Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Toxicity Bioassays
2.3. Laboratory-Induced Resistance Selection
2.4. Fitness Comparison of SpRS and SS T. absoluta
2.5. Spinosad Resistance Gene Effects
2.6. Data Analysis
3. Results
3.1. Spinosad Toxicity and Resistance Development
3.2. Impact of Spinosad Resistance on Biological Parameters of T. absoluta
3.3. Development and Reproduction-Related Gene Expressions
3.4. Expression Levels of Resistance-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Colmenárez, Y.C.; Vásquez, C.; de Freitas Bueno, A.; Cantor, F.; Hidalgo, E.; Corniani, N.; Lagrava, J.J. Sustainable management of the invasive Tuta absoluta (Lepidoptera: Gelechiidae): An overview of case studies from Latin American countries participating in plantwise. J. Integr. Pest Manag. 2022, 13, 15. [Google Scholar] [CrossRef]
- Zhang, G.-F.; Wang, Y.-S.; Gao, Y.-H.; Liu, W.-X.; Zhang, R.; Fu, W.-J.; Xian, X.-Q.; Jun, W.; Kuang, M.; Wan, F.-H. First report of the South American tomato leafminer, Tuta absoluta (Meyrick), in China. J. Integr. Agric. 2020, 19, 1912–1917. [Google Scholar] [CrossRef]
- Desneux, N.; Han, P.; Mansour, R.; Arnó, J.; Brévault, T.; Campos, M.R.; Chailleux, A.; Guedes, R.N.; Karimi, J.; Konan, K.A.J. Integrated pest management of Tuta absoluta: Practical implementations across different world regions. J. Pest Sci. 2022, 95, 17–39. [Google Scholar] [CrossRef]
- Wang, M.-H.; Ismoilov, K.; Liu, W.-X.; Bai, M.; Bai, X.-S.; Chen, B.; Chen, H.; Chen, H.-S.; Dong, Y.-C.; Fang, K. Tuta absoluta management in China: Progress and prospects. Entomol. Gen. 2024, 44, 269–278. [Google Scholar] [CrossRef]
- Biondi, A.; Zappalà, L.; Stark, J.D.; Desneux, N. Do biopesticides affect the demographic traits of a parasitoid wasp and its biocontrol services through sublethal effects? PLoS ONE 2013, 8, e76548. [Google Scholar] [CrossRef] [PubMed]
- Thompson, G.D.; Dutton, R.; Sparks, T.C. Spinosad–a case study: An example from a natural products discovery programme. Pest Manag. Sci. Former. Pestic. Sci. 2000, 56, 696–702. [Google Scholar] [CrossRef]
- Erasmus, R.; van den Berg, J.; van Rensburg, P.J.; du Plessis, H. Residual activity of spinosad applied as a soil drench to tomato seedlings for control of Tuta absoluta. Pest Manag. Sci. 2023, 79, 1860–1867. [Google Scholar] [CrossRef] [PubMed]
- Ullah, F.; Güncan, A.; Gul, H.; Hafeez, M.; Zhou, S.; Wang, Y.; Zhang, Z.; Huang, J.; Ghramh, H.A.; Guo, W. Spinosad-induced intergenerational sublethal effects on Tuta absoluta: Biological traits and related genes expressions. Entomol. Gen. 2024, 44, 395–404. [Google Scholar] [CrossRef]
- Papari, S.; Dousti, A.; Fallahzadeh, M.; Haddi, K.; Desneux, N.; Saghaei, N. Side effects of insecticides used for management of Tuta absoluta Meyrick (Lepidoptera: Gelechidae) on the biocontrol agent Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae). CABI Agric. Biosci. 2024, 5, 101. [Google Scholar] [CrossRef]
- Haseljić, S.; Hrnčić, S.; Bašić, F.; Jurković, J.; Mitrić, S. Effectiveness of Chlorantraniliprole, Methoxyfenozide and Emamectin Benzoate Insecticides in Controlling Tuta Absoluta. In Proceedings of the Scientific-Expert Conference of Agriculture and Food Industry, Sarajevo, Bosnia, 1–2 December 2022; pp. 107–115. [Google Scholar]
- Mansour, R.; Brévault, T.; Chailleux, A.; Cherif, A.; Grissa-Lebdi, K.; Haddi, K.; Mohamed, S.A.; Nofemela, R.S.; Oke, A.; Sylla, S. Occurrence, biology, natural enemies and management of Tuta absoluta in Africa. Entomol. Gen. 2018, 38, 83–112. [Google Scholar] [CrossRef]
- Aboutalebian-Soureshjani, A.; Rafiee-Dastjerdi, H.; Naseri, B.; Hassanpour, M.; Khajehali, J. Indoxacarb resistance in Iranian populations of Tuta absoluta (Lepidoptera: Gelechiidae): Cross-resistance, biochemical and molecular mechanisms. Pestic. Biochem. Physiol. 2023, 196, 105633. [Google Scholar] [CrossRef] [PubMed]
- Grant, C.; Jacobson, R.; Ilias, A.; Berger, M.; Vasakis, E.; Bielza, P.; Zimmer, C.T.; Williamson, M.S.; ffrench-Constant, R.H.; Vontas, J. The evolution of multiple-insecticide resistance in UK populations of tomato leafminer, Tuta absoluta. Pest Manag. Sci. 2019, 75, 2079–2085. [Google Scholar] [CrossRef] [PubMed]
- Berger, M.; Puinean, A.M.; Randall, E.; Zimmer, C.T.; Silva, W.M.; Bielza, P.; Field, L.M.; Hughes, D.; Mellor, I.; Hassani-Pak, K. Insecticide resistance mediated by an exon skipping event. Mol. Ecol. 2016, 25, 5692–5704. [Google Scholar] [CrossRef]
- Ureña, E.; Guillem-Amat, A.; Couso-Ferrer, F.; Beroiz, B.; Perera, N.; López-Errasquín, E.; Castañera, P.; Ortego, F.; Hernández-Crespo, P. Multiple mutations in the nicotinic acetylcholine receptor Ccα6 gene associated with resistance to spinosad in medfly. Sci. Rep. 2019, 9, 2961. [Google Scholar] [CrossRef]
- Zhang, K.; Yuan, J.; Wan, Y.; Wang, J.; Zheng, X.; Zhang, Y.; Wu, S.; Liang, P.; Zhou, X.; Wu, Q. An insertion in intron 3 of nAChR α6 subunit is associated with spinosad resistance in the western flower thrips, Frankliniella occidentalis. Entomol. Gen. 2023, 43, 605–613. [Google Scholar] [CrossRef]
- Bastarache, P.; Bouafoura, R.; Omakele, E.; Moffat, C.E.; Vickruck, J.L.; Morin, P.J. Spinosad-associated modulation of select cytochrome P450s and glutathione S-transferases in the Colorado potato beetle, Leptinotarsa decemlineata. Arch. Insect Biochem. Physiol. 2023, 112, e21993. [Google Scholar] [CrossRef] [PubMed]
- Qu, C.; Yao, J.; Huang, J.; Che, W.; Fang, Y.; Luo, C.; Wang, R. Tetraniliprole resistance in field-collected populations of Tuta absoluta (Lepidoptera: Gelechiidae) from China: Baseline susceptibility, cross-resistance, inheritance, and biochemical mechanism. Pestic. Biochem. Physiol. 2024, 203, 106019. [Google Scholar] [CrossRef]
- Sagri, E.; Reczko, M.; Gregoriou, M.-E.; Tsoumani, K.T.; Zygouridis, N.E.; Salpea, K.D.; Zalom, F.G.; Ragoussis, J.; Mathiopoulos, K.D. Olive fly transcriptomics analysis implicates energy metabolism genes in spinosad resistance. BMC Genom. 2014, 15, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Hou, W.; Liu, Q.; Tian, L.; Wu, Q.; Zhang, Y.; Xie, W.; Wang, S.; San Miguel, K.; Funderburk, J.; Scott, J.G. The α6 nicotinic acetylcholine receptor subunit of Frankliniella occidentalis is not involved in resistance to spinosad. Pestic. Biochem. Physiol. 2014, 111, 60–67. [Google Scholar] [CrossRef] [PubMed]
- Silva, J.E.; Ribeiro, L.M.d.S.; Vinasco, N.; Guedes, R.N.C.; Siqueira, H.Á.A. Field-evolved resistance to chlorantraniliprole in the tomato pinworm Tuta absoluta: Inheritance, cross-resistance profile, and metabolism. J. Pest Sci. 2019, 92, 1421–1431. [Google Scholar] [CrossRef]
- Silva, G.A.; Picanço, M.C.; Bacci, L.; Crespo, A.L.B.; Rosado, J.F.; Guedes, R.N.C. Control failure likelihood and spatial dependence of insecticide resistance in the tomato pinworm, Tuta absoluta. Pest Manag. Sci. 2011, 67, 913–920. [Google Scholar] [CrossRef] [PubMed]
- Roditakis, E.; Skarmoutsou, C.; Staurakaki, M.; del Rosario Martínez-Aguirre, M.; García-Vidal, L.; Bielza, P.; Haddi, K.; Rapisarda, C.; Rison, J.L.; Bassi, A. Determination of baseline susceptibility of E uropean populations of Tuta absoluta (M eyrick) to indoxacarb and chlorantraniliprole using a novel dip bioassay method. Pest Manag. Sci. 2013, 69, 217–227. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Benchaâbane, S.; Aribi, N.; Kilani-Morakchi, S.; Chaabane, M. Delayed toxic effects of spinosad on G1 progeny of an invasive species, Tuta absoluta (Lepidoptera: Gelechiidae). Afr. Entomol. 2016, 24, 412–420. [Google Scholar] [CrossRef]
- Prasannakumar, N.; Jyothi, N.; Saroja, S.; Kumar, G.R. Relative toxicity and insecticide resistance of different field population of tomato leaf miner, Tuta absoluta (Meyrick). Int. J. Trop. Insect Sci. 2021, 41, 1397–1405. [Google Scholar] [CrossRef]
- Stavrakaki, M.; Ilias, A.; Ioannidis, P.; Vontas, J.; Roditakis, E. Investigating mechanisms associated with emamectin benzoate resistance in the tomato borer Tuta absoluta. J. Pest Sci. 2022, 95, 1163–1177. [Google Scholar] [CrossRef]
- Mocchetti, A.; Dermauw, W.; Van Leeuwen, T. Incidence and molecular mechanisms of insecticide resistance in Frankliniella occidentalis, Thrips tabaci and other economically important thrips species. Entomol. Gen. 2023, 43, 587–604. [Google Scholar] [CrossRef]
- Kandil, M.A.; Abdel-Kerim, R.N.; Moustafa, M.A. Lethal and sub-lethal effects of bio-and chemical insecticides on the tomato leaf miner, Tuta absoluta (Meyrick)(Lepidoptera: Gelechiidae). Egypt. J. Biol. Pest Control 2020, 30, 1–7. [Google Scholar] [CrossRef]
- Gonçalves, G.A.d.S.; Haddi, K.; Ribas, N.d.S.; Santos, K.C.P.; Tschoeke, L.F.P.; Lima, E. Age, weight, and mating status of the male influence female choice and reproductive success in Tuta absoluta. Entomol. Gen. 2024, 44, 443–450. [Google Scholar] [CrossRef]
- Wang, D.; Qiu, X.; Wang, H.; Qiao, K.; Wang, K. Reduced fitness associated with spinosad resistance in Helicoverpa armigera. Phytoparasitica 2010, 38, 103–110. [Google Scholar] [CrossRef]
- Yang, W.-J.; Yan, X.; Han, P.; Wang, M.-h.; Zhang, C.; Song, J.-H.; Zhang, G.-F.; Zhang, Y.-B.; Wan, F.-H. Ovarian development and role of vitellogenin gene in reproduction of the tomato leaf miner, Tuta absoluta. Entomol. Gen. 2023, 44, 423–432. [Google Scholar] [CrossRef]
- Campos, M.R.; Rodrigues, A.R.S.; Silva, W.M.; Silva, T.B.M.; Silva, V.R.F.; Guedes, R.N.C.; Siqueira, H.A.A. Spinosad and the tomato borer Tuta absoluta: A bioinsecticide, an invasive pest threat, and high insecticide resistance. PLoS ONE 2014, 9, e103235. [Google Scholar] [CrossRef]
- Miranda, M.; Picanço, M.; Zanuncio, J.; Guedes, R. Ecological life table of Tuta absoluta (Meyrick)(Lepidoptera: Gelechiidae). Biocontrol Sci. Technol. 1998, 8, 597–606. [Google Scholar] [CrossRef]
- Karanu, S.W.; Ajene, I.J.; Lelmen, E.K.; Ong’onge, M.A.; Akutse, K.S.; Khamis, F.M. Biochemistry and transcriptomic analyses of Phthorimaea absoluta (Lepidoptera: Gelechiidae) response to insecticides. Sci. Rep. 2024, 14, 7931. [Google Scholar] [CrossRef]
- Wang, J.; Wan, Y.; Zhang, Y.; Yuan, J.; Zheng, X.; Cao, H.; Qian, K.; Feng, J.; Tang, Y.; Chen, S. Uridine diphosphate glucosyltransferases are involved in spinosad resistance in western flower thrips Frankliniella occidentalis (Pergande). J. Hazard. Mater. 2024, 466, 133575. [Google Scholar] [CrossRef] [PubMed]
- Han, C.; Rahman, M.-M.; Kim, J.; Lueke, B.; Nauen, R. Genome-wide analysis of detoxification genes conferring diamide insecticide resistance in Spodoptera exigua identifies CYP9A40. Chemosphere 2024, 367, 143623. [Google Scholar] [CrossRef] [PubMed]
- Kaplanoglu, E.; Scott, I.M.; Vickruck, J.; Donly, C. Role of CYP9E2 and a long non-coding RNA gene in resistance to a spinosad insecticide in the Colorado potato beetle, Leptinotarsa decemlineata. PLoS ONE 2024, 19, e0304037. [Google Scholar] [CrossRef]
- Wang, W.; Zhang, R.; Liu, H.; Ding, R.; Huang, Q.; Yao, J.; Liang, G. Resistance development, cross-resistance, and fitness costs associated with Aphis gossypii resistance towards sulfoxaflor and acetamiprid in different geographical regions. J. Integr. Agric. 2024, 23, 2332–2345. [Google Scholar] [CrossRef]
- Ullah, F.; Gul, H.; Tariq, K.; Hafeez, M.; Desneux, N.; Song, D. Silencing of Cytochrome P450 genes CYP6CY14 and CYP6DC1 in Aphis gossypii by RNA interference enhances susceptibility to clothianidin. Entomol. Gen. 2023, 43, 669–678. [Google Scholar] [CrossRef]
- Kaplanoglu, E.; Chapman, P.; Scott, I.M.; Donly, C. Overexpression of a cytochrome P450 and a UDP-glycosyltransferase is associated with imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata. Sci. Rep. 2017, 7, 1762. [Google Scholar] [CrossRef] [PubMed]
- Hafeez, M.; Li, X.; Ullah, F.; Zhang, Z.; Zhang, J.; Huang, J.; Fernández-Grandon, G.M.; Khan, M.M.; Siddiqui, J.A.; Chen, L. Down-regulation of P450 genes enhances susceptibility to indoxacarb and alters physiology and development of fall armyworm, Spodoptera frugipreda (Lepidoptera: Noctuidae). Front. Physiol. 2022, 13, 884447. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, A.R.B.d.; Fresia, P.; Cônsoli, F.L.; Omoto, C. Comparative transcriptome analysis of lufenuron-resistant and susceptible strains of Spodoptera frugiperda (Lepidoptera: Noctuidae). BMC Genom. 2015, 16, 1–12. [Google Scholar] [CrossRef]
- Vandenhole, M.; Lu, X.; Tsakireli, D.; Mermans, C.; De Rouck, S.; De Beer, B.; Simma, E.; Pergantis, S.A.; Jonckheere, W.; Vontas, J. Contrasting roles of cytochrome P450s in amitraz and chlorfenapyr resistance in the crop pest Tetranychus urticae. Insect Biochem. Mol. Biol. 2024, 164, 104039. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Forward Sequence | Reverse Sequence |
---|---|---|
Vg | TGGTACGTGGTTATGCAGGA | TACTTCGACACTGGGGGTTC |
VgR | TACTTCGACACTGGGGGTTC | ATCTTTGTCCGGACCACACT |
JHBP | CCCATTAACCATGCCACAGG | TGAAGCTTTTCCTGGTGTGTC |
JHE | TTAAAACTGGCGCTCCTTCG | CATGTCGTCTTGCTCTGTCG |
JHAMT | AATCCGTTCAAGATGTCGCG | CACAATGAGCGTGTAGTCCG |
JHDK | TTTCAAATCCTTCGGCCGTG | CCAGGATCGCTAGGGTTCTC |
CYP4M116 | GACGCCAACTTTCCACTTCAAC | GCCCATCGCTGTTTCGCATA |
CYP6AW1 | GCCTTGAAACATCAGCCACAAC | GTCAATCCGTCGTGCTTACTCA |
CYP339A1 | TCTCGCTTCACCTCGTCCTG | CGAACGGCAGAACCATAGACTC |
CYP9A307v2 | AAAGGTTCGTGGGCAGATTCG | TCGTTCAGGAAGTCTCGGTGAT |
CYP4S55 | GGTTCCACGAGAGCATCTATTCA | CGAGAGCACCACCTCAACATC |
CYP15C1 | GCAGCAGGAGATAGATGAAGTCA | CACGGAGGATATGCGAAGAGTT |
CYP321C40 | GGAATGAGATACGCACGACTACA | CACCGCTTGCTTGCTGTACT |
CYP6AB327 | AAGGTGCTCTAGTGGGAGAATCT | AATCCTGCGGCGAAGAATACAA |
RPL28 | TCAGACGTGCTGAACACACA | GCCAGTCTTGGACAACCATT |
TaEF1α | GAAGCCTGGTATGGTTGTCGT | GGGTGGGTTGTTCTTTGTG |
Gen. | LC50 (95% CI) a mg/L | Slope ± SE b | χ2 c | df | p-Value | RR d |
---|---|---|---|---|---|---|
F0 | 0.040 (0.033–0.047) | 2.728 ± 0.280 | 5.349 | 16 | 0.994 | / |
F1 | 0.042 (0.036–0.049) | 2.91 ± 0.306 | 3.304 | 13 | 0.997 | 1.05 |
F2 | 0.051 (0.044–0.060) | 2.713 ± 0.271 | 6.354 | 13 | 0.932 | 1.27 |
F3 | 0.077 (0.066–0.091) | 2.411 ± 0.239 | 4.561 | 13 | 0.984 | 1.92 |
F4 | 0.132 (0.109–0.167) | 2.073 ± 0.237 | 4.498 | 13 | 0.985 | 3.30 |
F5 | 0.224 (0.173–0.310) | 1.419 ± 0.196 | 4.993 | 13 | 0.975 | 5.60 |
F6 | 0.339 (0.291–0.400) | 2.595 ± 0.251 | 12.394 | 13 | 0.496 | 8.47 |
F7 | 0.451 (0.382–0.539) | 2.650 ± 0.33 | 6.134 | 13 | 0.941 | 11.27 |
F8 | 0.576 (0.482–0.716) | 2.369 ± 0.268 | 4.825 | 13 | 0.979 | 14.40 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ullah, F.; Murtaza, G.; Li, X.; Gul, H.; Wang, Y.; Zhao, S.; Abbas, A.; Zhang, Z.; Huang, J.; Desneux, N.; et al. Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest. Agronomy 2025, 15, 358. https://doi.org/10.3390/agronomy15020358
Ullah F, Murtaza G, Li X, Gul H, Wang Y, Zhao S, Abbas A, Zhang Z, Huang J, Desneux N, et al. Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest. Agronomy. 2025; 15(2):358. https://doi.org/10.3390/agronomy15020358
Chicago/Turabian StyleUllah, Farman, Ghulam Murtaza, Xiaowei Li, Hina Gul, Yaru Wang, Shengyuan Zhao, Arzlan Abbas, Zhijun Zhang, Jun Huang, Nicolas Desneux, and et al. 2025. "Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest" Agronomy 15, no. 2: 358. https://doi.org/10.3390/agronomy15020358
APA StyleUllah, F., Murtaza, G., Li, X., Gul, H., Wang, Y., Zhao, S., Abbas, A., Zhang, Z., Huang, J., Desneux, N., & Lu, Y. (2025). Selection-Induced Spinosad Resistance and Associated Fitness Costs in Tuta absoluta: A Key Invasive Tomato Pest. Agronomy, 15(2), 358. https://doi.org/10.3390/agronomy15020358