Abstract
The genetic transformation of plants has provided fundamental insights into plant biology. However, the genetic transformation systems for most horticultural plants remain incomplete. Genome editing has significantly contributed to the improvement of crop traits, but it heavily relies on effective genetic transformation. Currently, reducing costs and improving the efficiency of genetic transformation are crucial for promoting the widespread application of genome editing in plants. Here, we review the advances in plant genetic transformation research, performing analysis of three methods for plant gene function analysis that bypass tissue culture: Agrobacterium rhizogenes-mediated root genetic transformation, developmental regulators (DRs)-mediated genetic transformation, and virus-mediated genome editing. We analyzed transformation efficiency in strawberry and citrus using the A. rhizogenes infiltration method, employing GFP to label different subcellular locations to investigate the morphology of microfilaments, nuclei, and peroxisomes in strawberry cells. Sequence analysis revealed that a series of developmental regulators critical for enhancing genetic transformation efficiency in specific species are highly conserved across different plant species. Additionally, we successfully edited the endogenous Pds gene in Cas9-overexpressing transgenic tobacco using TRV and CLBV containing the gRNA module. These three methods offer the benefits of being cost-effective and time-efficient, providing valuable technical insights for the application of plant genome editing.
1. Introduction
Crop yields have consistently risen over time, with research indicating that advancements in crop management and breeding account for 50% of this progress [1,2]. The genetic transformation of plants is a crucial method for enhancing yield, quality, and resilience to both abiotic and biotic stressors [3]. In the United States, where genetically engineered crops were first introduced in 1996, over 75% of the current corn, cotton, soybean, and sugar beet crops have been modified for resistance to herbicides and insects [4]. In 2023, the global area of genome-modified crops reached 206.26 million hectares [https://gm.agbioinvestor.com/ (accessed on 1 October 2024)]. With the advancement of genome sequencing and gene analysis technologies, the use of genome editing to modify endogenous genes to create new phenotypes has become possible in many horticultural plants, such as tomato, citrus, apples, and strawberry [5,6,7,8]. Nevertheless, despite decades of technological progress, achieving efficient plant genetic transformation and genome editing continues to be a challenge for numerous species [9].
Initial attempts at genetic transformation in plants were made nearly sixty years ago with maize, but these early efforts were unsuccessful [10]. In the early 1970s, recombinant DNA molecules were first produced using restriction enzymes [11,12], and by the 1980s, this technology led to the creation of genetically stable transformed plants such as maize [13], rice [14], tobacco [15], tomato [16], petunia [17], celery [18], wheat [19], and grape [20]. Currently, various plant genetic transformation methods are continuously being developed, such as Agrobacterium-mediated transformation [21,22,23], particle bombardment method [24,25], pollen tube pathway [26], electroporation [27], PEG-mediated transformation [28], and nanoparticle-mediated transformation [29] However, challenges such as low transformation efficiency, high costs, lengthy processes, and random integration of sites remain significant limitations [30]. For example, the particle bombardment method often causes significant tissue cell death; high-efficiency transformation with gold particles is costly, while tungsten particles are cheaper but less efficient [31,32,33]. In addition, although traditional Agrobacterium-mediated transformation methods are cost-effective, they exhibit low transformation efficiency in most plants, particularly monocotyledonous species [34]. The PEG-mediated transformation method can overcome species barriers but faces challenges such as difficulty in transferring long DNA fragments and reliance on mature protoplast preparation and culture techniques. Furthermore, traditional genetic transformation methods heavily depend on tissue culture, requiring operators with high technical proficiency, controlled environments, specialized equipment, and skilled personnel throughout the transformation process. Therefore, in recent years, researchers have started exploring the development of plant genetic transformation technologies with enhanced efficiency, broader applicability, reduced costs, and no reliance on tissue culture. Examples include developmental regulator-mediated and nanoparticle-mediated genetic transformations [29,35,36,37,38,39].
Genetic transformation technologies are crucial auxiliary tools for achieving plant genome editing. Genome editing relies on sequence-specific nucleases, such as zinc-finger nucleases [40], transcription activator-like effector nucleases [41], and the CRISPR–Cas system [42,43]. The CRISPR/Cas9 system, known for its versatility and efficiency, primarily consists of Cas proteins and single guide RNA (sgRNA) [42,44,45]. Originally, the type II CRISPR–Cas system was designed to induce DNA cleavage at specific sites in vitro [42]. Subsequently, this CRISPR/Cas technology has been employed for genome editing in bacteria, yeast, and other organisms, enabling efficient targeted mutagenesis [45,46,47,48,49,50,51]. When Cas proteins induce double-stranded breaks (DSBs) at target DNA sites, these breaks are repaired through either non-homologous end-joining (NHEJ) or homologous-directed repair (HDR) [52]. HDR, which uses a DNA template, provides greater precision in the repair process than NHEJ. However, HDR is seldom employed in basic research and crop improvement because of its markedly low efficiency in higher plants [53]. Recently, several genome editing technologies based on the CRISPR/Cas system have been developed, greatly enhancing the precision and efficiency of genome manipulation while minimizing off-target effects. For example, David Liu’s team developed the base editing systems (BEs) by combining dead Cas9 (dCas9) or Cas9 nickase (nCas9) with various nucleoside deaminases [54]. At present, BE technology has successfully achieved four types of base substitutions (C to T, G to A, A to G, and T to C) without the need for creating DNA double-strand breaks or using exogenous donor DNA templates [55,56]. However, BE technology can only modify a narrow range of DNA, and the off-target rate remains a significant issue that needs to be addressed. On the other hand, David Liu’s team created prime editing (PE), a new technology that significantly reduces off-target effects and broadens the range of genome editing [57,58]. The PE system is composed of Moloney murine leukemia virus reverse transcriptase (M-MLV-RT), an effector protein created by integrating nCas9 (H840A) and prime editing guide RNA (peg RNA). To enhance the editing efficiency of the PE system, various strategies, including twinPE technology, have been developed [57,59,60]. However, to date, research on PE-mediated genome editing through non-tissue culture transformation systems remains scarce.
To achieve efficient genome editing without relying on tissue culture, researchers have invested substantial efforts and developed many strategies in this field. A series of studies have demonstrated that using developmental regulators can induce transgenic shoot and root formation in planta [36,61,62,63,64]. In addition, genome editing in plants can be achieved by infecting plants with viruses carrying Cas protein and sgRNA or by infecting transgenic plants overexpressing Cas9 with viruses carrying sgRNA [51,65,66,67]. In this study, we systematically analyzed three tissue culture-independent plant genetic transformation or genome editing methods: A. rhizogenes-mediated hairy root genetic transformation, developmental regulator-mediated shoot genetic transformation, and virus-mediated genome editing. Nicotiana benthamiana is a widely used model species in plant research, while citrus is one of the major global fruit crops, and strawberry is an important herbaceous economic crop. Testing the methods in these species thus holds significant scientific and practical value. Therefore, corresponding experimental validations were conducted accordingly in these three species. We anticipate that by reducing the cost, required workload, experimental period, and other technical obstacles, these genetic transformation and genome editing methods will be valuable tools for routine investigation of endogenous and exogenous genes in plants.
2. Materials and Methods
2.1. Bacterial and Plant Materials
All competent cells were purchased from WEIDI Biotechnology Co., Ltd., Shanghai, China, and the list is shown below: Escherichia coli (TG1) chemically competent cells (CAT#: DL1055); A. rhizogenes (K599) chemically competent cells (CAT#: AC1080); and A. tumefaciens (GV3101) chemically competent cells (CAT#: AC1001). The TG1 was cultured in LB medium (Tryptone, 10 g/L; yeast extract, 5 g/L; NaCl, 10 g/L; pH, 7.0) at 37 °C. The GV3101 and K599 were cultured in TY medium (Tryptone, 5 g/L; yeast extract, 3 g/L; CaCl2, 10 mM) at 28 °C. All transformed bacterial strains were stored in 15% glycerol and kept at −80 °C for preservation.
Citrus (Citrus medica), strawberry (Fragaria × ananassa), and tobacco (Nicotiana benthamiana) were used in this study under the following conditions. Citrus: Mature plants aged over 5 years, with semi-lignified cuttings, were used. Strawberry and Tobacco: Plants aged 3 to 5 weeks were selected for the study. All plants were grown in a controlled environment chamber at 22–26 °C with a 16 h/8 h (light/dark) photoperiod. The vermiculite used for rooting was sterilized prior to use.
2.2. Microscopy
Hairy roots were washed with deionized water and examined under a Leica-M205FA stereomicroscope (Leica Microsystems, Wetzlar, Germany). For confocal observation, a Leica-SP8MP laser scanning confocal microscope (Leica Microsystems, Wetzlar, Germany) was utilized. Razor-thin transverse or longitudinal sections of the hairy roots were prepared. GFP signals were visualized with the laser scanning confocal microscope using an excitation wavelength of 488 nm and an emission range of 505–550 nm.
2.3. A. rhizogenes-Mediated Genetic Transformation
K599 strain carrying GFP-overexpressing binary plasmid was cultured in TY medium (200 rpm, 28 °C) until OD600 = 1.0. The bacteria were pelleted by centrifugation at 5000 rpm and then resuspended in an infiltration solution (MES, 10 mM; MgCl2, 10 mM; Acetosyringone, 200 μM; pH, 5.2) to a final concentration of OD600 = 0.8. Explants of citrus and strawberry were immersed in the infiltration solution under vacuum conditions for 30 min. Following agroinfiltration, the explants were incubated in vermiculite at 20–26 °C under high humidity conditions. Transgenic hairy root formation and development were regularly monitored. All the vector maps are shown on the website [http://nebenfuehrlab.utk.edu/markers/default.htm (accessed on 1 October 2024)]. Each experiment included over 10 plants or test explants and was independently repeated at least three times.
2.4. TRV Agroinfiltration and Analysis of Virus Infectivity
GV3101 strains carrying the TRV1 or TRV2-GFP plasmid were cultured in 10 mL of YEP medium containing rifampicin (50 mg/L) and kanamycin (50 mg/L). The cultures were grown overnight at 28 °C in a shaker at 200 rpm until reaching an OD600 of 1.0. Harvest the cells from each culture by centrifugation at 5000 rpm for 5 min at room temperature. Resuspend the cells in infiltration solution and adjust the OD600 to 0.4–0.6. Conduct the TRV agroinfiltration by inoculating the tobacco leaves with a needleless syringe. Check the plants for phenotypic changes 4 to 30 days post-inoculation. All tobacco used in this study is stable Cas9-overexpressing transgenic tobacco.
2.5. sgRNA Design
The sgRNAs used in this study were designed using the online tool Benchling [https://benchling.com/signin/welcome (accessed on 1 January 2024)] based on their evaluation scores (on-target score and off-target score). Target sequences of gRNA (gRNA, TTGGTAGTAGCGACTCCATG; PAM, GGG) were selected for Pds-encoding gene TRV and CLBV vectors. tRNA sequence: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA; gRNA scaffold sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
2.6. Genome Editing Analysis
Genomic DNA from transgenic roots was extracted using the CTAB method. The gRNA-targeted DNA locus was amplified by PCR using a high-fidelity enzyme (CAT#: P521-d1, Vazyme, Nanjing, China). The PCR products were cloned into a T-vector using the TA/Blunt-Zero Cloning Kit (CAT#: C601-01, Vazyme, Nanjing, China) and sent to Tsingke Biotechnology Co., Ltd., Beijing, China. for sequencing. Subsequently, the sequencing results were aligned using SnapGene software 8.0, and the gene editing efficiency was calculated as follows: [Editing efficiency = (TA clones with targeted DNA locus edited/total TA clones) × 100%]. Each experiment included over 8 plants and was independently repeated at least three times.
2.7. Data Collection
All experimental data were obtained between January 2022 and December 2024.
3. Results
3.1. Classification of Commonly Used Traditional Plant Genetic Transformation Methods
Plant genetic transformation techniques can be broadly categorized into two main types: direct and indirect transformation methods [68]. Direct genetic transformation involves physical or chemical techniques to insert DNA into plant cells, including methods such as the pollen tube pathway (Figure 1A), microinjection (Figure 1B), PEG (Figure 1C), and particle bombardment (also known as the gene gun) (Figure 1D). On the other hand, indirect genetic transformation involves the use of vectors, such as A. tumefaciens and A. rhizogenes, to transfer genes into target cells (Figure 1E,F). As shown in Figure 1B–F, most plant traditional genetic transformation methods heavily rely on tissue culture. These methods often require steps such as callus induction, shoot induction, and root induction to obtain complete transgenic plants. Unlike microinjection, PEG, particle bombardment, and Agrobacterium-mediated plant transformation, the pollen tube pathway method does not require protoplast manipulation, tissue culture, or plant regeneration processes (Figure 1A). However, this method has been applied to only a few plant species due to constraints of the natural flowering period, limiting its use. A. rhizogenes-mediated genetic transformation also does not require tissue culture and has been successfully achieved in a variety of plant species. However, it typically produces transgenic roots, and its application in woody plants remains limited.
Figure 1.
Classification of commonly used traditional plant genetic transformation methods. Transformation via pollen tube pathway (A), microinjection (B), PEG (C), particle bombardment (D), A. tumefaciens (E), and A. rhizogenes (F).
3.2. A. rhizogenes-Mediated Plant Genetic Transformation
A. rhizogenes, a Gram-negative soil bacterium, is known for inducing hairy root formation through the transfer of its Ri-plasmid. Currently, A. rhizogenes-mediated genetic transformation is one of the most widely used tissue culture-independent transformation methods in plants. The implementation details of this technique are as follows: ① transfer of the binary vector into A. rhizogenes; ② cultivation of A. rhizogenes; ③ preparation of infiltration solution; ④ agroinfiltration; ⑤ cultivation of infiltrated explants; ⑥ identification of transgenic hairy roots; and ⑦ additional operations, such as shoot induction. To verify the effectiveness of this method, we performed agroinfiltration on citrus and strawberry using A. rhizogenes carrying a GFP-overexpressing binary vector. This resulted in the successful generation of transgenic hairy roots in all tested species (Figure 2A). Confocal laser scanning microscopy confirmed the normal expression of GFP in the transgenic root cells (Figure 2B). Transformation efficiency analysis indicated success rates of 90% for citrus and 70% for strawberry [transformation efficiency = (number of explants with transgenic hairy root or callus/total number of surviving explants) × 100%] (Figure 2C). Additionally, GFP fluorescence in the transgenic roots was maintained for over 30 days without noticeable reduction, suggesting that the transformation was stable. This stability was in contrast to typical transient expression, where GFP fluorescence generally lasts only 3–7 days. This finding further supports the successful and stable transformation in both citrus and strawberry. Additionally, this study conducted genetic transformation of strawberry using multiple binary vectors containing GFP targeted to different subcellular compartments (nucleus, microfilament, peroxisome, etc.), successfully obtaining the corresponding transformants and demonstrating the efficacy of this method (Figure 3).
Figure 2.
A. rhizogenes-mediated plant genetic transformation. (A). Images of citrus and strawberry at several weeks post-agroinfiltration. The scale actually represents 1cm. ‘C’ is for ‘Citrus’, and ‘S’ is for ‘Strawberry’. Citrus-GFP and strawberry-GFP represent explants infiltrated with A. rhizogenes harboring a GFP-overexpressing plasmid; citrus-WT and strawberry-WT represent wild-type explants without agroinfiltration. ‘Bright’ represents images taken under white light, and ‘GFP’ represents images taken under GFP excitation light. (B). GFP observation by laser scanning confocal microscopy (excitation 488 nm, emission 505–550 nm) in target roots. (C). A. rhizogenes-mediated genetic transformation efficiency in citrus and strawberry. Each group of data includes more than three independent replicates. Significance analysis was performed using one-way ANOVA with differences considered statistically significant at *** p < 0.001.
Figure 3.
GFP observation by laser scanning confocal microscopy. ‘WT’ represents wild-type root stained with DAPI (4′,6-diamidino-2-phenylindole). ‘Cell nucleus’, ‘Microfilament’, and ‘Peroxisome’ represent transgenic root overexpressing GFP targeting cell nucleus, microfilament, and peroxisome, respectively. All transgenic hairy roots were obtained through A. rhizogenes-mediated genetic transformation.
3.3. The Developmental Regulators Used for Enhancing Genetic Transformation Efficiency
Agrobacterium-mediated genetic transformation is well established in model species and some herbaceous plants but often exhibits low or even negligible success rates in most monocotyledonous and woody plants. Developmental regulators such as WUS, BBM, WIND1, PLT5, GRF4, and GIF1 can induce callus formation or shoot regeneration and have been utilized to enhance genetic transformation efficiency. These regulators not only improve transformation efficiency but also enable direct genetic transformation of living plants without the need for tissue culture [35,36,69,70,71]. Developmental regulator-mediated genetic transformation can be classified into the following types. First, A. tumefaciens containing developmental regulators expressing vectors can be used to perform agroinfiltration in vivo, leading to transgenic shoot formation at the infiltration site (Figure 4A). Second, agroinfiltration of explants under tissue culture conditions with A. tumefaciens containing DR-expressing vectors can enhance transformation efficiency. Finally, while the efficiency of shoot induction from transgenic hairy roots obtained through conventional A. rhizogenes-mediated transformation is generally low, using A. rhizogenes with DR-expressing vectors can improve shoot induction rates (Figure 4B).
Figure 4.
DRs-mediated genetic transformation. (A). Schematic diagram of DRs-mediated genetic transformation combined with A. tumefaciens in vivo. (B). Schematic diagram of DRs-mediated genetic transformation combined with A. tumefaciens in vitro.
In this study, we conducted sequence alignment of several developmental regulators known to enhance transformation efficiency across various plant species based on previous reports. The results indicate that the amino acid sequences of these developmental regulators are conserved among these species (Figure 5A, File S1). Additionally, protein domain and three-dimensional structure predictions reveal that developmental regulators are highly conserved in both herbaceous plants (e.g., Arabidopsis) and woody plants (e.g., citrus) (Figure 5B,C).
Figure 5.
Amino acid sequences analysis of DRs. (A). Phylogenetic trees were constructed by comparing amino acid sequences between different species using the neighbor-joining algorithm of MEGA6. Bar, 5% sequence divergence. Accession number of amino acid sequences and the corresponding species used in this study are listed in Supplementary File S1. (B). Schematic depiction of the conserved domain of DRs. (C). Protein three-dimensional structure predictions of DRs.
3.4. Virus-Mediated Genome Editing
Currently, there are three main methods for virus-mediated plant genome editing. First, the infection of Cas9-overexpressing plants with a virus containing gRNA module, followed by screening T1 generation plants for gene-edited materials. This method is broadly applicable to various viruses but results in plants that retain the Cas9 overexpression (Figure 6A). Second, wild-type plants were infected with a virus carrying both Cas9 and the gRNA module, followed by the selection of T1 generation plants for gene-edited materials. This approach enables the selection of non-transgenic genome-edited plants; however, it requires a virus with a sufficiently large genome to stably express both Cas9 and gRNA modules, which is relatively rare (Figure 6B). Finally, infecting Cas9-overexpressing plants with a virus containing a shoot apical meristem induction-type gRNA module: this method facilitates the acquisition of genome-edited materials in the T0 generation (Figure 6C).
Figure 6.
Virus-mediated plant genome editing. (A). Virus-mediated genome editing of Cas9-overexpressing plant (Cas9-ov), resulting in transgenic genome-edited plants in the T1 generation. (B). Virus-mediated genome editing of wild-type plant (WT), resulting in no-transgenic genome-edited plants in the T1 generation. (C). Virus-mediated genome editing of Cas9-ov, resulting in genome-edited shoots in the T0 generation.
In this study, we constructed TRV and CLBV viruses capable of overexpressing gRNA modules targeting the tobacco Pds-encoding gene (Figure 7A). These constructs were introduced into A. tumefaciens strain GV3101, which was then used to infiltrate Cas9-overexpressing tobacco for virus inoculation. Seven to ten weeks later, the systemic leaves of infected tobacco displayed numerous white spots, while control plants remained normal (Figure 7B). DNA extraction, TA cloning, and sequencing confirmed successful editing of the Pds in leaves, with editing efficiencies of 71% in TRV-infected leaves and 56% in CLBV-infected leaves (Figure 7C,D).
Figure 7.
(A). Schematic overview of the genomic structure of gRNA-overexpressing CLBV and TRV viruses. The gRNA module is located near the 3′ end of the CP coding gene in both the TRV and CLBV genomes. The sequences of tRNA and gRNA scaffold were provided in the Materials and Methods section. (B). Photo-bleaching phenotype of tobacco leaves agro-inoculated with the TRV or CLBV carrying gRNA module. (C). Alignment of the genome-edited sequence of corresponding tobacco leaves infected by TRV or CLBV. Blue nucleotides indicate gRNA, and red nucleotides indicate PAM. (D). The efficiency of genome editing in tobacco leaf cells mediated by TRV and CLBV.
4. Discussion
Currently, plant genetic transformation and genome editing methods are being optimized to expand their applicability to a wider range of species, eliminate the need for tissue culture, improve efficiency, and shorten process durations. However, the effectiveness of these systems can vary considerably among horticultural plants, and even within the same species, significant differences may exist between genotypes. This study explores two plant genetic transformation methods and one genome editing technique in citrus, strawberry, or tobacco, all of which bypass traditional tissue culture: A. rhizogenes-mediated root transformation, developmental regulator-mediated transformation, and virus-mediated genome editing. These methods mark significant advancements in plant genetic research by providing cost-effective and efficient alternatives to conventional tissue culture-based systems.
The A. rhizogenes-mediated transformation method effectively generates transgenic hairy roots across various species and does not require tissue culture [61,62]. This approach capitalizes on the bacterium’s natural ability to induce root formation through its Ri-plasmid [23,72]. The advantage of this technique lies in its simplicity and the reduced need for tissue culture, making it a viable option for genetic studies and plant improvement [73,74,75]. However, it typically produces roots rather than shoots, limiting its application in species where shoot regeneration is crucial [76]. In addition, its application in woody plants remains limited. In recent years, A. rhizogenes-mediated hairy root genetic transformation has been proven to be applicable to several citrus species, offering advantages such as high efficiency, low cost, and short processing time [61,77,78]. Our study confirms that this method achieves high transformation efficiency, with success rates of 90% and 70% for citrus and strawberry, respectively. Compared to the genetic transformation efficiency in strawberry reported in a recent study [79], this study achieved a significantly higher transformation efficiency when using the same A. rhizogenes (K599). In this study, the A. rhizogenes-mediated genetic transformation method applied to strawberry is the same as that used in citrus [61]. However, compared to previous strawberry transformation methods [79], an additional vacuum infiltration step was introduced, and significant differences were observed in the explant and culture conditions. These combined factors may be key contributors to the improved transformation efficiency. This improvement is likely due to the substantial differences in the explants and culture conditions employed in our study. In addition, this study employed A. rhizogenes-mediated genetic transformation to introduce plasmids containing GFP targeted to different organelles in strawberry, allowing for microscopic observation of various organelle morphologies. Although the resulting transformants are hairy roots, this method remains valuable for investigating gene function and related areas of research. A. rhizogenes-mediated transformation can affect plant metabolism, particularly through the regulation of hormone levels. For example, the formation of hairy roots is often controlled by auxin synthesis, influencing plant growth and development. While our study did not observe significant metabolic or physiological changes, such transformations can sometimes result in phenotypic alterations, such as dwarfing or altered growth patterns, due to changes in hormonal or metabolic pathways. Future studies should consider these potential effects to better assess the broader impact of genetic transformation on plant physiology.
The developmental regulator-mediated transformation approach represents a significant advancement by enabling direct genetic transformation without tissue culture and significantly improving transformation efficiency in tissue culture-dependent methods [35,36,38,71]. Developmental regulators such as WUS, BBM, WIND1, and GRF4 enhance the efficiency of shoot regeneration and callus formation [35,71,80]. The primary advantage of this method is its applicability to a broader range of species, including those challenging to transform using traditional methods, such as maize and rice [81,82]. This study shows that developmental regulators are conserved in a series of plant species, as indicated by sequence alignments and structural predictions, revealing that developmental regulator-mediated genetic transformation may be applicable to a wide range of plants. Therefore, improving genetic transformation efficiency in related plant species using developmental regulators with well-defined functions in model species is feasible. It should be noted that the use of developmental regulators to achieve genetic transformation bypassing tissue culture is still limited to a few species, with even fewer applications in woody plants. Moreover, the overexpression of these regulators could potentially impact the physiological phenotype of plants. Therefore, selecting suitable developmental regulators and achieving appropriate expression levels will be an important focus for future research.
Virus-mediated genome editing represents a cutting-edge approach that utilizes plant viruses to deliver genome editing elements such as Cas9 and gRNA. Three virus-mediated strategies were discussed in this study: infecting Cas9-overexpressing plants with viruses carrying gRNA, infecting wild-type plants with viruses carrying both Cas9 and gRNA, and using viruses with shoot apical meristem induction-type gRNA modules to infect Cas9-overexpressing plants. The findings highlight the efficiency of virus-mediated editing, with high editing rates achieved in Cas9-overexpressing tobacco plants. For example, Ellison et al. demonstrated that by using TRV (containing gRNA sequences targeting the Pds gene in the genome) to infect tobacco, successful editing of the tobacco Pds was achieved [65]. In this study, the TRV and CLBV viruses achieved editing efficiencies of 71% and 56%, respectively, in systematic leaf. This study is the first to report a genome editing method for tobacco using CLBV. CLBV does not transmit through seeds, so transformed plants can be propagated from seeds to produce CLBV-free offspring. This approach minimizes risks to native species and ecosystems. However, the environmental release of genetically modified organisms, especially those using viral vectors, should undergo thorough risk assessments. These results not only provide a viable method for current genome editing in tobacco but also offer the potential for future genome editing in citrus using CLBV, as CLBV is a virus isolated from citrus and exhibits high infection efficiency in citrus plants. In addition, virus-mediated methods enable the creation of non-transgenic genome-edited plants [51]. However, the requirement for large viral genomes to express both Cas9 and gRNA can limit the practicality of some strategies. Despite this, the ability to achieve genome editing in the T0 generation makes this approach promising for future research and practical applications [65]. In the future, additional types of virus-mediated genome editing, such as BE, PE, and twinPE, may be developed in plants, offering more technical options for research on plant gene function research and precision breeding.
The three methods discussed offer substantial advantages over traditional tissue culture-dependent techniques, including reduced costs, shorter timelines, and enhanced efficiency. Collectively, they represent a significant leap forward in plant genetic transformation and genome editing technologies. The A. rhizogenes method excels in generating transgenic roots, while the developmental regulator-mediated transformation provides a more versatile approach for shoot regeneration. Virus-mediated genome editing is notable for enabling genome editing. Future research should focus on further optimizing these methods to overcome their current limitations. For A. rhizogenes-mediated transformation, efforts could target improving shoot induction techniques. In developmental regulator-mediated transformation, exploring additional developmental regulators and optimizing their delivery could enhance efficiency and applicability. In virus-mediated genome editing, developing viruses with larger genomes or alternative delivery mechanisms could broaden the method’s utility. Overall, these advancements provide powerful tools for plant genetic research and crop improvement, potentially transforming our approach to plant biotechnology and contributing to the development of more resilient and high-yielding crops.
5. Conclusions
This study presents a comparative analysis of three tissue culture-independent methods for plant genetic transformation and genome editing: A. rhizogenes-mediated root transformation, developmental regulator-mediated transformation, and virus-mediated genome editing. The A. rhizogenes method successfully generated transgenic hairy roots in strawberry and citrus. Virus-mediated editing achieved high efficiency in genome editing in tobacco. These methods offer notable advantages, including reduced costs, shorter timelines, and enhanced efficiency compared to traditional tissue culture-dependent approaches. This advancement in genetic transformation technologies provides robust tools for accelerating plant genome editing and improving horticultural research.
Supplementary Materials
The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy15030603/s1. File S1: Amino acid sequence information of developmental regulators used in this study.
Author Contributions
Conceptualization, H.M., H.J., S.H. and K.X.; Methodology, H.M., H.J., S.H., J.W., D.S., M.W., S.L., K.X., J.L. and B.L.; Software, H.M., Validation, H.M., H.J., S.H. and M.W.; Formal analysis, H.M. and H.J.; Investigation, H.M., H.J., S.H., J.W., D.S., M.W., S.L., K.X., J.L. and B.L.; Data curation, H.J., S.H., J.W., D.S., M.W., S.L. and B.L.; Writing—original draft, H.M. and H.J.; Writing—review and editing, H.M. and H.J.; Supervision, H.M.; Funding acquisition, H.M. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the National Natural Science Foundation of China (32202427), Natural Science Foundation of Zhejiang Province (LY24C150005), and Zhejiang Province Major Agricultural Technology Cooperative Promotion Plan (2022XTTGGP03-02).
Data Availability Statement
Data is contained within the article and Supplementary Materials.
Acknowledgments
This work was supported by the Public Research Platform of the College of Horticultural Science, Zhejiang A&F University.
Conflicts of Interest
Author Jinhua Liu was employed by the company Natural Medicine Institute of Zhejiang YangShengTang Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
References
- Duvick, D.N. The contribution of breeding to yield advances in maize (Zea mays L.). Adv. Agron. 2005, 86, 83–145. [Google Scholar]
- Lopes, M.; Reynolds, M.; Manes, Y.; Singh, R.; Crossa, J.; Braun, H. Genetic yield gains and changes in associated traits of CIMMYT spring bread wheat in a “historic” set representing 30 years of breeding. Crop Sci. 2012, 52, 1123–1131. [Google Scholar] [CrossRef]
- Yan, Y.; Zhu, X.; Yu, Y.; Li, C.; Zhang, Z.; Wang, F. Nanotechnology strategies for plant genetic engineering. Adv. Mater. 2022, 34, 2106945. [Google Scholar] [CrossRef] [PubMed]
- Anjanappa, R.B.; Gruissem, W. Current progress and challenges in crop genetic transformation. J. Plant Physiol. 2021, 261, 153411. [Google Scholar] [CrossRef]
- Jia, H.; Zhang, Y.; Orbović, V.; Xu, J.; White, F.F.; Jones, J.B.; Wang, N. Genome editing of the disease susceptibility gene Cs LOB 1 in citrus confers resistance to citrus canker. Plant Biotechnol. J. 2017, 15, 817–823. [Google Scholar] [CrossRef]
- Li, R.; Li, R.; Li, X.; Fu, D.; Zhu, B.; Tian, H.; Luo, Y.; Zhu, H. Multiplexed CRISPR/Cas9-Mediated metabolic engineering of γ-aminobutyric acid levels in Solanum lycopersicum. Plant Biotechnol. J. 2018, 16, 415–427. [Google Scholar] [CrossRef]
- Zhou, J.; Wang, G.; Liu, Z. Efficient genome editing of wild strawberry genes, vector development and validation. Plant Biotechnol. J. 2018, 16, 1868–1877. [Google Scholar] [CrossRef]
- Miranda, S.; Piazza, S.; Nuzzo, F.; Li, M.; Lagrèze, J.; Mithöfer, A.; Cestaro, A.; Tarkowska, D.; Espley, R.; Dare, A.; et al. CRISPR/Cas9 genome-editing applied to MdPGT1 in apple results in reduced foliar phloridzin without impacting plant growth. Plant J. 2023, 113, 92–105. [Google Scholar] [CrossRef] [PubMed]
- Ramkumar, T.R.; Lenka, S.K.; Arya, S.S.; Bansal, K.C. A short history and perspectives on plant genetic transformation. Methods Mol. Biol. 2020, 2124, 39–68. [Google Scholar] [PubMed]
- Coe, E., Jr.; Sarkar, K. Preparation of nucleic acids and a genetic transformation attempt in maize. Crop Sci. 1966, 6, 432–435. [Google Scholar] [CrossRef]
- Meselson, M.; Yuan, R. DNA restriction enzyme from E. coli. Nature 1968, 217, 1110–1114. [Google Scholar] [CrossRef] [PubMed]
- Smith, H.O.; Welcox, K. A restriction enzyme from Hemophilus influenzae: I. Purification and general properties. J. Mol. Biol. 1970, 51, 379–391. [Google Scholar] [CrossRef] [PubMed]
- Fromm, M.E.; Taylor, L.P.; Walbot, V. Stable transformation of maize after gene transfer by electroporation. Nature 1986, 319, 791–793. [Google Scholar] [CrossRef] [PubMed]
- Toriyama, K.; Arimoto, Y.; Uchimiya, H.; Hinata, K. Transgenic rice plants after direct gene transfer into protoplasts. Nat. Biotechnol. 1988, 6, 1072–1074. [Google Scholar] [CrossRef]
- Shimamoto, K.; Terada, R.; Izawa, T.; Fujimoto, H. Fertile transgenic rice plants regenerated from transformed protoplasts. Nature 1989, 338, 274–276. [Google Scholar] [CrossRef]
- Horsch, R.; Fry, J.; Hoffmann, N.; Wallroth, M.; Eichholtz, D.; Rogers, S.; Fraley, R.T. A simple and general method for transferring genes into plants. Science 1985, 227, 1229–1231. [Google Scholar] [CrossRef] [PubMed]
- Fraley, R.T.; Rogers, S.G.; Horsch, R.B.; Sanders, P.R.; Flick, J.S.; Adams, S.P.; Bittner, M.L.; A Brand, L.; Fink, C.L.; Fry, J.S.; et al. Expression of bacterial genes in plant cells. Proc. Natl. Acad. Sci. USA 1983, 80, 4803–4807. [Google Scholar] [CrossRef]
- Catlin, D.; Ochoa, O.; Mccormick, S.; Quiros, C. Celery transformation by Agrobacterium tumefaciens: Cytological and genetic analysis of transgenic plants. Plant Cell Rep. 1988, 7, 100–103. [Google Scholar] [CrossRef]
- Hess, D.; Dressler, K.; Nimmrichter, R. Transformation experiments by pipetting Agrobacterium into the spikelets of wheat (Triticum aestivum L.). Plant Sci. 1990, 72, 233–244. [Google Scholar] [CrossRef]
- Perl, A.; Lotan, O.; Abu-Abied, M.; Holland, D. Establishment of an Agrobacterium-Mediated transformation system for grape (Vitis vinifera L.): The role of antioxidants during grape–Agrobacterium interactions. Nat. Biotechnol. 1996, 14, 624–628. [Google Scholar] [CrossRef]
- Tzfira, T.; Citovsky, V. Agrobacterium-Mediated genetic transformation of plants: Biology and biotechnology. Curr. Opin. Biotechnol. 2006, 17, 147–154. [Google Scholar] [CrossRef] [PubMed]
- Azizi-Dargahlou, S.; Pouresmaeil, M. Agrobacterium tumefaciens-Mediated plant Transformation: A review. Mol. Biotechnol. 2023, 66, 1563–1580. [Google Scholar] [CrossRef]
- Bahramnejad, B.; Naji, M.; Bose, R.; Jha, S. A critical review on use of Agrobacterium rhizogenes and their associated binary vectors for plant transformation. Biotechnol. Adv. 2019, 37, 107405. [Google Scholar] [CrossRef]
- Sailaja, M.; Tarakeswari, M.; Sujatha, M. Stable genetic transformation of castor (Ricinus communis L.) via particle gun-Mediated gene transfer using embryo axes from mature seeds. Plant Cell Rep. 2008, 27, 1509–1519. [Google Scholar] [CrossRef] [PubMed]
- Ozyigit, I.I.; Kurtoglu, K.Y. Particle bombardment technology and its applications in plants. Mol. Biol. Rep. 2020, 47, 9831–9847. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Sun, R.; Zhang, B.; Wang, Q. Pollen tube pathway-mediated cotton transformation. In Transgenic Cotton Methods Protocols; Springer: Berlin/Heidelberg, Germany, 2019; pp. 67–73. [Google Scholar]
- Ozyigit, I.I. Gene transfer to plants by electroporation: Methods and applications. Mol. Biol. Rep. 2020, 47, 3195–3210. [Google Scholar] [CrossRef]
- Wu, S.; Zhu, H.; Liu, J.; Yang, Q.; Shao, X.; Bi, F.; Hu, C.; Huo, H.; Chen, K.; Yi, G. Establishment of a PEG-mediated protoplast transformation system based on DNA and CRISPR/Cas9 ribonucleoprotein complexes for banana. BMC Plant Biol. 2020, 20, 425. [Google Scholar] [CrossRef]
- Lv, Z.; Jiang, R.; Chen, J.; Chen, W. Nanoparticle-Mediated gene transformation strategies for plant genetic engineering. Plant J. 2020, 104, 880–891. [Google Scholar] [CrossRef] [PubMed]
- Demirer, G.S.; Zhang, H.; Matos, J.L.; Goh, N.S.; Cunningham, F.J.; Sung, Y.; Chang, R.; Aditham, A.J.; Chio, L.; Cho, M.-J.; et al. High aspect ratio nanomaterials enable delivery of functional genetic material without DNA integration in mature plants. Nat. Nanotechnol. 2019, 14, 456–464. [Google Scholar] [CrossRef] [PubMed]
- Frame, B.R.; Zhang, H.; Cocciolone, S.M.; Sidorenko, L.V.; Dietrich, C.R.; Pegg, S.E.; Zhen, S.; Schnable, P.S.; Wang, K. Production of transgenic maize from bombarded type II callus: Effect of gold particle size and callus morphology on transformation efficiency. Vitr. Cell Dev. Biol.-Plant 2000, 36, 21–29. [Google Scholar] [CrossRef]
- Altpeter, F.; Baisakh, N.; Beachy, R.; Bock, R.; Capell, T.; Christou, P.; Daniell, H.; Datta, K.; Datta, S.; Dix, P.J.; et al. Particle bombardment and the genetic enhancement of crops: Myths and realities. Mol. Breed. 2005, 15, 305–327. [Google Scholar] [CrossRef]
- Rivera, A.L.; Gómez-Lim, M.; Fernández, F.; Loske, A.M. Physical methods for genetic plant transformation. Life Rev. 2012, 9, 308–345. [Google Scholar] [CrossRef] [PubMed]
- Koetle, M.; Finnie, J.; Balázs, E.; Van Staden, J. A review on factors affecting the Agrobacterium-Mediated genetic transformation in ornamental monocotyledonous geophytes. S. Afr. J. Bot. 2015, 98, 37–44. [Google Scholar] [CrossRef]
- Debernardi, J.M.; Tricoli, D.M.; Ercoli, M.F.; Hayta, S.; Ronald, P.; Palatnik, J.F.; Dubcovsky, J. A GRF–GIF chimeric protein improves the regeneration efficiency of transgenic plants. Nat. Biotechnol. 2020, 38, 1274–1279. [Google Scholar] [CrossRef] [PubMed]
- Lian, Z.; Nguyen, C.D.; Liu, L.; Wang, G.; Chen, J.; Wang, S.; Yi, G.; Wilson, S.; Ozias-Akins, P.; Gong, H.; et al. Application of developmental regulators to improve in planta or in vitro transformation in plants. Plant Biotechnol. J. 2022, 20, 1622–1635. [Google Scholar] [CrossRef] [PubMed]
- Maren, N.A.; Duan, H.; Da, K.; Yencho, G.C.; Ranney, T.G.; Liu, W. Genotype-Independent plant transformation. Hortic. Res. 2022, 9, uhac047. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Shi, L.; Liang, X.; Zhao, P.; Wang, W.; Liu, J.; Chang, Y.; Hiei, Y.; Yanagihara, C.; Du, L. The gene TaWOX5 overcomes genotype dependency in wheat genetic transformation. Nat. Plants 2022, 8, 110–117. [Google Scholar] [CrossRef]
- Squire, H.J.; Tomatz, S.; Voke, E.; González-Grandío, E.; Landry, M. The emerging role of nanotechnology in plant genetic engineering. Nat. Biomed. Eng. 2023, 1, 314–328. [Google Scholar] [CrossRef]
- Kim, Y.-G.; Cha, J.; Chandrasegaran, S. Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain. Proc. Natl. Acad. Sci. USA 1996, 93, 1156–1160. [Google Scholar] [CrossRef] [PubMed]
- Christian, M.; Cermak, T.; Doyle, E.L.; Schmidt, C.; Zhang, F.; Hummel, A.; Bogdanove, A.J.; Voytas, D.F. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 2010, 186, 757–761. [Google Scholar] [CrossRef] [PubMed]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef] [PubMed]
- Yin, K.; Gao, C.; Qiu, J.-L. Progress and prospects in plant genome editing. Nat. Plants 2017, 3, 17107. [Google Scholar] [CrossRef] [PubMed]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; Dicarlo, J.E.; Norville, J.E.; Church, G.M. RNA-Guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef]
- Qi, L.S.; Larson, M.H.; Gilbert, L.A.; Doudna, J.A.; Weissman, J.S.; Arkin, A.P.; Lim, W.A. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 2013, 152, 1173–1183. [Google Scholar] [CrossRef] [PubMed]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [PubMed]
- Hwang, W.Y.; Fu, Y.; Reyon, D.; Maeder, M.L.; Tsai, S.Q.; Sander, J.D.; Peterson, R.T.; Yeh, J.-R.J.; Joung, J.K. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 2013, 31, 227–229. [Google Scholar] [CrossRef]
- Jiang, W.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L.A. RNA-Guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 2013, 31, 233–239. [Google Scholar] [CrossRef]
- Wang, H.; Yang, H.; Shivalila, C.S.; Dawlaty, M.M.; Cheng, A.W.; Zhang, F.; Jaenisch, R. One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-Mediated genome engineering. Cell 2013, 153, 910–918. [Google Scholar] [CrossRef]
- Liu, H.; Ding, Y.; Zhou, Y.; Jin, W.; Xie, K.; Chen, L.-L. CRISPR-P 2.0: An improved CRISPR-Cas9 tool for genome editing in plants. Mol. Plant 2017, 10, 530–532. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, X.; Liu, H.; Li, Z. Highly efficient DNA-free plant genome editing using virally delivered CRISPR–Cas9. Nat. Plants 2020, 6, 773–779. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Kim, J.-S. A guide to genome engineering with programmable nucleases. Nat. Rev. Genet. 2014, 15, 321–334. [Google Scholar] [CrossRef]
- Huang, T.-K.; Puchta, H. CRISPR/Cas-Mediated gene targeting in plants: Finally a turn for the better for homologous recombination. Plant Cell Rep. 2019, 38, 443–453. [Google Scholar] [CrossRef] [PubMed]
- Rees, H.A.; Liu, D.R. Base editing: Precision chemistry on the genome and transcriptome of living cells. Nat. Rev. Genet. 2018, 19, 770–788. [Google Scholar] [CrossRef]
- Komor, A.C.; Kim, Y.B.; Packer, M.S.; Zuris, J.A.; Liu, D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 2016, 533, 420–424. [Google Scholar] [CrossRef] [PubMed]
- Gaudelli, N.M.; Komor, A.C.; Rees, H.A.; Packer, M.S.; Badran, A.H.; Bryson, D.I.; Lui, D.R. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 2017, 551, 464–471. [Google Scholar] [CrossRef] [PubMed]
- Anzalone, A.V.; Randolph, P.B.; Davis, J.R.; Sousa, A.A.; Koblan, L.W.; Levy, J.M.; Chen, P.J.; Wilson, C.; Newby, G.A.; Raguram, A.; et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 2019, 576, 149–157. [Google Scholar] [CrossRef] [PubMed]
- Marzec, M.; Brąszewska-Zalewska, A.; Hensel, G. Prime editing: A new way for genome editing. Trends Cell Biol. 2020, 30, 257–259. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Yang, G.; Huang, S.; Li, X.; Wang, X.; Li, G.; Chi, T.; Chen, Y.; Huang, X.; Wang, X. Enhancing prime editing by Csy4-Mediated processing of pegRNA. Cell Res. 2021, 31, 1134–1136. [Google Scholar] [CrossRef]
- Anzalone, A.V.; Gao, X.D.; Podracky, C.J.; Nelson, A.T.; Koblan, L.W.; Raguram, A.; Levy, J.M.; Mercer, J.A.M.; Liu, D.R. Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Nat. Biotechnol. 2022, 40, 731–740. [Google Scholar] [CrossRef]
- Ma, H.; Meng, X.; Xu, K.; Li, M.; Gmitter, F.G., Jr.; Liu, N.; Gai, Y.; Huang, S.; Wang, M.; Wang, M.; et al. Highly efficient hairy root genetic transformation and applications in citrus. Front. Plant Sci. 2022, 13, 1039094. [Google Scholar] [CrossRef]
- Cao, X.; Xie, H.; Song, M.; Lu, J.; Ma, P.; Huang, B.; Wang, M.; Tian, Y.; Chen, F.; Peng, J.; et al. Cut–dip–budding delivery system enables genetic modifications in plants without issue culture. Innovation 2023, 4, 100345. [Google Scholar] [PubMed]
- Lu, J.; Li, S.; Deng, S.; Wang, M.; Wu, Y.; Li, M.; Dong, J.; Lu, S.; Su, C.; Li, G.; et al. A method of genetic transformation and gene editing of succulents without tissue culture. Plant Biotechnol. J. 2024, 22, 1981–1988. [Google Scholar] [CrossRef]
- Mei, G.; Chen, A.; Wang, Y.; Li, S.; Wu, M.; Hu, Y.; Liu, X.; Hou, X. A simple and efficient in planta transformation method based on the active regeneration capacity of plants. Plant Commun. 2024, 5, 100822. [Google Scholar] [CrossRef]
- Ellison, E.E.; Nagalakshmi, U.; Gamo, M.E.; Huang, P.-J.; Dinesh-Kumar, S.; Voytas, D.F. Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Nat. Plants 2020, 6, 620–624. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Hu, J.; Sun, Y.; Li, B.; Zhang, D.; Li, W.; Liu, J.; Li, D.; Gao, C.; Zhang, Y.; et al. Highly efficient heritable genome editing in wheat using an RNA virus and bypassing tissue culture. Mol. Plant 2021, 14, 1787–1798. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Su, Z.; Tian, B.; Liu, Y.; Pang, Y.; Kavetskyi, V.; Trick, H.N.; Bai, G. Development and optimization of a Barley stripe mosaic virus-mediated gene editing system to improve Fusarium head blight resistance in wheat. Plant Biotechnol. J. 2022, 20, 1018. [Google Scholar] [CrossRef] [PubMed]
- Su, W.; Xu, M.; Radani, Y.; Yang, L. Technological development and application of plant genetic transformation. Int. J. Mol. Sci. 2023, 24, 10646. [Google Scholar] [CrossRef]
- Zuo, J.; Niu, Q.W.; Frugis, G.; Chua, N.H. The WUSCHEL gene promotes vegetative-to-embryonic transition in Arabidopsis. Plant J. 2002, 30, 349–359. [Google Scholar] [CrossRef]
- Du, Y.; Scheres, B. PLETHORA transcription factors orchestrate de novo organ patterning during Arabidopsis lateral root outgrowth. Proc. Natl. Acad. Sci. USA 2017, 114, 11709–11714. [Google Scholar] [CrossRef] [PubMed]
- Iwase, A.; Kondo, Y.; Laohavisit, A.; Takebayashi, A.; Ikeuchi, M.; Matsuoka, K.; Asahina, M.; Mitsuda, N.; Shirasu, K.; Fukufa, H.; et al. WIND transcription factors orchestrate wound-induced callus formation, vascular reconnection and defense response in Arabidopsis. New Phytol. 2021, 232, 734. [Google Scholar] [CrossRef]
- Hooykaas, M.J.; Hooykaas, P.J. The genome sequence of hairy root Rhizobium rhizogenes strain LBA9402: Bioinformatics analysis suggests the presence of a new opine system in the agropine Ri plasmid. MicrobiologyOpen 2021, 10, e1180. [Google Scholar] [CrossRef]
- Christensen, B.; Müller, R. The use of Agrobacterium rhizogenes and its rol-genes for quality improvement in ornamentals. Eur. J. Hortic. Sci. 2009, 74, 275. [Google Scholar]
- Ozyigit, I.I.; Dogan, I.; Artam Tarhan, E. Agrobacterium rhizogenes-Mediated transformation and its biotechnological applications in crops. In Crop Improvement: New Approaches and Modern Techniques; Springer: Berlin/Heidelberg, Germany, 2013; pp. 1–48. [Google Scholar]
- Cheng, Y.; Wang, X.; Cao, L.; Ji, J.; Liu, T.; Duan, K. Highly efficient Agrobacterium rhizogenes-Mediated hairy root transformation for gene functional and gene editing analysis in soybean. Plant Methods 2021, 17, 73. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; Liu, N.; Sun, X.; Zhu, M.; Mao, T.; Huang, S.; Meng, X.; Li, H.; Wang, M.; Liang, H. Establishment of an efficient transformation system and its application in regulatory mechanism analysis of biological macromolecules in tea plants. Int. J. Biol. Macromol. 2023, 244, 125372. [Google Scholar] [CrossRef]
- Gong, J.; Chen, Y.; Xu, Y.; Gu, M.; Ma, H.; Hu, X.; Li, X.; Jiao, C.; Sun, X. Tracking organelle activities through efficient and stable root genetic transformation system in woody plants. Hortic. Res. 2023, 11, uhad262. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Xiao, Y.X.; Dutt, M.; Ma, H.; Xiao, C.; Tong, Z.; Wang, Z.-Q.; He, X.-J.; Sun, Z.-H.; Qiu, W.-M. Establishment of an efficient root mediated genetic transformation method for gene function verification in citrus. Sci. Hortic. 2023, 321, 112298. [Google Scholar] [CrossRef]
- Yan, H.; Ma, D.; Yi, P.; Sun, G.; Chen, X.; Yi, Y.; Huang, X. Highly efficient Agrobacterium rhizogenes-Mediated transformation for functional analysis in woodland strawberry. Plant Methods 2023, 19, 99. [Google Scholar] [CrossRef] [PubMed]
- Duan, H.; Maren, N.A.; Ranney, T.G.; Liu, W. New opportunities for using WUS/BBM and GRF-GIF genes to enhance genetic transformation of ornamental plants. Ornam. Plant Res. 2022, 2, 4. [Google Scholar] [CrossRef]
- Kong, J.; Martin-Ortigosa, S.; Finer, J.; Orchard, N.; Gunadi, A.; Batts, L.A.; Thakare, D.; Rush, B.; Schmitz, O.; Stuiver, M.; et al. Overexpression of the transcription factor GROWTH-REGULATING FACTOR5 improves transformation of dicot and monocot species. Front. Plant Sci. 2020, 11, 572319. [Google Scholar] [CrossRef] [PubMed]
- Vandeputte, W.; Coussens, G.; Aesaert, S.; Haeghebaert, J.; Impens, L.; Karimi, M.; Debernardi, J.M.; Pauwels, L. Use of GRF-GIF chimeras and a ternary vector system to improve maize (Zea mays L.) transformation frequency. Plant J. 2024, 119, 2116–2132. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).