Effects and Mechanism of Nitrogen Regulation on Seed Yield and Quality of Rapeseed (Brassica napus L.)
1
Hybrid Rapeseed Research Center of Shaanxi Province, Yangling 712100, China
2
College of Natural Resources and Environment, Northwest A&F University, Yangling 712100, China
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(5), 1232; https://doi.org/10.3390/agronomy15051232
Submission received: 15 April 2025
/
Revised: 11 May 2025
/
Accepted: 15 May 2025
/
Published: 19 May 2025
(This article belongs to the Section Soil and Plant Nutrition)
Abstract
:Appropriate nitrogen is required and important in grain yield formation of crops. To elucidate nitrogen regulation of seed yield and quality of rapeseed (Brassica napus L.), field trials were consecutively conducted in two years with three nitrogen levels of 0, 180, and 240 kg ha−1 (the N0, N180, and N240 treatments). The nitrogen application (N-app) induced increasing trend in the nitrogen accumulation in flowering plants (N-acc), number of siliques per plant (silique-num), number of branches per plant (branch-num), number of seeds per silique (seed-num), and seed yield of rapeseed; there were significant correlational relationships between these indexes (excepting seed-num). The N-app, N-acc, and silique-number showed higher effects on the seed yield. The effect of N-app was mainly achieved through influence on the silique-num, branch-num, and seed-num. When the N-app was increased from 180 to 240 kg ha−1, the nitrogen utilization efficiency (NUE) and the partial productivity of nitrogen fertilizer (PPN) of the rapeseed varieties tested showed a decreasing trend; the NR (nitrate reductase) gene expression level and the NR and GS (glutamine synthetase) activity in leaves was significantly increased under the N180 and N240 treatments compared to the N0 treatment, which achieved peak values at 180 kg ha−1 of N-app. The N-app hardly influenced the seed quality, as well as the gene expression and activity of the enzymes ACCase (acetyl-CoA carboxylase), FAD2 (oleic acid desaturase), and FAD3 (omega-3 fatty acid desaturase) in young seed. In conclusion, N-app induced significant increase in seed yield of rapeseed, the NR gene expression level and the NR and GS activity in leaves was improved; the NUE of rapeseed variety showed decreasing trend with increase in N-app level; while N-app hardly influenced the seed quality.
1. Introduction
Winter rapeseed (Brassica napus L.) is widely planted all over the world. The seeds of rapeseed are extracted to produce edible oil and industrial oil. Rapeseed oil achieved about 40% of the total amount of edible oil consumed in China. Also, rapeseed oil is a high-quality lubrication oil, which is extensively used in industry and used as potential energy material to synthesize biodiesel [1,2]. The seed yield of winter rapeseed is significantly increased by nitrogen application, which can be increased by 50.33% under 90 kg ha−1 nitrogen application [3,4]. However, excessive nitrogen application causes delaying ripening and lignin content reduction in the stems of rapeseed plants, and a large area of plant lodging is caused; thus, seed yield and seed oil content decline. These effects are mitigated by optimizing nitrogen application and suitable planting density [5,6].
Optimizing nitrogen application rate significantly improved grain yield and quality of crops [7]. Appropriate nitrogen levels improved chlorophyll content and net photosynthetic rate of rice flag leaves, and height and size of tobacco plants were increased. The rice grain yield and biomass production of tobacco were also increased; also, seed oil content, seed yield, and seed oil yield of the crops were enhanced with increasing nitrogen addition [8,9]. In some studies, as a result of nitrogen application the oil content was decreased in the seed of oilseed rape (Brassica napus L.), and it was not affected in the seed of winter mustard [10,11]. In other studies, the concentrations of fatty acids such as oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3) in seed oil were irregularly modified by nitrogen addition; or the contents of unsaturated fatty acids in seed oil were increased by nitrogen addition, while the contents of saturated fatty acids such as palmitic (C16:0) and stearic (C18:0) acid showed the opposite change trend [8,9,10,11,12]. Obviously, biomass and yields of seed and oil of crops could be improved by nitrogen application; there were variable effects of nitrogen on seed oil content and fatty acids concentration in oil.
The organic nitrogen in soil usually exists in forms of nitrate (NO3−) and ammonium (NH4+) [13,14]. The NO3− and NH4+ absorbed by the roots are transported to the aboveground part of the plant, the NO3− is converted into NH4+, and finally the NH4+ enters the glutamate cycle and ammonium assimilation process. These conversions are catalyzed by a series of enzymes such as nitrate reductase (NR, EC 1.7.1.3) and glutamine synthetase (GS, EC 6.3.1.2) [15]. NR is the first rate-limiting enzyme in the nitrate assimilation process; GS is crucial in nitrogen fixation, transfer, and storage [16,17,18,19].
Acetyl-CoA is a precursor for synthesizing saturated and unsaturated long chain fatty acids in oil crops, under catalytic action of key enzymes such as acetyl-CoA carboxylase (ACCase), oleic acid desaturase (FAD2), and omega-3 fatty acid desaturase (FAD3) [20,21]. ACCase is a rate-limiting enzyme in biosynthesizing oleic acid [22]. FAD2 catalyzes the transformation from oleic acid to linoleic acid [23]; FAD3 catalyzes the transformation from linoleic acid to α-linolenic acid [24]. Responding to nitrogen application, ACCase, FAD2, and FAD3 activity is changed and the biosynthesis of oil and fatty acids is influenced in the seed of crops.
There were inconsistent suggestions in nitrogen effect on grain yield and quality of crops in previous research. In order to increase seed yield and quality and improve the NUE of rapeseed, and to alleviate fertilizer loss and reduce environmental pollution, a two-year experiment was conducted with different rapeseed varieties used as materials in the study. The effects of nitrogen fertilizer application on seed yield and seed quality of rapeseed were measured; the activity and gene expression of key enzymes such as NR, GS, ACCase, FAD2, and FAD3 related to nitrogen metabolism and fatty acids synthesis were investigated. Basing on the results, the pattern and mechanism of N-app regulation on seed yield and seed quality of rapeseed was elaborated; this is important in providing a theoretical basis for related research and crop culture in the future.
2. Materials and Methods
2.1. Experiment Site and Soil
In this study, the field experiment was located at Zhou-jia-shan town, Mian county, Han-zhong City, China (33°09′ N, 106°54′ E). The location was in a subtropical zone with a continental monsoon climate. The average annual rain precipitation was 800–1000 mm and average annual temperature was 14 °C; in a year, the frost-free period was about 237 days and the temperature accumulation above 10 °C was 4480 °C. The experiment field was paddy soil with an original fertility of 26.3 g kg−1 organic matter, 1.95 g kg−1 total nitrogen, 8.35 mg kg−1 nitrate nitrogen, 4.18 mg kg−1 ammonium nitrogen, 30.51 mg kg−1 available phosphorus, 122.67 mg kg−1 available potassium, and pH of 5.91.
2.2. Materials, Experimental Design, and Field Management
Field trials were conducted from September 2022 to May 2023 and from September 2023 to May 2024, with three nitrogen application (N-app) levels of 0 kg ha−1 (N0, the control), 180 kg ha−1 (N180, middle level), and 240 kg ha−1 (N240, higher level). The area of each test plot was 3.0 m × 6.0 m, the urea (N content ≥ 46.0%) was used as nitrogen source, 70% of the nitrogen fertilizer was applied in the experimental field before sowing, and 30% of the nitrogen fertilizer was applied to the foliage of rapeseed plants during the over-wintering period. The fore-rotating crop was rice and soil (0–20 cm) was rototilled by a tractor before sowing. Meanwhile, basal fertilizers were applied in the field. The basal fertilizers included 90 kg/ha superphosphate (P2O5 ≥ 12%), 45 kg ha−1 potassium chloride (K2O ≥ 60%), and 15 kg ha−1 borax (B ≥ 11%).
Every treatment was conducted with five rapeseed varieties including Shan-You-28 (V1), Qin-You-28 (V2), Feng-You 737 (V3), Qin-You-10 (V4), and Zhong-You-Za-19 (V5). All these rape varieties (Brassica napus L.) were winter ecotype hybrids, and were suitable for planting in the Yangtze River valley and Huang-Huai River region in China. The height of these varieties was about 1.6 m. Every treatment was repeated three times, and the varieties tested were randomly arranged per repeat. The varieties were sowed on about 29 September, with plant spacing of 8.9 cm, row spacing of 30 cm, and plant density of 375,000 ha−1. The initial flowering date and ending flowering date of these varieties was on about 22 March and 13 April, respectively; the harvest date was around 15 May. Normal farming management was carried out in the experiment, and winter irrigation was applied in December.
2.3. Growth and Physiological Indexes
During the flowering stage and harvesting stage of the rapeseed varieties tested, plants in a 1.2 × 1 m2 area in each plot were harvested and measured for biological yield; ten plants in each plot were randomly selected and the stem, leaves, roots, inflorescence, silique shuck, and seeds were collected and weighed, respectively, and thus the biomass of different organs per plant was obtained. Nitrogen content in these organs was determined using a continuous flow analyzer (Auto-Analyzer 3, Ludwigshafen, Germany), and the nitrogen accumulation in flowering plants (N-acc) or in mature plants (N-acr) was calculated.
A total of ten plants in each plot were randomly selected on the third day before harvest, and the number of siliques per plant (silique-num) and number of branches per plant (branch-num) were investigated. A total of 50 siliques were picked from different branches of these plants to investigate the number of seeds per silique (seed-num). Fully ripened plants in a 1.2 × 2 m2 area sampled in every test plot were harvested and investigated for their 1000-seed weight and seed yield.
The oil content in seed (oil content) was measured by the nuclear magnetic resonance spectroscopy (NMR) method (NMR Analyzer, mq20, BRUKER, Rheinstetten, Germany); the oleic acid, linoleic acid and linoleic acid content in oil (oleic acid, linoleic acid, and linoleic acid content) was measured by the gas chromatography method (6890N GC, Aglient, Jefferson City, MO, USA); and the protein content in the seed (protein content) was measured by the near–infrared spectroscopy method (Fourier transform NIR spectrometer, Matrix-I, BRUKER, Ettlingen, Germany), with three repeats.
2.4. Activity and Gene Expression Level of the Enzymes Related to Nitrogen Metabolism and Fatty Acids Biosynthesis
Leaves were sampled during the flowering period, and green seeds were collected during the seed filling stage of the rapeseed varieties tested. The NR and GS activity in the leaves and the ACCase, FAD2, and FAD3 activity in the green seeds were measured by enzyme-linked immunosorbent assay (ELISA) kits. The RNA in the leaves and green seeds was extracted, and gene expression levels of the NR, GS, ACCase, FAD2, and FAD3 were detected according to the real-time fluorescence quantitative PCR (RT-qPCR) method on a PCR instrument (ABI 7500, Applied Biosystems, Foster City, CA, USA), with three repeats. The gene expression levels of these enzymes were analyzed according to the 2−ΔΔCt method [25,26]. The primers in the RT-qPCR detection were designed and are shown in Table 1 and Table 2, respectively.
2.5. Statistical Analysis
The test data were statistically computed by the Excel 2010 and DPS V7.05 analysis software, and Duncan’s comparison method, correlation analysis, and the linear regression method were used in the study. The partial productivity of nitrogen fertilizer (PPN) (kg kg−1) was computed according to the formula below:
PPN = Seed yield/N-app
The nitrogen utilization efficiency (NUE) was computed according to the formula below:
NUE (%) = 100% (N180-acr or N240-acr − N0-acr)/N-app
N180-acr, N240-acr or N0-acr refer to the nitrogen accumulation amount (kg ha−1) in ripened plants applied with 180 kg ha−1, 240 kg ha−1 or 0 kg ha−1 N-app, respectively.
3. Results
3.1. Effects of Nitrogen Application on Seed Yield of Rapeseed
3.1.1. Seed Yield and Nitrogen Accumulation in Plants of Different Rapeseed Varieties at Different Levels of Nitrogen Application
In the trials conducted in 2022–2023 or in 2023–2024, compared to the N0 treatment, the N180 and N240 treatments induced significant increases in the N-acc, seed yield, silique-num, and branch-num of the rapeseed varieties V1, V2, V3, V4, and V5. The seed-num of these rapeseed varieties showed an increasing trend, while the 1000-seed weight showed no significant change under the N0, N180, and N240 treatments in both the 2022–2023 and 2023–2024 trials (Table 3).
In the 2022–2023 trial, when the N-app level was increased from 180 to 240 kg ha−1, the N-acc of varieties V1 and V3, the branch-num of varieties V2, V4, and V5, the seed-num of variety V4, the silique-num of varieties V1, V2, V4, and V5, and the seed yield of varieties V1 and V5 were significantly increased, while these indexes in the rest of the rapeseed varieties tested showed no significant change in the rest of the rapeseed varieties tested (Table 3). In the 2023–2024 trial, when the N-app level was increased from 180 to 240 kg ha−1, the N-acc of varieties V2 and V3, the branch-num of varieties V1 and V2, and the seed yield of varieties V3 and V4 were significantly increased, while these indexes showed no significant change in the rest of the rapeseed varieties tested; also, the seed-num and silique-num of the rapeseed varieties tested showed no significant change (Table 3).
In short, with moderate N-app, the N-acc, seed yield, silique-num, and branch-num of rapeseed were significantly increased, and also the seed-num showed an increasing trend, while the 1000-seed weight showed no significant change; when the N-app increased from the middle level to a higher level these indexes (excepting the 1000-seed weight) showed a slight increasing trend.
3.1.2. Correlation Analysis of Nitrogen Levels, Nitrogen Accumulation in Plants, and Seed Yield Components of Rapeseed
As shown in Table 4, N-app was significantly correlated with N-acc, branch-num, seed-num, silique-num, and seed yield, with correlation coefficients of 0.922, 0.800, 0.631, 0.820, and 0.922, respectively; N-acc was significantly correlated with the branch-num, seed-num, silique-num, and seed yield, with correlation coefficients of 0.817, 0.528, 0.819, and 0.911, respectively; the branch-num was significantly correlated with the silique-num and seed yield, with correlation coefficients of 0.712 and 0.810, respectively; respectively, the seed-num and silique-num were significantly correlated with the seed yield; these correlation coefficients all achieved a very significant level (p ≤ 0.01). The correlation coefficients between the 1000-seed weight and the above indexes were insignificant. In a word, significant correlation relationships occurred between N-app, N-acc, branch-num, silique-num, and seed yield of rapeseed, and likewise between N-app, N-acc, seed-num, and seed yield.
3.1.3. Path Coefficient Analysis of Nitrogen Application Effect on Seed Yield of Rapeseed
A linear regression formula for the effects of N-app (x1), N-acc (x2), branch-num (x3), seed-num (x4), 1000-seed weight (x5) and silique-num (x6) on the seed yield (y) was calculated (correlation coefficient R = 0.9496, determination coefficient R2 = 0.9017, and p = 0.0001) based on the results of the two-year experiment, as the following:
y = −411.6 + 1.895 x1 + 5.356 x2 + 83.02 x3 + 53.45 x4 + 56.75 x5 + 7.473 x6
On the seed yield, silique-num showed the maximum direct effect with a path coefficient of 0.325; next came N-app, N-acc, branch-num and seed-num, with path coefficients of 0.254, 0.225, 0.137, and 0.136, respectively. The effect of N-app was achieved through influence on N-acc, branch-num, seed-num and silique-num, with path coefficients of 0.207, 0.110, 0.086 and 0.267, respectively; the effect of N-acc (x2) was achieved through influence on branch-num, seed-num, and silique-num, with path coefficients of 0.112, 0.072, and 0.266, respectively; and the effect of branch-num on seed yield was achieved through influence on silique-num, with a path coefficient 0.231; the effect of 1000-seed weight on the seed yield was slight with small path coefficients (Table 5). In brief, N-app, N-acc, and silique-num showed higher effects on the seed yield, the effect of N-app and N-acc was mainly achieved through influence on silique-num, branch-num, and seed-num, and the effect of branch-num was mainly achieved through influence on silique-num.
3.1.4. Influence of Nitrogen Application on Nitrogen Utilization Efficiency of Rapeseed
For the rapeseed varieties V1, V2, V3, V4, and V5, the PPN was significantly higher under the N180 treatment than that under the N240 treatment in the trial conducted in 2022–2023, and so was the PPN of these rapeseed varieties (excepting the V4) in the trial conducted in 2023–2024 (Figure 1). The PPN showed a decreasing trend with the increase in the N-app level.
The NUE of the varieties V2, V3, and V4 under the N180 treatment was significantly higher than that under the N240 treatment in the 2022–2023 trial, and so was the NUE of the varieties V1, V2, and V5 in the 2023–2024 trial (Figure 2). When N-app increased from 180 kg ha−1 to 240 kg ha−1, the NUE of the varieties V1 and V5 did not significantly change in the 2022–2023 trial, and neither did the NUE of the varieties V3 and V4 in the 2023–2024 trial (Figure 2). Generally, when the N-app increased the NUE of rapeseed varieties showed a decreasing trend.
3.1.5. Influence of Nitrogen Application on Activity and Gene Expression of the Key Enzymes Related to Nitrogen Metabolism
Compared to the N0 treatment, the N180 and N240 treatment induced a significant increase in the gene expression levels of NR and GS in leaves of the rapeseed varieties tested. The NR gene expression level in leaves of the V1, V2, and V5 varieties achieved peak values under the N180 treatment (Figure 3). The GS gene expression level in leaves of variety V1 was increased with N-app increasing from 0 to 180 and 240 kg ha−1, which for variety V5 was increased and achieved a peak value at 180 kg ha−1 N-app, but for the V2 variety showed no significant difference under the N180 and N240 treatments (Figure 3). Thus, N-app induced a significant increase in gene expression level of NR and GS in leaves of rapeseed; with N-app increasing from a middle level to a higher level NR gene expression level declined, but GS gene expression showed inconsistent changes in different rapeseed varieties.
Under the N180 and N240 treatments, the NR and GS activity in leaves of the rapeseed varieties tested was significantly enhanced compared to the N0 treatment; activity of both NR and GS achieved peak values under the N180 treatment, which significantly or insignificantly declined under the N240 treatment (Figure 4). Thus, the NR and GS activity in leaves of rapeseed was improved by nitrogen application and reached peak values at middle levels of nitrogen.
3.2. Effects of Nitrogen Application on Seed Quality of Rapeseed
3.2.1. Effects of Nitrogen Application on Seed Quality of Rapeseed
Under the N180 and N240 treatments, the oil content, protein content, and oleic acid, linoleic acid, and linolenic acid content of most of the rapeseed varieties tested showed no significant change compared to the N0 treatment, while N-acc was significantly increased and showed an increasing trend with N-app increasing from 180 to 240 kg ha−1 (Table 6). These results indicate that N-app promoted N-acc, while the seed quality was hardly influenced.
3.2.2. Correlation Relationships Between Nitrogen Application, Plant Nitrogen Accumulation, and Seed Quality of Rapeseed
N-app significantly correlated with N-acc, with a correlation coefficient of 0.920; neither N-app nor N-acc significantly correlated with the protein content, oil content, oleic acid, linoleic acid, or linolenic acid content, with small correlation coefficients (p ≤ 0.01 or p ≤ 0.05) (Table 7). The protein content negatively correlated with the oil and oleic acid content and positively correlated with the linolenic acid content (p ≤ 0.01 or p ≤ 0.05); the oil content positively correlated with the oleic acid content and negatively correlated with the linolenic acid content; and the oleic acid content negatively correlated with the linolenic acid content (p ≤ 0.01 or p ≤ 0.05) (Table 7). In short, N-app hardly influenced the seed quality, the seed protein content was significantly negatively correlated with oil content, and the seed oil content was positively or negatively correlated with the fatty acid content in oil.
3.2.3. Influence of Nitrogen Application on Activity and Gene Expression of Key Enzymes Related to Fatty Acids Synthesis
The activity of ACCase and FAD3 in young seed of varieties V1, V2, and V5 showed no significant change under the N0, N180, and N240 treatments, and neither did FAD2 in young seed of the V1 and V5 varieties; FAD2 activity in young seed of the V2 variety was significantly increased under the N180 treatment compared to that under the N0 and N240 treatments (Figure 5).
Gene expression levels of ACCase and FAD2 in young seed of the varieties V1, V2, and V5 showed no significant variation under the N0, N180, and N240 treatments; neither did FAD3 gene expression in young seed of the V1 and V5 varieties. The gene expression level of FAD3 in young seed of the V2 variety was significantly increased under the N180 treatment compared to that under the N0 and N240 treatments (Figure 6).
In general, the different levels of nitrogen induced no significant change in gene expression and activity of the enzymes related to oil synthesis in young seed of rapeseed.
4. Discussion
4.1. Effects of Nitrogen Application on Seed Yield of Rapeseed
The nitrogen absorbed and accumulated in plants during the vegetative growing stage and reproductive stage is transported into seeds, which directly influences the seed yield formation of the crop [27]. The nitrogen absorbed in the flowering season of maize plants accounts for about 50% of total nitrogen accumulation, and 80% of the total nitrogen accumulation is transferred into the seeds; about one-third of the nitrogen absorbed during the anthesis period is transferred into grains of wheat [28,29]. The seed yield of rapeseed shows an increasing trend and reaches a peak value with the increase in nitrogen application level [3,7]. As shown in this study, responding to the N-app, the N-acc of rapeseed was significantly increased, the seed yield, silique-num, branch-num, and seed-num of rapeseed showed increasing trends, and there were significant correlational relationships between these indexes (excepting the seed-num). N-app, N-acc, and silique-num showed higher effects on the seed yield. The effect of N-app was mainly achieved through influence on silique-num, branch-num, and seed-num, and the effect of branch-num was mainly achieved through influence on silique-num.
In a previous study, nitrogen application led to an increase in the 1000-seed weight of rapeseed [7]. While the 1000-seed of rapeseed was not significantly influenced by N-app in this study, which is seemingly a genetic trait, this needs further study in the future.
The amount of nitrogen absorbed in the plant in the reproductive stage, nitrogen remobilization, genotype, and cultivars complexly affect the seed yield and NUE of rapeseed [30]. The NUE and agronomic NUE (additional amount of grain harvested per kilogram of nitrogen applied) of canola and winter rapeseed were decreased by an increase in nitrogen application [31,32]. With high ammonium, the activity of the nitrate transporter NPF6.3 and ammonium transporters (AMTs) was inhibited by the activation of CIPK23 (calcineurin B like protein interacting with protein kinase 23). With a moderate ammonium supply or high nitrogen demand, CIPK23 was bound and inactivated by protein phosphatases (PP2C), and in this way the NUE of crops was regulated and the yield declined at high nitrogen levels [33]. In the present study, the PPN and NUE of the rapeseed varieties were higher at middle levels of nitrogen (180 kg ha−1) and declined at high levels of nitrogen (240 kg ha−1).
4.2. The Key Enzymes Related to Nitrogen Metabolism
NR and GS are key enzymes directly influencing the nitrogen metabolism rate and NUE of plants [34]. NR plays a central role in the conversion of nitrate to nitrite and in regulating plant growth; the nitrate is one of inducers of gene expression of NR, as are the light, light/dark variation, growth regulators, photosynthetic electron transport chain, and environmental stress [35]. NR activity is enhanced by PP2A (protein phosphatase 2A), which was roughly positively correlated with the expression level of auxin biosynthetic genes in roots of Arabidopsis; there was crosstalk between the nitrate signal and the auxin signal [33,36]. The plant GS enzyme is critical in synthesizing glutamine from glutamate and ammonium ion; a plant species with high activity of GS and glutamate dehydrogenase in the roots in darkness was ammonium tolerant and displayed a high capacity for nitrogen metabolism [37,38]. High nitrogen levels significantly increased yield and grain protein content, and coincidently the gene expression and activity of GS was significantly increased in wheat seed after anthesis [39]. Also, GS over-expression in plants induced enhancement in photorespiration capacity and tolerance to high temperature, salinity, drought, and oxidation [38]. In the present study, the gene expression levels and activity of NR and GS were significantly increased in leaves of rapeseed by N-app; NR gene expression level and NR and GS activity achieved peak values at middle level nitrogen when N-app increased from 0 to 180 and 240 kg ha−1.
4.3. Effects of Nitrogen Application on Seed Quality of Rapeseed
Previous researchers proposed that the oil content in rape seed declined with an increase in nitrogen application, while the seed protein content increased; in seed oil, the palmitic acid (C16:0) and stearic acid (C18:0) concentrations declined and the oleic acid (C18:1) concentration increased [3,10]. However, other researchers suggested that nitrogen application did not influence the oil content of rape seed and hardly influenced the fatty acids concentration in the oil, while the seed protein content was not significantly altered [40,41]. In this study, the oil content in seed was significantly negatively correlated with the protein content; the oil content positively correlated with the oleic acid content and negatively correlated with the linolenic acid content; however, N-app had slight negative or positive effects on the oil, protein, oleic acid, linoleic acid, and linolenic acid content. Thus, N-app hardly influenced the seed quality of rapeseed.
4.4. The Key Enzymes Related to Fatty Acids Synthesis
The ACCase, FAD2, and FAD3 (ω-3FAD) are rate-limiting enzymes in fatty acids synthesis. The activity of chloroplast ACCase was enhanced in algae culture under unfavorable culture conditions, and the contents of neutral lipid, fat, and monounsaturated fatty acids in the culture were increased [42]. When the ACCase gene was specifically expressed in seed of transgenic rape (Brassica napus), the oil content in seed was increased [43]. The Δfad2 gene encodes Δ12-fatty acid desaturase; with FAD2 gene deletion the yeast mutant grew slowly at 12 °C and 18:2 fatty acid was not detected [44]. In seed of a transgenic soybean with a down-regulated GmFAD2-1B gene, the oleic acid content significantly increased, and the linoleic acid and linolenic acid contents were concomitantly decreased compared to the wild type [45]. The ω-3FAD gene was induced by cold temperature and was involved in abiotic stress tolerance in cotton; in rice plants genetically modified with soybean ω-3FAD genes, the α-linolenic acid content was greatly increased in the rice bran oil [46,47]. In the present study, N-app generally induced no significant changes in gene expression and activity of the enzymes ACCase, FAD2, and FAD3 in young seed of rapeseed.
5. Conclusions
N-app induced a significant increase in seed yield of rapeseed, and there were significant correlational relationships between N-app, N-acc, branch-num, silique-num, seed-num, and seed yield. The effect of N-app, N-acc, and silique-num on seed yield was higher; the effect of N-app was mainly achieved through influences on silique-num, branch-num, and seed-num. The NUE and PPN of the rapeseed varieties generally showed a decreasing trend with the increase in N-app. By N-app, the gene expression level and activity of NR and GS in leaves of rapeseed were improved compared to the control, and the NR and GS activity achieved peak values at middle-level nitrogen (180 kg ha−1 N-app). N-app hardly influenced the seed quality, although there were slight negative/positive correlational relationships between N-app and the protein and oil content in seed and fatty acids content in oil. N-app generally induced no significant change in gene expression and activity of the enzymes ACCase, FAD2, and FAD3 in young seed.
Author Contributions
Conceptualization, C.W. and J.Y.; data curation, C.W., X.W. and J.Y.; formal analysis, C.W. and X.W.; investigation, C.W., X.W., J.Y., Z.Z. and M.C.; methodology, C.W., X.W., J.Y., Z.Z. and M.C.; project administration, J.Y.; visualization, C.W.; writing—original draft, C.W.; writing—review and editing, J.Y. All authors have read and agreed to the published version of the manuscript.
Funding
The work was financially supported by the research and development key project of Shaanxi province, China under grant number: 2024NC-ZDCYL-01-05.
Data Availability Statement
The raw data supporting the conclusions of this article will be made available by the authors on request.
Conflicts of Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Abbreviations
| ACCase | acetyl-CoA carboxylase |
| Branch-num | number of branches per plant |
| FAD2 | oleic acid desaturase |
| FAD3 | omega-3 fatty acid desaturase |
| GS | glutamine synthetase |
| N0 | 0 kg ha−1 nitrogen application |
| N180 | 180 kg ha−1 nitrogen application |
| N240 | 240 kg ha−1 nitrogen application |
| N-acc | nitrogen accumulation in flowering plants |
| N-acr | nitrogen accumulation in ripened plants |
| NMR | the nuclear magnetic resonance spectroscopy |
| NR | nitrate reductase |
| NUE | nitrogen utilization efficiency |
| PPN | partial productivity of nitrogen fertilizer |
| RT-qPCR | real-time fluorescence quantitative PCR |
| Seed-num | number of seeds per silique |
| Silique-num | number of siliques per plant |
References
- Stephenson, A.L.; Dennis, J.S.; Scott, S.A. Improving the sustainability of the production of biodiesel from oilseed rape in the UK. Process Saf. Environ. 2008, 86, 427–440. [Google Scholar] [CrossRef]
- Sulek, M.W.; Kulczychi, A.; Malysa, A. Assessment of lubricity of compositions of fuel oil with biocomponents derived from rape-seed. Wear 2010, 268, 104–108. [Google Scholar] [CrossRef]
- Yahbi, M.; Nabloussi, A.; Maataoui, A.; Alami, N.E.; Boutagayout, A.; Daoui, K. Effects of nitrogen rates on yield, yield components, and other related attributes of different rapeseed (Brassica napus L.) varieties. OCL-Oilseeds Fats Crops Lipids 2022, 29, 8. [Google Scholar] [CrossRef]
- Öztürk, Ö. Effects of source and rate of nitrogen fertilizer on yield, yield components and quality of winter rapeseed (Brassica napus L.). Chil. J. Agric. Res. 2010, 70, 132–141. [Google Scholar] [CrossRef]
- Kuai, J.; Sun, Y.; Zhou, M.; Zhang, P.; Zuo, Q.; Wu, J.; Zhou, G. The effect of nitrogen application and planting density on the radiation use efficiency and the stem lignin metabolism in rapeseed (Brassica napus L.). Field Crops Res. 2016, 199, 89–98. [Google Scholar] [CrossRef]
- Khan, S.; Anwar, S.; Kuai, J.; Noman, A.; Shahid, M.; Din, M.; Ali, A.; Zhou, G. Alteration in yield and oil quality traits of winter rapeseed by lodging at different planting density and nitrogen rates. Sci. Rep. 2018, 8, 634. [Google Scholar] [CrossRef]
- Khan, S.; Anwar, S.; Kuai, J.; Ullah, S.; Fahad, S.; Zhou, G. Optimization of nitrogen rate and planting density for improving yield, nitrogen use efficiency, and lodging resistance in oilseed rape. Front. Plant Sci. 2017, 8, 532. [Google Scholar] [CrossRef]
- Chen, G.; Li, C.; Hu, M.; He, X.; Yang, H.; Zhang, Q.; Wu, C.; Duan, Q.; Peng, L.; Zhang, Y.; et al. Evaluating rice lipid content, yield, and quality in response to nitrogen application rate and planting density. Front. Plant Sci. 2024, 15, 1469264. [Google Scholar] [CrossRef]
- Lin, Y.; Kong, D.; Wang, Z.; Chen, Y.; Yang, Z.; Wu, C.; Yang, H.; Chen, L. Nitrogen application modifies the seed and oil yields and fatty acid composition of nicotiana tabacum. Hortscience 2020, 55, 1898–1902. [Google Scholar] [CrossRef]
- Gu, H.; Li, J.; Lu, Z.; Li, X.; Cong, R.; Ren, T.; Lu, J. Effects of combined application of nitrogen and potassium on oil concentration and fatty acid component of oilseed rape (Brassica napus L.). Field Crops Res. 2024, 306, 109229. [Google Scholar] [CrossRef]
- Zheljazkov, V.D.; Vick, B.; Ebelhar, M.W.; Buehring, N.; Astatkie, T. Nitrogen applications modify seed and oil yields and fatty acid composition of winter mustard. Ind. Crops Prod. 2012, 36, 28–32. [Google Scholar] [CrossRef]
- Zapletalová, A.; Ducsay, L.; Varga, L.; Sitkey, J.; Javoreková, S.; Hozlár, P. Influence of Nitrogen Nutrition on Fatty Acids in Oilseed Rape (Brassica napus L.). Plants 2022, 11, 44. [Google Scholar] [CrossRef] [PubMed]
- Salmenkallio, M.; Sopanen, T. Amino acid and peptide uptake in the scutella of germinating grains of barley, wheat, rice, and maize. Plant Physiol. 1989, 89, 1285–1291. [Google Scholar] [CrossRef]
- Sohlenkamp, C.; Wood, C.C.; Roeb, G.W.; Udvardi, M.K. Characterization of Arabidopsis AtAMT2, a high-affinity ammonium transporter of the plasma membrane. Plant Physiol. 2002, 130, 1788–1796. [Google Scholar] [CrossRef]
- Zhan, N.; Xu, K.; Ji, G.; Yan, G.; Chen, B.; Wu, X.; Cai, G. Research progress in high-efficiency utilization of nitrogen in rapeseed. Int. J. Mol. Sci. 2023, 24, 7752. [Google Scholar] [CrossRef]
- Miflin, B.J. The location of nitrite reductase and other enzymes related to amino acid biosynthesis in the plastids of root and leaves. Plant Physiol. 1974, 54, 550–555. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, H.S. Regulation of nitrate reductase activity in higher plants. Phytochemistry 1980, 19, 725–733. [Google Scholar] [CrossRef]
- Masclaux-Daubresse, C.; Daniel-Vedele, F.; Dechorgnat, J.; Chardon, F.; Gaufichon, L.; Suzuki, A. Nitrogen uptake, assimilation and remobilization in plants: Challenges for sustainable and productive agriculture. Ann. Bot. 2010, 105, 1141–1157. [Google Scholar] [CrossRef] [PubMed]
- Maeda, S.-I.; Konishi, M.; Yanagisawa, S.; Omata, T. Nitrite transport activity of a novel HPP family protein conserved in cyanobacteria and chloroplasts. Plant Cell Physiol. 2014, 55, 1311–1324. [Google Scholar] [CrossRef] [PubMed]
- Nikolau, B.J.; Ohlrogge, J.B.; Wurtele, E.S. Plant biotin-containing carboxylases. Arch. Biochem. Biophys. 2003, 414, 211–222. [Google Scholar] [CrossRef]
- Zhao, S.; Zhang, X.; Su, Y.; Chen, Y.; Liu, Y.; Sun, M.; Qi, G. Transcriptome analysis reveals dynamic fat accumulation in the Walnut Kernel. Int. J. Genom. 2018, 2018, 8931651. [Google Scholar] [CrossRef] [PubMed]
- Modiri, S.; Zahiri, H.S.; Vali, H.; Noghabi, K.A. Evaluation of transcription profile of acetyl-CoA carboxylase (ACCase) and acyl-ACP synthetase (AAS) to reveal their roles in induced lipid accumulation of Synechococcus sp. HS01. Renew. Energy 2018, 129, 347–356. [Google Scholar] [CrossRef]
- Dar, A.A.; Choudhury, A.R.; Kancharla, P.K.; Arumugam, N. The FAD2 gene in plants: Occurrence, regulation, and role. Front. Plant Sci. 2017, 8, 1789. [Google Scholar] [CrossRef]
- O’Neill, C.M.; Gill, S.; Hobbs, D.; Morgan, C.; Bancroft, I. Natural variation for seed oil composition in Arabidopsis thaliana. Phytochemistry 2003, 64, 1077–1090. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Adnan, M.; Morton, G.; Hadi, S. Analysis of rpoS and bolA gene expression under various stress-induced environments in planktonic and biofilm phase using 2−ΔΔCT method. Mol. Cell. Biochem. 2011, 357, 275–282. [Google Scholar] [CrossRef]
- Bogard, M.; Jourdan, M.; Allard, V.; Martre, P.; Perretant, M.R.; Ravel, C.; Heumez, E.; Orford, S.; Snape, J.; Griffiths, S.; et al. Anthesis date mainly explained correlations between post-anthesis leaf senescence, grain yield, and grain protein concentration in a winter wheat population segregating for flowering time QTLs. J. Exp. Bot. 2011, 62, 3621–3636. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Serret, M.D.; Elazab, A.; Bort, P.J.; Araus, J.L.; Aranjuelo, I.; Sanz-Sáez, Á. Wheat ear carbon assimilation and nitrogen remobilization contribute significantly to grain yield. J. Integr. Plant Biol. 2016, 58, 914–926. [Google Scholar] [CrossRef]
- Yang, L.; Guo, S.; Chen, Q.; Chen, F.; Yuan, L.; Mi, G. Use of the stable nitrogen isotope to reveal the source-sink regulation of nitrogen uptake and remobilization during grain filling phase in maize. PLoS ONE 2016, 11, e162201. [Google Scholar] [CrossRef]
- Bouchet, A.; Laperche, A.; Bissuel-Belaygue, C.; Snowdon, R.; Nesi, N.; Stahl, A. Nitrogen use efficiency in rapeseed. A review. Agron. Sustain. Dev. 2016, 36, 38. [Google Scholar] [CrossRef]
- Ma, B.L.; Herath, A.W. Timing and rates of nitrogen fertiliser application on seed yield, quality and nitrogen-use efficiency of canola. Crop Pasture Sci. 2016, 67, 167–180. [Google Scholar] [CrossRef]
- Sieling, K.; Böttcher, U.; Kage, H. Effect of sowing method and N application on seed yield and N use efficiency of winter oilseed rape. Agronomy 2017, 7, 21. [Google Scholar] [CrossRef]
- Sathee, L.; Krishna, G.K.; Adavi, S.B.; Jha, S.K.; Jain, V. Role of protein phosphatases in the regulation of nitrogen nutrition in plants. Physiol. Mol. Biol. Plants 2021, 27, 2911–2922. [Google Scholar] [CrossRef]
- Ahmad, A.; Sivakami, S.; Nandula, R.; Ali, A.; Raghuram, N. Effect of nitrate, nitrite, ammonium, glutamate, glutamine and 2-oxoglutarate on the RNA levels and enzyme activities of nitrate reductase and nitrite reductase in rice. Physiol. Mol. Biol. Plants 2007, 13, 17–25. [Google Scholar]
- Rohilla, P.; Yadav, J.P. Nitrate reductase structure, role and factors affecting its regulation: A review. Plant Arch. 2020, 20, 5787–5793. [Google Scholar]
- Fu, Y.-F.; Zhang, Z.-W.; Yang, X.-Y.; Wang, C.-Q.; Lan, T.; Tang, X.-Y.; Chen, G.-D.; Zeng, J.; Yuan, S. Nitrate reductase is a key enzyme responsible for nitrogen-regulated auxin accumulation in Arabidopsis roots. Biochem. Biophys. Res. Commun. 2020, 532, 633–639. [Google Scholar] [CrossRef] [PubMed]
- Cruz, C.; Bio, A.F.M.; Domínguez-Valdivia, M.D.; Aparicio-Tejo, P.M.; Lamsfus, C.; Martins-Loução, M.A. How does glutamine synthetase activity determine plant tolerance to ammonium? Planta 2006, 223, 1068–1080. [Google Scholar] [CrossRef]
- Yin, H.; Yang, F.; He, X.; Du, X.; Mu, P.; Ma, W. Advances in the functional study of glutamine synthetase in plant abiotic stress tolerance response. Crop J. 2022, 10, 917–923. [Google Scholar] [CrossRef]
- Zhang, M.; Ma, D.; Ma, G.; Wang, C.; Xie, X.; Kang, G. Responses of glutamine synthetase activity and gene expression to nitrogen levels in winter wheat cultivars with different grain protein content. J. Cereal Sci. 2017, 74, 187–193. [Google Scholar] [CrossRef]
- Zhang, Z.; Song, H.; Liu, Q.; Rong, X.; Peng, J.; Xie, G.; Zhang, Y.; Chen, L.; Guan, C.; Gu, J. Responses of Seed Yield and Quality to Nitrogen Application Levels in Two Oilseed Rape (Brassica napus L.) Varieties Differing in Nitrogen Efficiency. Plant Prod. Sci. 2012, 15, 265–269. [Google Scholar] [CrossRef]
- Tian, C.; Zhou, X.; Liu, Q.; Peng, J.; Zhang, Z.; Song, H.; Ding, Z.; Zhran, M.A.; Eissa, M.A.; Kheir, A.M.S.; et al. Increasing yield, quality and profitability of winter oilseed rape (Brassica napus) under combinations of nutrient levels in fertiliser and planting density. Crop Pasture Sci. 2020, 71, 1010–1019. [Google Scholar] [CrossRef]
- Li, D.W.; Xie, W.H.; Hao, T.B.; Cai, J.X.; Zhou, T.B.; Balamurugan, S.; Yang, W.D.; Liu, J.S.; Li, H.Y. Constitutive and chloroplast targeted expression of acetyl-CoA carboxylase in oleaginous microalgae elevates fatty acid biosynthesis. Mar. Biotechnol. 2018, 20, 566–572. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.L.; Wu, G.T.; Lang, C.X.; Liu, R.H. Influence on Brassica seed oil content by transformation with heteromeric acetyl-CoA carboxylase (ACCase) Gene. Mol. Plant Breed. 2017, 15, 920–927. (In Chinese) [Google Scholar]
- Tezaki, S.; Iwama, R.; Kobayashi, S.; Shiwa, Y.; Yoshikawa, H.; Ohta, A.; Horiuchi, H.; Fukuda, R. Δ12-fatty acid desaturase is involved in growth at low temperature in yeast Yarrowia lipolytica. Biochem. Biophys. Res. Commun. 2017, 488, 165–170. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Xing, G.; Niu, L.; He, H.; Guo, D.; Du, Q.; Qian, X.; Yao, Y.; Li, H.; Zhong, X.; et al. Improved oil quality in transgenic soybean seeds by RNAi-mediated knockdown of GmFAD2-1B. Transgenic Res. 2018, 27, 155–166. [Google Scholar] [CrossRef]
- Yin, Z.J.; Liu, H.L.; Dong, X.B.; Tian, L.H.; Xiao, L.; Xu, Y.N.; Qu, L.Q. Increasing α-linolenic acid content in rice bran by embryo-specific expression of ω3/Δ15-desaturase gene. Mol. Breed. 2014, 33, 987–996. [Google Scholar] [CrossRef]
- Yurchenko, O.P.; Park, S.; Ilut, D.C.; Inmon, J.J.; Millhollon, J.C.; Liechty, Z.; Page, J.T.; Jenks, M.A.; Chapman, K.D.; Udall, J.A.; et al. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium. BMC Plant Biol. 2014, 14, 312. [Google Scholar] [CrossRef]
Figure 1.
The partial productivity of nitrogen fertilizer (PPN) of different rapeseed varieties. Error lines represent the standard deviation; different lower-case letters above the bars indicate significant difference under different levels of N-app in a rapeseed variety (p ≤ 0.05); the same below.
Figure 1.
The partial productivity of nitrogen fertilizer (PPN) of different rapeseed varieties. Error lines represent the standard deviation; different lower-case letters above the bars indicate significant difference under different levels of N-app in a rapeseed variety (p ≤ 0.05); the same below.
Figure 2.
The nitrogen utilization efficiency (NUE) of rapeseed varieties.
Figure 3.
Gene expression levels of the key enzymes related to nitrogen metabolism.
Figure 4.
Activity of the key enzymes related to nitrogen metabolism.
Figure 5.
Activity of the key enzymes related to fatty acids synthesis in young seed of rapeseed.
Figure 6.
Gene expression levels of the key enzymes related to fatty acids synthesis in young seed of rapeseed.
Figure 6.
Gene expression levels of the key enzymes related to fatty acids synthesis in young seed of rapeseed.
Table 1.
The RT-qPCR primers for gene expression of the enzymes related to nitrogen assimilation.
| Gene | Primer Sequence (5′-3′) | Size (bp) | |
|---|---|---|---|
| NR | Forward | GCAAGTTCTGGTGCTGGTGTTTC | 123 |
| Reverse | AGATGAGTTTTTCAGGCTGGGTG | ||
| GS | Forward | AAACAGAGCAGCAGCAAAGTCAG | 116 |
| Reverse | CGGTCAGTGAAAGGTTTGGTGTC | ||
| EF1-α | Forward | GCCTGGTATGGTTGTGACCT | 202 |
| Reverse | GAAGTTAGCAGCACCCTTGG |
Table 2.
The RT-qPCR primers for gene expression of the enzymes related to fatty acids biosynthesis.
Table 2.
The RT-qPCR primers for gene expression of the enzymes related to fatty acids biosynthesis.
| Gene | Primer Sequence (5′-3′) | Size (bp) | |
|---|---|---|---|
| ACCase | Forward | AGGACTTGCCAATCTTCTAAAC | 158 |
| Reverse | AGCTTCTTTCACCGTAGGACAC | ||
| FAD2 | Forward | CACCACGCCTTCAGCGACTAC | 162 |
| Reverse | CTTCTTCTTGGGGACAAACACTTC | ||
| FAD3 | Forward | TTCCCACAAATCCCTCACTATCA | 132 |
| Reverse | ACTTGCCACCAAACTTTCCACC | ||
| EF1-α | Forward | GCCTGGTATGGTTGTGACCT | 202 |
| Reverse | GAAGTTAGCAGCACCCTTGG |
Table 3.
Influence of nitrogen application on seed yield components and nitrogen accumulation in flowering plants of rapeseed.
Table 3.
Influence of nitrogen application on seed yield components and nitrogen accumulation in flowering plants of rapeseed.
| Growing Season | Rapeseed Variety | N-app (kg ha−1) | N-acc (kg ha−1) | Branch-num | Seed-num | 1000-Seed Weight (g) | Silique-num | Seed Yield (kg ha−1) |
|---|---|---|---|---|---|---|---|---|
| 2022–2023 | V1 | 0 | 45.7 ± 3.44 c | 1.77 ± 0.322 b | 20.2 ± 1.34 b | 4.03 ± 0.116 a | 76.5 ± 9.46 c | 1907.8 ± 96.61 c |
| 180 | 79.1 ± 9.29 b | 3.60 ± 0.520 a | 23.7 ± 0.53 a | 3.90 ± 0.058 a | 122.2 ± 3.10 b | 3170.2 ± 201.98 b | ||
| 240 | 124.7 ± 16.10 a | 3.90 ± 0.265 a | 24.9 ± 0.67 a | 3.97 ± 0.058 a | 149.1 ± 7.81 a | 3514.7 ± 48.21 a | ||
| V2 | 0 | 39.5 ± 6.15 b | 1.50 ± 0.200 c | 19.7 ± 0.63 b | 3.50 ± 0.173 a | 82.0 ± 6.93 c | 1848.5 ± 77.22 b | |
| 180 | 88.8 ± 8.71 a | 3.50 ± 0.173 b | 22.8 ± 0.95 a | 3.40 ± 0.100 a | 133.8 ± 10.45 b | 3201.7 ± 123.24 a | ||
| 240 | 97.5 ± 6.38 a | 4.17 ± 0.153 a | 23.3 ± 0.48 a | 3.43 ± 0.058 a | 159.1 ± 8.71 a | 3265.7 ± 97.96 a | ||
| V3 | 0 | 31.9 ± 3.83 c | 2.40 ± 0.400 b | 18.5 ± 1.13 a | 3.57 ± 0.153 a | 95.0 ± 6.84 b | 1943.2 ± 148.11 b | |
| 180 | 96.2 ± 11.73 b | 4.73 ± 0.231 a | 19.3 ± 1.45 a | 3.53 ± 0.153 a | 166.1 ± 10.16 a | 3698.0 ± 142.20 a | ||
| 240 | 124.0 ± 8.80 a | 4.97 ± 0.208 a | 19.9 ± 0.49 a | 3.63 ± 0.116 a | 174.0 ± 8.95 a | 3727.0 ± 161.21 a | ||
| V4 | 0 | 35.8 ± 7.10 b | 1.43 ± 0.322 c | 18.1 ± 0.76 c | 3.33 ± 0.058 a | 76.0 ± 5.37 c | 1734.9 ± 111.93 b | |
| 180 | 82.2 ± 7.99 a | 4.37 ± 0.116 b | 23.8 ± 0.85 a | 3.30 ± 0.100 a | 134.1 ± 6.26 b | 2924.1 ± 183.53 a | ||
| 240 | 94.3 ± 8.67 a | 5.00 ± 0.100 a | 21.7 ± 1.35 b | 3.17 ± 0.116 a | 162.6 ± 11.08 a | 3163.8 ± 79.82 a | ||
| V5 | 0 | 38.4 ± 5.68 b | 1.93 ± 0.231 c | 21.2 ± 0.72 b | 4.27 ± 0.058 a | 82.5 ± 7.95 c | 1890.2 ± 77.09 c | |
| 180 | 83.8 ± 10.12 a | 3.90 ± 0.361 b | 21.8 ± 0.90 ab | 4.13 ± 0.116 a | 112.0 ± 7.58 b | 3004.7 ± 135.94 b | ||
| 240 | 78.2 ± 4.88 a | 4.63 ± 0.404 a | 23.2 ± 0.41 a | 4.13 ± 0.208 a | 146.6 ± 6.39 a | 3532.9 ± 88.01 a | ||
| 2023–2024 | V1 | 0 | 44.6 ± 6.10 b | 3.37 ± 0.116 c | 20.6 ± 0.83 b | 4.40 ± 0.132 a | 72.0 ± 8.26 b | 2099.7 ± 154.83 b |
| 180 | 109.0 ± 11.45 a | 5.67 ± 0.208 a | 22.6 ± 0.80 a | 4.35 ± 0.05 a | 121.4 ± 1.41 a | 3533.9 ± 69.81 a | ||
| 240 | 104.0 ± 9.26 a | 5.13 ± 0.252 b | 23.3 ± 0.65 a | 4.27 ± 0.029 a | 119.2 ± 10.65 a | 3700.2 ± 177.89 a | ||
| V2 | 0 | 44.1 ± 5.31 c | 3.53 ± 0.231 c | 21.3 ± 0.79 a | 3.87 ± 0.076 a | 79.3 ± 9.28 b | 2286.3 ± 118.12 c | |
| 180 | 98.3 ± 6.40 b | 4.40 ± 0.300 b | 22.8 ± 0.42 a | 3.88 ± 0.153 a | 133.8 ± 6.25 a | 3584.1 ± 179.08 a | ||
| 240 | 123.6 ± 4.94 a | 5.13 ± 0.322 a | 22.8 ± 0.96 a | 3.93 ± 0.076 a | 119.4 ± 10.44 a | 3305.9 ± 151.95 a | ||
| V3 | 0 | 35.0 ± 9.83 c | 3.90 ± 0.265 b | 18.8 ± 1.01 a | 4.15 ± 0.002 a | 77.6 ± 4.81 b | 1705.7 ± 80.99 c | |
| 180 | 100.3 ± 7.70 b | 5.93 ± 0.252 a | 19.6 ± 0.50 a | 4.35 ± 0.087 a | 158.7 ± 1.56 a | 3368.2 ± 102.76 b | ||
| 240 | 135.9 ± 10.81 a | 6.20 ± 0.300 a | 19.4 ± 0.89 a | 4.37 ± 0.076 a | 170.9 ± 10.28 a | 3798.8 ± 183.11 a | ||
| V4 | 0 | 29.1 ± 7.33 b | 2.87 ± 0.153 b | 17.7 ± 0.62 b | 3.80 ± 0.001 a | 69.1 ± 9.12 b | 1252.1 ± 90.31 c | |
| 180 | 89.3 ± 5.69 a | 5.03 ± 0.208 a | 22.2 ± 0.43 a | 3.80 ± 0.050 a | 116.9 ± 10.40 a | 2826.7 ± 76.84 b | ||
| 240 | 83.8 ± 5.86 a | 4.87 ± 0.153 a | 22.7 ± 0.56 a | 3.75 ± 0.001 a | 108.7 ± 3.35 a | 3761.8 ± 178.75 a | ||
| V5 | 0 | 37.0 ± 4.84 b | 3.00 ± 0.100 b | 21.0 ± 0.64 b | 4.78 ± 0.161 a | 77.3 ± 6.75 b | 1943.3 ± 149.93 b | |
| 180 | 102.4 ± 7.08 a | 4.33 ± 0.208 a | 23.8 ± 1.05 a | 4.60 ± 0.150 a | 95.2 ± 4.40 a | 2999.4 ± 173.50 a | ||
| 240 | 94.6 ± 9.57 a | 4.53 ± 0.306 a | 23.1 ± 0.69 a | 4.47 ± 0.202 a | 104.5 ± 6.48 a | 2788.4 ± 165.85 a |
Note: When the data in a column for a rapeseed variety are followed by different lower-case letters, this indicates a significant difference under different levels of N-app (p ≤ 0.05); the same below.
Table 4.
Correlation coefficients between nitrogen application, nitrogen accumulation in plants, and seed yield components of rapeseed.
Table 4.
Correlation coefficients between nitrogen application, nitrogen accumulation in plants, and seed yield components of rapeseed.
| Factor | N-app | N-acc | Branch-num | Seed-num | 1000-Seed Weight | Silique-num |
|---|---|---|---|---|---|---|
| N-acc | 0.920 ** | — | — | — | — | — |
| Branch-num | 0.800 ** | 0.817 ** | — | — | — | — |
| Seed-num | 0.631 ** | 0.528 ** | 0.352 | — | — | — |
| 1000-seed weight | −0.060 | 0.050 | 0.196 | 0.121 | — | — |
| Silique-num | 0.820 ** | 0.819 ** | 0.712 ** | 0.293 | −0.259 | — |
| Seed yield | 0.922 ** | 0.911 ** | 0.810 ** | 0.562 ** | −0.014 | 0.848 ** |
Note: —, blank; ** indicates significance levels of p ≤ 0.01.
Table 5.
Path coefficients of effects of nitrogen application, nitrogen accumulation, and seed yield components on seed yield of rapeseed.
Table 5.
Path coefficients of effects of nitrogen application, nitrogen accumulation, and seed yield components on seed yield of rapeseed.
| Effect | N-app (x1) | N-acc (x2) | Branch-num (x3) | Seed-num (x4) | 1000-Seeds Weight (x5) | Silique-num (x6) |
|---|---|---|---|---|---|---|
| Direct effect | 0.254 | 0.225 | 0.137 | 0.136 | 0.031 | 0.325 |
| Through x1 | — | — | — | — | — | — |
| Through x2 | 0.207 | — | — | — | — | — |
| Through x3 | 0.110 | 0.112 | — | — | — | — |
| Through x4 | 0.086 | 0.072 | 0.048 | — | — | — |
| Through x5 | −0.002 | 0.002 | 0.006 | 0.004 | — | — |
| Through x6 | 0.267 | 0.266 | 0.231 | 0.095 | −0.084 | — |
Table 6.
The plant nitrogen accumulation and seed quality of different rapeseed varieties under different levels of nitrogen application.
Table 6.
The plant nitrogen accumulation and seed quality of different rapeseed varieties under different levels of nitrogen application.
| Growing Season | Rapeseed Variety | N-app (kg ha−1) | N-acc (kg ha−1) | Oil Content (%) | Protein Content (%) | Oleic Acid Content (%) | Linoleic Acid Content (%) | Linolenic Acid Content (%) |
|---|---|---|---|---|---|---|---|---|
| 2022–2023 | V1 | 0 | 45.7 ± 3.44 c | 44.3 ± 0.99 a | 21.2 ± 0.84 a | 60.0 ± 2.97 a | 15.8 ± 0.22 a | 9.27 ± 0.265 a |
| 180 | 79.1 ± 9.29 b | 44.6 ± 0.53 a | 20.4 ± 0.25 a | 60.2 ± 1.83 a | 15.9 ± 0.48 a | 9.23 ± 0.544 a | ||
| 240 | 124.7 ± 16.10 a | 42.7 ± 1.60 a | 22.1 ± 1.28 a | 58.4 ± 2.69 a | 16.5 ± 0.31 a | 8.98 ± 0.217 a | ||
| V2 | 0 | 39.5 ± 6.15 b | 45.3 ± 0.15 b | 20.4 ± 0.54 a | 63.7 ± 1.87 a | 14.5 ± 0.54 a | 8.83 ± 0.479 a | |
| 180 | 88.8 ± 8.71 a | 45.8 ± 0.30 ab | 19.5 ± 0.50 ab | 58.3 ± 3.15 a | 14.8 ± 0.87 a | 9.00 ± 0.325 a | ||
| 240 | 97.5 ± 6.38 a | 46.3 ± 0.45 a | 19.3 ± 0.39 b | 57.4 ± 5.12 a | 15.4 ± 0.64 a | 9.40 ± 0.340 a | ||
| V3 | 0 | 31.9 ± 3.83 c | 45.7 ± 1.79 a | 19.9 ± 1.26 a | 64.1 ± 2.62 ab | 14.7 ± 0.40 a | 8.60 ± 0.272 a | |
| 180 | 96.2 ± 11.73 b | 44.8 ± 1.50 a | 20.0 ± 1.29 a | 60.3 ± 3.25 b | 14.7 ± 0.84 a | 8.80 ± 0.162 a | ||
| 240 | 124.0 ± 8.80 a | 46.6 ± 1.59 a | 18.5 ± 1.58 a | 67.3 ± 2.59 a | 14.0 ± 0.62 a | 8.50 ± 0.256 a | ||
| V4 | 0 | 35.8 ± 7.10 b | 46.3 ± 1.14 a | 19.3 ± 0.65 a | 63.9 ± 1.59 a | 14.6 ± 0.27 a | 8.94 ± 0.301 ab | |
| 180 | 82.2 ± 7.99 a | 46.7 ± 0.52 a | 18.4 ± 0.23 a | 62.9 ± 2.05 a | 14.3 ± 0.39 a | 9.14 ± 0.093 a | ||
| 240 | 94.3 ± 8.67 a | 47.1 ± 1.07 a | 18.2 ± 0.74 a | 65.0 ± 0.91 a | 14.7 ± 0.43 a | 8.61 ± 0.280 b | ||
| V5 | 0 | 38.4 ± 5.68 b | 47.9 ± 0.90 a | 19.2 ± 0.37 a | 64.2 ± 2.76 a | 12.7 ± 0.60 a | 8.49 ± 0.213 a | |
| 180 | 83.8 ± 10.12 a | 47.7 ± 0.39 a | 19.5 ± 0.28 a | 64.9 ± 0.10 a | 12.5 ± 0.54 a | 8.62 ± 0.169 a | ||
| 240 | 78.2 ± 4.88 a | 46.7 ± 2.03 a | 19.5 ± 0.93 a | 61.4 ± 2.53 a | 13.1 ± 1.47 a | 8.64 ± 0.347 a | ||
| 2023–2024 | V1 | 0 | 44.6 ± 6.10 b | 48.6 ± 0.44 a | 19.7 ± 0.33 a | 65.8 ± 5.20 a | 17.1 ± 0.83 a | 8.58 ± 0.245 a |
| 180 | 109.0 ± 11.45 a | 48.4 ± 1.18 a | 20.2 ± 1.08 a | 64.0 ± 2.88 a | 17.5 ± 0.42 a | 8.46 ± 0.250 a | ||
| 240 | 104.0 ± 9.26 a | 48.1 ± 0.22 a | 20.5 ± 0.17 a | 65.7 ± 2.06 a | 17.9 ± 0.73 a | 8.53 ± 0.437 a | ||
| V2 | 0 | 44.1 ± 5.31 c | 48.6 ± 0.64 a | 19.3 ± 0.82 a | 67.5 ± 2.22 a | 16.9 ± 0.58 a | 8.41 ± 0.296 a | |
| 180 | 98.3 ± 6.40 b | 48.5 ± 0.56 a | 19.2 ± 0.49 a | 67.1 ± 0.77 a | 16.5 ± 0.41 a | 7.62 ± 0.360 b | ||
| 240 | 123.6 ± 4.94 a | 47.5 ± 0.81 a | 20.5 ± 0.81 a | 68.7 ± 0.74 a | 16.6 ± 0.17 a | 7.82 ± 0.185 b | ||
| V3 | 0 | 35.0 ± 9.83 c | 49.1 ± 1.34 a | 18.2 ± 1.22 a | 68.9 ± 0.92 a | 15.9 ± 0.28 a | 7.48 ± 0.312 a | |
| 180 | 100.3 ± 7.70 b | 48.6 ± 0.27 a | 18.6 ± 0.30 a | 69.3 ± 0.53 a | 16.2 ± 0.72 a | 7.10 ± 0.308 a | ||
| 240 | 135.9 ± 10.81 a | 48.7 ± 0.08 a | 18.4 ± 0.31 a | 68.5 ± 0.40 a | 15.5 ± 0.61 a | 7.23 ± 0.136 a | ||
| V4 | 0 | 29.1 ± 7.33 b | 49.6 ± 0.43 a | 18.9 ± 0.41 a | 68.3 ± 0.68 a | 16.6 ±0.56 a | 7.52 ± 0.271 a | |
| 180 | 89.3 ± 5.69 a | 49.2 ± 0.87 a | 18.9 ± 0.74 a | 67.8 ± 0.57 a | 16.7 ± 0.44 a | 7.47 ± 0.257 a | ||
| 240 | 83.8 ± 5.86 a | 48.6 ± 0.91 a | 19.4 ± 0.66 a | 68.2 ± 1.05 a | 16.8 ± 0.54 a | 7.48 ± 0.204 a | ||
| V5 | 0 | 37.0 ± 4.84 b | 51.4 ± 1.03 a | 18.8 ± 0.74 a | 68.3 ± 1.26 a | 14.8 ± 0.23 a | 8.22 ± 0.252 a | |
| 180 | 102.4 ± 7.08 a | 50.6 ± 0.76 a | 19.7 ± 0.39 a | 66.9 ± 2.82 a | 14.2 ± 0.79 a | 7.43 ± 0.340 b | ||
| 240 | 94.6 ± 9.57 a | 50.2 ± 0.57 a | 20.1 ± 0.77 a | 69.5 ± 0.34 a | 15.1 ± 0.63 a | 7.30 ± 0.135 b |
Table 7.
Correlation coefficients between nitrogen application, plant nitrogen accumulation, and seed quality indexes of rapeseed.
Table 7.
Correlation coefficients between nitrogen application, plant nitrogen accumulation, and seed quality indexes of rapeseed.
| Index | N-app | N-acc | Protein Content | Oil Content | Oleic Acid Content | Linoleic Acid Content |
|---|---|---|---|---|---|---|
| N-acc | 0.920 ** | — | — | — | — | — |
| Protein content | 0.053 | 0.111 | — | — | — | — |
| Oil content | −0.091 | −0.092 | −0.540 ** | — | — | — |
| Oleic acid content | −0.089 | −0.028 | −0.476 ** | 0.808 ** | — | — |
| Linoleic acid content | 0.048 | 0.144 | 0.248 | 0.131 | 0.213 | — |
| Linolenic acid content | −0.116 | −0.170 | 0.381 * | −0.748 ** | −0.856 ** | −0.249 |
Note: —, blank; * and ** indicate significance levels of p ≤ 0.05 and p ≤ 0.01, respectively.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Wang, C.; Wang, X.; Yang, J.; Zhang, Z.; Chen, M. Effects and Mechanism of Nitrogen Regulation on Seed Yield and Quality of Rapeseed (Brassica napus L.). Agronomy 2025, 15, 1232. https://doi.org/10.3390/agronomy15051232
AMA Style
Wang C, Wang X, Yang J, Zhang Z, Chen M. Effects and Mechanism of Nitrogen Regulation on Seed Yield and Quality of Rapeseed (Brassica napus L.). Agronomy. 2025; 15(5):1232. https://doi.org/10.3390/agronomy15051232
Chicago/Turabian StyleWang, Chunli, Xiaojun Wang, Jianli Yang, Zhi Zhang, and Miaomiao Chen. 2025. "Effects and Mechanism of Nitrogen Regulation on Seed Yield and Quality of Rapeseed (Brassica napus L.)" Agronomy 15, no. 5: 1232. https://doi.org/10.3390/agronomy15051232
APA StyleWang, C., Wang, X., Yang, J., Zhang, Z., & Chen, M. (2025). Effects and Mechanism of Nitrogen Regulation on Seed Yield and Quality of Rapeseed (Brassica napus L.). Agronomy, 15(5), 1232. https://doi.org/10.3390/agronomy15051232
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
