. Consequently, this study focuses on the resistance-related QTL loci on chromosome 2 [40].

4.2. Candidate Gene Expression Level Analysis

Cloned disease resistance genes in plants frequently contain similar domains, such as leucine-rich repeats (LRR), nucleotide-binding sites (NBS), and transmembrane domains (TM) [41]. In this study, through alignment with the diploid potato DM1-3 reference genome, 83 annotated genes were identified in the fine-mapping interval, among which 14 genes had unknown functions. Based on the functional annotations of the conserved domains of these candidate genes, it was found that none contained typical LRR or NBS genes, nor were there any other functionally verified disease resistance genes. To explore the genes potentially associated with scab resistance, qRT-PCR was performed on resistant and susceptible parents, as well as some resistant and susceptible progeny before and after pathogen inoculation. The qRT-PCR analysis indicated that genes PGSC0003DMG400030643 and PGSC0003DMG400030661 were upregulated after pathogen infection, and their expression levels in resistant materials were significantly higher than those in susceptible materials. Therefore, these genes were selected as key research targets for further investigation. Previous candidate gene selection only encompassed genes that had been reported as potentially related to resistance, which might have led to the omission of some relevant genes. Thus, future experiments should validate the expression levels of other genes in resistant and susceptible single plants.

4.3. Candidate Gene Functional Analysis

The gene PGSC0003DMG400030661 encodes an ATP-binding protein, which contains three ATP/GTP-binding motifs: kinase-1a (also known as the P-loop), kinase-2, and kinase-3a motifs. In a membrane-binding assay, the purified I-2 protein was found to bind ATP, and the binding was entirely dependent on divalent cations, with no binding to other triphosphate nucleotides [42]. ATP-binding proteins constitute a large protein family widely distributed in both prokaryotes and eukaryotes. Arabidopsis contains 130 members, while rice contains 133 [43]. The presence of tandem amino-acid repeats (AAR) is a characteristic of eukaryotic proteins and is often involved in biomolecular interactions. Studies have demonstrated that the AAR content in dicotyledonous plants is positively correlated with the GC content of protein-coding sequences. mRNA decay rate, alternative splicing, and tissue-specificity are processes associated with proteins carrying AARs. A small fraction of these proteins may play a pivotal role and are widely regulated in plant cells [44].

Studies have shown that FgArb1, an ATP-binding protein, interacts with the mitogen-activated protein kinase (MAPK) FgSte7 and regulates the phosphorylation of FgGpmk1 (a downstream kinase of FgSte7), thereby partially regulating plant osmotic stress. The FgArb1 mutant exhibited a significantly reduced infection growth in wounded host tissue, possibly due to increased sensitivity to oxidative stress, cell-wall integrity defects, and reduced deoxynivalenol (DON) production [45]. ATP-binding proteins such as FgArb1 are crucial for Fusarium graminearum’s infection, osmotic stress tolerance, and normal growth. Becker JD [46]. found that nodulins like ENOD18, which belong to the ATP-binding protein family, are involved in nodulation in legumes. Yang R [47]. discovered that the MsABCG1 ATP-binding G transporter in alfalfa enhanced drought tolerance in transgenic tobacco, improving osmotic regulation and reducing lipid peroxidation. Wei Y [48] identified ZmMRPA6 as the first ABC transporter in maize associated with cold and salt tolerance, playing a crucial role in plant resistance to various abiotic stresses.

These findings suggest that ATP-binding proteins and AAR proteins play significant regulatory roles in plant biotic stress responses. Whether they mediate potato scab resistance remains to be verified through further experiments.

5. Conclusions

• A total of 214 pairs of SSR primers and 133 pairs of InDel primers were designed within the 38–43 Mb interval of chromosome 2. Through t-tests, 18 markers linked to resistance indentified. The linkage rates of three SSR markers with the disease-resistant trait in extreme materials ranged from 70.0% to 90.0%, and the linkage rates of six InDel markers with the disease-resistant trait were also 70.0–90.0%, which can be used for molecular marker-assisted selection.
• An 18-polymorphic-marker-based genetic linkage map with a total length of 104.59 cm was constructed. The scab resistance gene was mapped between the linkage markers SSR-2-9 and InDel-3-9, corresponding to the physical position within the 41.33–42.09 Mb interval on chromosome 2.
• The expression patterns of genes within the candidate region were verified using quantitative real-time PCR technology. The resistant and susceptible parent materials, as well as some resistant and susceptible progeny materials, were inoculated with the KS28-2 suspension. Samples were collected at four time points, namely 0 d (uninoculated control), 2 d, 4 d, and 7 d, for gene expression analysis. Resistance—related genes with significantly different expression levels between resistant and susceptible individuals were obtained.