GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growing Conditions
2.2. Treatments and Determination of Relative Expression
2.3. Evolutionary Tree Construction and Domain Analysis
2.4. Subcellular Localization
2.5. Stable and Transient GsEXPA8 Overexpression in Soybean
2.6. Determination of Root Physiological Indexes
2.7. Analysis of Root Morphology and Gene Tissue Localization in Hairy Roots of WT and GsEXPA8-Overexpressing Plants
2.8. Western Blotting
2.9. Immunochromatographic Detection
2.10. 3,3-Diaminobenzidine Staining
2.11. Statistical Analysis
3. Results
3.1. GsEXPA8 Expression Was Significantly Upregulated Under Alkali Stress and ABA Treatment
3.2. When the Cell Wall Was Present, GsEXPA8 Relocated from the Cytoplasm to the Membrane and Cell Wall
3.3. GsEXPA8 Overexpression Increased Soybean Alkali Stress Tolerance
3.4. Transient GsEXPA8 Overexpression Promoted Root Morphology Alteration
3.5. GsEXPA8 Overexpression Increased Alkali-Tolerant Gene Expression
4. Discussion
4.1. Roles of GsEXPA8 Under Sodium Bicarbonate Stress
4.2. Relationship of GsEXPA8 to Root Development and Increased Alkali Stress
4.3. The Regulatory Pathway of GsEXPA8 Gene Expression Involves Interactions with Marker Genes
4.4. GsEXPA8 May Work in an Eco-Physiological System
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Cao, L.; Yu, Y.; Mu, H.; Chen, C.; Duan, X.; Zhu, P.; Chen, R.; Li, Q.; Zhu, Y.; Ding, X. A novel Glycine soja homeodomain-leucine zipper (HD-Zip) I gene, Gshdz4, positively regulates bicarbonate tolerance and responds to osmotic stress in Arabidopsis. BMC Plant Biol. 2016, 16, 184. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, T.; Li, C.; Zhou, C.; Liu, B.; Wu, Y.; He, F.; Xu, Y.; Li, F.; Feng, X. Overexpression of Wild Soybean Expansin Gene GsEXLB14 Enhanced the Tolerance of Transgenic Soybean Hairy Roots to Salt and Drought Stresses. Plants 2024, 13, 1656. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Yu, Y.; Ding, X.; Liu, B.; Duanmu, H.; Zhu, D.; Sun, X.; Cao, L.; Zaib Un, N.; Li, Q.; et al. Genome-wide analysis and expression profiling of PP2C clade D under saline and alkali stresses in wild soybean and Arabidopsis. Protoplasma 2018, 255, 643–654. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.; Yu, Y.; Ding, X.; Zhu, D.; Yang, F.; Liu, B.; Sun, X.; Duan, X.; Yin, K.; Zhu, Y. The Glycine soja NAC transcription factor GsNAC019 mediates the regulation of plant alkaline tolerance and ABA sensitivity. Plant Mol. Biol. 2017, 95, 253–268. [Google Scholar] [CrossRef]
- Duan, X.; Yu, Y.; Duanmu, H.; Chen, C.; Sun, X.; Cao, L.; Li, Q.; Ding, X.; Liu, B.; Zhu, Y. GsSLAH3, a Glycine soja slow type anion channel homolog, positively modulates plant bicarbonate stress tolerance. Physiol. Plant 2018, 164, 145–162. [Google Scholar] [CrossRef]
- McQueen-Mason, S.; Cosgrove, D.J. Disruption of hydrogen bonding between plant cell wall polymers by proteins that induce wall extension. Proc. Natl. Acad. Sci. USA 1994, 91, 6574–6578. [Google Scholar] [CrossRef]
- Kende, H.; Bradford, K.; Brummell, D.; Cho, H.T.; Cosgrove, D.; Fleming, A.; Gehring, C.; Lee, Y.; McQueen-Mason, S.; Rose, J.; et al. Nomenclature for members of the expansin superfamily of genes and proteins. Plant Mol. Biol. 2004, 55, 311–314. [Google Scholar] [CrossRef]
- Zou, H.; Wenwen, Y.; Zang, G.; Kang, Z.; Zhang, Z.; Huang, J.; Wang, G. OsEXPB2, a β-expansin gene, is involved in rice root system architecture. Mol. Breed. 2015, 35, 41. [Google Scholar] [CrossRef]
- Kaleem, F.; Shahzad, M.; Shabir, G.; Aslam, K.; Shah, S.M.; Khan, A.R. Salt Stress Induces Genotype-specific DNA Hypomethylation in ZmEXPB2 and ZmXET1 Genes in Maize. Cereal Res. Commun. 2019, 47, 216–227. [Google Scholar] [CrossRef]
- Li, F.; Xing, S.; Guo, Q.; Zhao, M.; Zhang, J.; Gao, Q.; Wang, G.; Wang, W. Drought tolerance through over-expression of the expansin gene TaEXPB23 in transgenic tobacco. J. Plant Physiol. 2011, 168, 960–966. [Google Scholar] [CrossRef]
- Li, A.; Han, Y.; Wang, X.; Chen, Y.; Zhao, M.; Zhou, S.-M.; Wang, W. Root-specific expression of wheat expansin gene TaEXPB23 enhances root growth and water stress tolerance in tobacco. Environ. Exp. Bot. 2015, 110, 73–84. [Google Scholar] [CrossRef]
- Feng, X.; Xu, Y.; Peng, L.; Yu, X.; Zhao, Q.; Feng, S.; Zhao, Z.; Li, F.; Hu, B. TaEXPB7-B, a β-expansin gene involved in low-temperature stress and abscisic acid responses, promotes growth and cold resistance in Arabidopsis thaliana. J. Plant Physiol. 2019, 240, 153004. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.R.; Lee, H.J.; Kim, K.H.; Hong, S.W.; Lee, S.J.; Lee, H. Ectopic expression of Expansin3 or Expansinbeta1 causes enhanced hormone and salt stress sensitivity in Arabidopsis. Biotechnol. Lett. 2008, 30, 1281–1288. [Google Scholar] [CrossRef] [PubMed]
- Dong, B.; Wang, Q.; Zhou, D.; Wang, Y.; Miao, Y.; Zhong, S.; Fang, Q.; Yang, L.; Xiao, Z.; Zhao, H. Abiotic stress treatment reveals expansin like A gene OfEXLA1 improving salt and drought tolerance of Osmanthus fragrans by responding to abscisic acid. Hortic. Plant J. 2024, 10, 537–585. [Google Scholar] [CrossRef]
- Zhang, H.; Ding, Y.; Zhi, J.; Li, X.; Liu, H.; Xu, J. Over-expression of the poplar expansin gene PtoEXPA12 in tobacco plants enhanced cadmium accumulation. Int. J. Biol. Macromol. 2018, 116, 676–682. [Google Scholar] [CrossRef]
- Zhu, Y.; Wu, N.; Song, W.; Yin, G.; Qin, Y.; Yan, Y.; Hu, Y. Soybean (Glycine max) expansin gene superfamily origins: Segmental and tandem duplication events followed by divergent selection among subfamilies. BMC Plant Biol. 2014, 14, 93. [Google Scholar] [CrossRef]
- Lee, D.K.; Ahn, J.H.; Song, S.K.; Choi, Y.D.; Lee, J.S. Expression of an expansin gene is correlated with root elongation in soybean. Plant Physiol. 2003, 131, 985–997. [Google Scholar] [CrossRef]
- Yang, Z.; Gao, Z.; Zhou, H.; He, Y.; Liu, Y.; Lai, Y.; Zheng, J.; Li, X.; Liao, H. GmPTF1 modifies root architecture responses to phosphate starvation primarily through regulating GmEXPB2 expression in soybean. Plant J. 2021, 107, 525–543. [Google Scholar] [CrossRef]
- Feng, X.; Li, C.; He, F.; Xu, Y.; Li, L.; Wang, X.; Chen, Q.; Li, F. Genome-Wide Identification of Expansin Genes in Wild Soybean (Glycine soja) and Functional Characterization of Expansin B1 (GsEXPB1) in Soybean Hair Root. Int. J. Mol. Sci. 2022, 23, 5407. [Google Scholar] [CrossRef]
- He, X.; Zeng, J.; Cao, F.; Ahmed, I.M.; Zhang, G.; Vincze, E.; Wu, F. HvEXPB7, a novel β-expansin gene revealed by the root hair transcriptome of Tibetan wild barley, improves root hair growth under drought stress. J. Exp. Bot. 2015, 66, 7405–7419. [Google Scholar] [CrossRef]
- Zou, C.-L.; Wang, Y.-B.; Wang, B.; Liu, D.; Liu, L.; Li, C.-F. Effects of alkali stress on dry matter accumulation, root morphology, ion balance, free polyamines, and organic acids of sugar beet. Acta Physiol. Plant. 2021, 43, 13. [Google Scholar] [CrossRef]
- Harb, A.; Asaad, H. Profiling the expression of expansin genes in barley roots under salinity stress at the germination stage. J. Plant Interact. 2024, 19, 2360938. [Google Scholar] [CrossRef]
- Peng, L.N.; Xu, Y.Q.; Wang, X.; Feng, X.; Zhao, Q.Q.; Feng, S.S.; Zhao, Z.Y.; Hu, B.Z.; Li, F.L. Overexpression of paralogues of the wheat expansin gene TaEXPA8 improves low-temperature tolerance in Arabidopsis. Plant Biol. 2019, 21, 1119–1131. [Google Scholar] [CrossRef]
- Lo, T.S.; Le, H.D.; Nguyen, V.T.; Chu, H.H.; Le, V.-S.; Chu, H.M. Overexpression of a soybean expansin gene, GmEXP1, improvesdrought tolerance in transgenic tobacco. Turk. J. Bot. 2015, 39, 988–995. [Google Scholar] [CrossRef]
- Kong, Y.; Wang, B.; Du, H.; Li, W.; Li, X.; Zhang, C. GmEXLB1, a Soybean Expansin-Like B Gene, Alters Root Architecture to Improve Phosphorus Acquisition in Arabidopsis. Front. Plant Sci. 2019, 10, 808. [Google Scholar] [CrossRef]
- Chen, X.; Jiang, X.; Sun, X.; Hu, Z.; Gao, F.; Wang, X.; Zhang, H.; Chen, R.; Jiang, Q. Gene editing and overexpression of soybean miR396a reveals its role in salinity tolerance and development. Crop J. 2024. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Li, X.; Wang, X.; Yang, Y.; Li, R.; He, Q.; Fang, X.; Luu, D.T.; Maurel, C.; Lin, J. Single-molecule analysis of PIP2;1 dynamics and partitioning reveals multiple modes of Arabidopsis plasma membrane aquaporin regulation. Plant Cell. 2011, 23, 3780–3797. [Google Scholar] [CrossRef]
- Liang, M.; Li, H.; Zhou, F.; Li, H.; Liu, J.; Hao, Y.; Wang, Y.; Zhao, H.; Han, S. Subcellular Distribution of NTL Transcription Factors in Arabidopsis thaliana. Traffic 2015, 16, 1062–1074. [Google Scholar] [CrossRef]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Barampuram, S.; Stacey, M.G.; Hancock, C.N.; Findley, S.; Mathieu, M.; Zhang, Z.; Parrott, W.A.; Stacey, G. Tnt1 retrotransposon mutagenesis: A tool for soybean functional genomics. Plant Physiol. 2013, 161, 36–47. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhang, D.; Yuan, Y.; Chen, P.; Zhang, P.; Jin, F.; Yang, Q.; Feng, B. A promising crop for cadmium-contamination remediation: Broomcorn millet. Ecotoxicol. Environ. Saf. 2021, 224, 112669. [Google Scholar] [CrossRef] [PubMed]
- Sule, R.; Rivera, G.; Gomes, A.V. Western blotting (immunoblotting): History, theory, uses, protocol and problems. Biotechniques 2023, 75, 99–114. [Google Scholar] [CrossRef]
- Christ, B.; Hochstrasser, R.; Guyer, L.; Francisco, R.; Aubry, S.; Hörtensteiner, S.; Weng, J.K. Non-specific activities of the major herbicide-resistance gene BAR. Nat. Plants 2017, 3, 937–945. [Google Scholar] [CrossRef]
- Feng, X.; Feng, P.; Yu, H.; Yu, X.; Sun, Q.; Liu, S.; Minh, T.N.; Chen, J.; Wang, D.; Zhang, Q.; et al. GsSnRK1 interplays with transcription factor GsERF7 from wild soybean to regulate soybean stress resistance. Plant Cell Environ. 2020, 43, 1192–1211. [Google Scholar] [CrossRef]
- Sun, Q.; Lu, H.R.; Zhang, Q.; Wang, D.; Chen, J.; Xiao, J.L.; Ding, X.D.; Li, Q. Transcriptome sequencing of wild soybean revealed gene expression dynamics under low nitrogen stress. J. Appl. Genet. 2021, 62, 389–404. [Google Scholar] [CrossRef]
- Acosta-Motos, J.R.; Ortuno, M.F.; Bernal-Vicente, A.; Diaz-Vivancos, P.; Sanchez-Blanco, M.J.; Hernandez, J.A. Plant responses to salt stress: Adaptive mechanisms. Agronomy 2017, 7, 18. [Google Scholar] [CrossRef]
- Witzel, K.; Matros, A.; Möller, A.L.B.; Ramireddy, E.; Finnie, C.; Peukert, M.; Rutten, T.; Herzog, A.; Kunze, G.; Melzer, M.J.; et al. Plasma membrane proteome analysis identifies a role of barley membrane steroid binding protein in root architecture response to salinity. Plant Cell Environ. 2018, 41, 1311–1330. [Google Scholar] [CrossRef]
- Wang, H.; Zhou, L.; Fu, Y.; Cheung, M.Y.; Wong, F.L.; Phang, T.H.; Sun, Z.; Lam, H.M. Expression of an apoplast-localized BURP-domain protein from soybean (GmRD22) enhances tolerance towards abiotic stress. Plant Cell Environ. 2012, 35, 1932–1947. [Google Scholar] [CrossRef]
- Zhang, B.; Liu, Z.; Zhou, R.; Cheng, P.; Li, H.; Wang, Z.; Liu, Y.; Li, M.; Zhao, Z.; Hu, Z.; et al. Genome-wide analysis of soybean DnaJA-family genes and functional characterization of GmDnaJA6 responses to saline and alkaline stress. Crop J. 2023, 11, 1230–1241. [Google Scholar] [CrossRef]
- Xun, H.; Yang, X.; He, H.; Wang, M.; Guo, P.; Wang, Y.; Pang, J.; Dong, Y.; Feng, X.; Wang, S.; et al. Over-expression of GmKR3, a TIR-NBS-LRR type R gene, confers resistance to multiple viruses in soybean. Plant Mol. Biol. 2018, 99, 95–111. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Yang, H.; Fang, Y.; Guo, W.; Chen, H.; Zhang, X.; Dai, W.; Chen, S.; Hao, Q.; Yuan, S.; et al. Overexpression of GmMYB14 improves high-density yield and drought tolerance of soybean through regulating plant architecture mediated by the brassinosteroid pathway. Plant Biotechnol. J. 2020, 19, 702–716. [Google Scholar] [CrossRef]
- Hura, T.; Hura, K.; Ostrowska, A. Drought-Stress Induced Physiological and Molecular Changes in Plants. Int. J. Mol. Sci. 2022, 23, 4698. [Google Scholar] [CrossRef]
- Patel, J.; Khatri, K.; Khandwal, D.; Gupta, N.K.; Choudhary, B.; Hapani, D.; Koshiya, J.; Syed, S.N.; Phillips, D.W.; Jones, H.D.; et al. Modulation of physio-biochemical and photosynthesis parameters by overexpressing SbPIP2 gene improved abiotic stress tolerance of transgenic tobacco. Physiol. Plant. 2024, 176, e14384. [Google Scholar] [CrossRef]
- Sunil, S.; Saini, R. Photorespiration is complemented by cyclic electron flow and the alternative oxidase pathway to optimize photosynthesis and protect against abiotic stress. Photosynth. Res. 2019, 139, 67–79. [Google Scholar] [CrossRef]
- Hura, T.; Hura, K.; Ostrowska, A. Drought stress-induced physiological mechanisms, signaling pathways and molecular response of chloroplasts in common vegetable crops. Crit. Rev. Biotechnol. 2021, 41, 669–691. [Google Scholar]
- Suzuki, N.; Koussevitzky, S.; Mittler, R.; Miller, G. ROS and redox signaling in the response of plants to abiotic stress. Plant Cell Environ. 2012, 35, 259–270. [Google Scholar] [CrossRef]
- Bahmani, R.; Kim, D.; Modareszadeh, M.; Hwang, S. Ethylene and ROS mediate root growth inhibition induced by the endocrine disruptor bisphenol A (BPA). Plant Physiol. Biochem. 2023, 205, 108212. [Google Scholar] [CrossRef]
- Liu, T.; Ji, J.; Cheng, Y.; Zhang, S.; Wang, Z.; Duan, K.; Wang, Y. CRISPR/Cas9-mediated editing of GmTAP1 confers enhanced resistance to Phytophthora sojae in soybean. J. Integr. Plant Biol. 2023, 65, 13476. [Google Scholar] [CrossRef]






| Primer Names | Primer Sequences (5′-3′) |
|---|---|
| qEA1-R | CCAAGAAGAGCCATTTTCCTTGAA |
| qEA1-F | ATTTGCATGGTCCCAACCGT |
| qEA6-R | CACACGCTCCTCCCATAGTT |
| qEA6-F | TCTCCATTCTCTCTCTCTTACTCAC |
| qEA8-F | GGTATGGCACTAACACTG |
| qEA8-R | TCTAGACCCTTTGATGGA |
| qEA9-R | AAACTGAGCTCAATGCTGCC |
| qEA9-F | AGGCTCTGGAACATTTGGAGG |
| qEA10-F | TGACTGCCCCTATTGAAGGC |
| qEA10-R | ACAAACTTGAGCCATTTTTCTTTTG |
| qEA11-F | CCTCTGGGACAATGGGAGGA |
| qEA11-R | CACTCCCCACACGATGCTC |
| qEA12-F | ATTTTTGCTTTGTTCTAAGTGCAG |
| qEA12-R | CCACATGCTCCCCCAAGG |
| qEA15-R | GGTACCAGCAATTCATCTGAGAG |
| qEA15-F | CTGGCAGAGCAACTCCTACC |
| qEA20-R | CATAACCACATGCTCCTTCTGT |
| qEA20-F | AGACCAGGAGTGGAAGAAAGC |
| qEA23-F | CAGTCGTCATCGAAGAAGTGGA |
| qEA23-R | AGCCACAAGCACCCTGCAT |
| qGmACTIN4-F | GTGTCAGCCATACTGTCCCCATTT |
| qGmACTIN4-R | GTTTCAAGCTCTTGCTCGTAATCA |
| Primer Names | Primer Sequences (5′-3′) |
|---|---|
| qRD22-F | TCGTCTCCTACCCATTTTTACTTTA |
| qRD22-R | TCCACCCAATCGGGGTAA |
| qDnaJA6-F | AGCAGTGGCTAAGCTAGCAG |
| qDnaJA6-R | TCCCGCGAAAATCTGAGGAT |
| qMYB14-F | ACATCTGGGTAACAGATGGTC |
| qMYB14-R | GTGGCTACTGAGTCTTGTTGA |
| qNFYC1-F | GCTCTTGGAATCACACTGAAG |
| qNFYC1-R | GGCATGTAGCAGTATGGAAG |
| qKIN1-F | ATCTCCATAACGGACTTCGGTG |
| qKIN1-R | ATTCCCCAACTCCTGCGTGG |
| qGmACTIN4-F | GTGTCAGCCATACTGTCCCCATTT |
| qGmACTIN4-R | GTTTCAAGCTCTTGCTCGTAATCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, M.; Tang, J.; Ma, S.; Liu, Y.; Wang, X.; Du, X.; Sun, X.; Zeng, Y.; Zeng, Y.; Ding, X.; et al. GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology. Agronomy 2025, 15, 16. https://doi.org/10.3390/agronomy15010016
Liu M, Tang J, Ma S, Liu Y, Wang X, Du X, Sun X, Zeng Y, Zeng Y, Ding X, et al. GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology. Agronomy. 2025; 15(1):16. https://doi.org/10.3390/agronomy15010016
Chicago/Turabian StyleLiu, Mengyu, Jixiang Tang, Shengjie Ma, Yujing Liu, Xiaoyu Wang, Xinlei Du, Xiaohuan Sun, Yucheng Zeng, Yulong Zeng, Xiaodong Ding, and et al. 2025. "GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology" Agronomy 15, no. 1: 16. https://doi.org/10.3390/agronomy15010016
APA StyleLiu, M., Tang, J., Ma, S., Liu, Y., Wang, X., Du, X., Sun, X., Zeng, Y., Zeng, Y., Ding, X., Han, Y., Zhang, J., & Cao, L. (2025). GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology. Agronomy, 15(1), 16. https://doi.org/10.3390/agronomy15010016

