Next Article in Journal
Research on the Genetic Improvement Effects of Lodging Resistance-Related Traits in Maize Core Germplasm
Previous Article in Journal
Analysis of Soil Microbial Community Structure and Function in Morchella esculenta Habitats in Jilin Province
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology

1
College of Horticulture and Landscape Architecture, Northeast Agricultural University, No. 600, Changjiang Road, Xiangfang District, Harbin 150030, China
2
School of Geography and Tourism, Harbin University, No. 109, Zhongxing Avenue, Nangang District, Harbin 150076, China
3
Hangzhou Fusheng Agricultural Technology Development Co., Ltd., No.1, Yinhu Street, Fuyang District, Hangzhou 311400, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2025, 15(1), 16; https://doi.org/10.3390/agronomy15010016
Submission received: 14 November 2024 / Revised: 11 December 2024 / Accepted: 21 December 2024 / Published: 26 December 2024
(This article belongs to the Section Plant-Crop Biology and Biochemistry)

Abstract

:
Saline–alkali environments restrict soybean production in China. Wild soybean genes can be used to improve the alkaline tolerance of cultivated soybean in molecular breeding. The expansin protein family promotes cell wall expansion. In this study, the relative expression levels of expansin family genes in wild soybean treated with 50 mM NaHCO3 were measured at 0, 3, 6, and 12 h, and the relative expression of GsEXPA8 was found to be higher at 12 h. Wild soybean was treated with abscisic acid (ABA), indole-3-acetic acid (IAA), gibberellic acid (GA), and jasmonic acid (JA), and GsEXPA8 was found to respond to ABA and IAA signals. Sequence analysis shows that GsEXPA8 has DPBB_EXPA and expansin domains. Subcellular localization analysis shows that GsEXPA8 was localized in the cytoplasm in protoplasts and the cell membrane or wall in tobacco, indicating that it has nuclear membrane localization signals. GsEXPA8 overexpression reduced the malondialdehyde content in transgenic plants treated with NaHCO3 and increased peroxidase activity before treatment. After the transformation of soybean roots from hair roots, GsEXPA8 was found to be expressed in the outer root cells and promote the development of thicker, shorter roots, thereby improving the plant’s alkaline tolerance. Stable GsEXPA8 transformation improved saline alkaline tolerance via the regulation of the alkali stress-related genes GmKIN1, GmRD22, GmDnaJA6, GmNFYC1, and GmMYB14. These findings provide support for further research on alkali-tolerance regulation pathways and molecular breeding for alkali tolerance.

1. Introduction

Saline–alkali soils restrict agricultural development and crop cultivation [1]. About 7% of available soil is lost due to salt–alkali stress across crops in China and 10% in the world. Saline–alkali soils induce salt stress mainly due to excess NaCl, and more harmful alkaline stress is due to Na+, the combination of metal ions with HCO3 or CO32−, and overly high pH. These stressors lead to abnormal seed germination, plant growth obstruction, and the reduction of crop yields [1]. Soybean is an important oil and plant protein crop. Wild soybean (Glycine soja) is closely related to cultivated soybean but is strongly resistant to various forms of stress. It also has a higher protein content and stronger reproduction ability than cultivated soybean [2]. Wild soybean has abundant alkali-resistant gene resources that cultivated soybean lacks, suggesting that important resistance genes have been lost during the plant’s evolution. Given the beneficial properties of wild soybean, the reintroduction of its genes into the cultivar would be an efficient and reliable means of improving its alkaline tolerance, expanding its planting area to include saline–alkali soils, as well as promoting other characteristics for overall soybean variety improvement.
Although the application of transgenic methods is controversial, the identification of the genetic mechanisms of alkali resistance in wild soybean is valuable. Wild soybean roots rely on a series of special transcription factor genes and genes related to the reduction of oxidation to respond to alkali stress. GsCML27 and PP2C family D genes have different functions in regulating responses to bicarbonate, salt, and osmotic stress [3]. The ethylene response transcription factors GsERF6 and GsERF71 may mediate the regulation of bicarbonate stress, and Gshdz4 and GsNAC019 genes may regulate responses to normal alkaline stress [1,4]. The anion channel protein GsSLAH3 and an exocyclic boron transporter are involved in the alkali stress pathway [5]. However, the alkali resistance of expansin proteins has not been reported.
Expansin proteins disrupt non-covalent bonds between cellulose microfibrils and associated matrix polysaccharides in plant cells, leading to cell wall loosening and elongation [6]. Encoded by a multigenic superfamily, expansins are classified into four subfamilies based on sequence-based phylogeny: α-expansin (EXPA), β-expansin (EXPB), expansin-like A (EXLA), and expansin-like B (EXLB) [7]. In the EXPA family, the DPBB_EXPA and expansin domains are similar. Most expansins have positive regulatory effects. The changes in cell wall morphology that they mediate are crucial for plant growth and development, including root growth, internode elongation, and leaf growth, and the response to abiotic stress.
The expression of various expansin genes plays a crucial role in enhancing the tolerance of diverse plant species to environmental stresses such as drought, salt, and heavy metal toxicity. Drought and P deficiency have been found to induce the expression of the OsEXPB2 gene in rice [8]. ZmExpB2, ZmExpB6, and ZmExpB8 upregulation has been observed under salt stress in salt-resistant maize varieties [9]. The overexpression of wheat TaEXPB23 was found to improve the drought resistance of transgenic tobacco [10,11], and TaEXPB7-B is known to be involved in the low-temperature stress tolerance of transgenic Arabidopsis [12]. In contrast, the overexpression of AtEXP3 and AtEXP-β1 increases the susceptibility of transgenic Arabidopsis to salt stress [13]. OfEXLA1 improves the salt and drought tolerance of Osmanthus fragrans via the response to abscisic acid (ABA) [14]. The PtoEXPA12 gene affects the absorption and accumulation of Cd in Populus tomentosa and alters the plant’s tolerance of Cd toxicity [15].
GsEXPA8 belongs to the EXPA family with conserved domains. In Arabidopsis, the transcript levels of AtEXPA8 were analyzed by qRT–PCR in root samples of 10-day-old Arabidopsis seedlings treated with 100 μM H2O2 for 24 h, showing that ROS (H2O2) reduced the expression of AtEXPA8. In Triticum aestivum, the expression patterns of TaEXPA8 genes in different tissues and in response to several abiotic stresses and hormones were analyzed. In rice, OsEXPA8 expression affects the root system architecture in transgenic rice plants. ABA can negatively regulate the expressions of SmEXPA8 genes in Salvia miltiorrhiza. Therefore, the conserved domains play different roles in diverse species. In our study, we determined the potential of the alkaline tolerance of the domains.
Seventy-five expansins have been identified in soybean, and most studies of them have focused on their involvement in plant root development [16]. Although expansin proteins in all subfamilies have been studied, most research has concentrated on the EXPA and EXPB gene families. GmEXP1, the first-verified EXPB gene in soybean, was shown to accelerate root growth and cell enlargement when ectopically expressed in transgenic Nicotiana benthamiana seedlings [17]. Subsequently, GmEXPB2, a root-specific EXPB gene induced by low-P stress, was found to enhance P-utilization efficiency by regulating adaptive changes in the soybean root architecture [18]. GsEXPB1 was found to promote wild soybean root growth and improve salt tolerance [19]. In wild soybean, expansin proteins are located mainly in cell membranes and walls. In wild barley, HvEXPB7 was found to enhance drought resistance by promoting root hair elongation [20].
Root morphology is important in plant responses to stress. Plants can adapt to and cope with various environmental changes and pressures by adjusting their root structure and configuration, regulating the internal ion balance, and accumulating osmotic regulatory substances to maintain normal growth [21]. The adaptive alteration of root morphology is a key strategy for plant growth efficiency, survival, and reproduction in nature. Expansins’ regulation of cell walls is important for the root morphology’s stress responses and resilience [22], with direct effects on overall plant growth and productivity through the health and function of the root system. For example, expansins help to relax cell walls at low temperatures, allowing roots to better absorb water and nutrients and thereby helping plants to withstand growth stress [12,23]. The GmEXP1 gene is expressed mainly in the primary and secondary root tips of soybean, and its overexpression promotes the growth of transgenic tobacco roots under acidic conditions [24]. The overexpression of GmEXLB1 changed the root configuration of Arabidopsis thaliana, increasing the number and length of lateral roots and thereby improving its P-utilization efficiency [25]. In this study, EXPA genes in wild soybean were mined, the structural characteristics of gene families were analyzed, the responses of EXPA genes to alkali stress and hormones were studied, and gene functions were determined via the examination of phenotypic and physiological indexes after the stable and instantaneous transformation of the GsEXPA8 gene in soybean. These results provide a theoretical reference for the improvement of soybean alkaline tolerance.

2. Materials and Methods

2.1. Plant Materials and Growing Conditions

Wild soybean, soybean (DN50), and WT Colombian Arabidopsis were planted in the Experimental Practice and Demonstration Center of Northeast Agricultural University, Harbin, China. Arabidopsis was grown at a temperature of 22–23 °C and a 16/8-h light/dark cycle in a culture room.
The wild soybean seeds were cleaned with distilled water, soaked in concentrated sulfuric acid, and washed with shaking twice for 5 min each. They were then soaked in distilled water and washed with shaking five times, followed by incubation at 28 °C in the dark for 48 h. After that, they were cultured in 1/4 of the Hoagland medium (pH 5.8) for 21 days. Fifteen wild soybean plants were set as a group. There were 4 groups of wild soybean seedlings treated with 50 mM NaHCO3 for 0, 3, 6, and 12 h, respectively. The root tips from five plants in each group were mixed as one sample, and twelve samples were obtained in total. There were 8 groups of wild soybean seedlings transferred to 1/4 of the Hoagland culture medium, either with or without plant hormone. The root tips were collected at 0 h and 12 h after hormones, including 15 mM abscisic acid (ABA), 5 μM indole-3-acetic acid (IAA), 0.5 μM gibberellic acid (GA), or 10 μM jasmonic acid (JA) treatment. The root tips from five plants in each group were mixed as one sample, and twenty-four samples were obtained. These samples were used to analyze the expression characteristic of expansin genes. WT and transgenic soybean were cultivated under controlled conditions at a temperature of 26–30 °C and a 16/8-h light/dark cycle, using a 1:1 mixture of original soil and vermiculite. After the seedling roots were exposed to 50 mM NaHCO3 and sampled at 0, 3, 6, and 12 h after treatment, they were used to determine the relative expression of the related genes. All the plant roots were put in 10 mL EP tubs, respectively, and stored in a refrigerator at −80 °C after being frozen quickly by liquid nitrogen [26].

2.2. Treatments and Determination of Relative Expression

GsEXPA8 transgenic plants were obtained by the Agrobacterium-mediated transformation method. The WT and transgenic lines were treated with 50 mM NaHCO3 for 15 days. Total RNA was extracted from the root tips using a TransZol Up kit (ET111-01-V2; TransGen Biotech, Beijing, China). Using this total RNA as a template, cDNA was obtained by reverse transcription using a SPARKscript RT Plus kit (with a gDNA eraser; AG0304-B; Sparkjade, Jinan, China). qPCR analysis was performed with 2 × SYBR Green qPCR Mix kits (AH0104-B, SparkJade, Jinan, China). With GmACTIN4 serving as the internal reference gene, the relative expression levels of GsEXPA1, GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA10, GsEXPA11, GsEXPA12, GsEXPA15, GsEXPA20, and GsEXPA23 were detected (the primers used are listed in Table 1). The expression levels of the marker genes (GsRD22, GsDna JA6, GsMYB14, GsNFYC1, and GsKIN1) were determined using the same method, with GmACTIN4 serving as a reference gene. The primers used are listed in Table 2. The relative expression of the target genes was calculated using the 2−ΔΔCT method [27].

2.3. Evolutionary Tree Construction and Domain Analysis

Using the NCBI’s database (https://www.ncbi.nlm.nih.gov/) (accessed: 30 October 2024) and BLAST tool, the GsEXPA8 protein sequence was aligned, and the protein sequence in the FASTA format was used, along with multiple sequence files for sequence alignment and evolutionary tree construction. A phylogenetic tree was generated using the neighbor-joining method with MEGA 11 software, and the EXPA8 protein was sequentially compared with those in Arachis ipaensis, Arachis duranensis, Arabidopsis thaliana, Cannabis sativa, Euphorbia peplus, Hevea brasiliensis, Hibiscus trionum, Manihot esculenta, Mucuna pruriens, Medicago truncatula, Pistacia vera, Jatropha curcas, Glycine max, Glycine soja, Stylosanthes scabra, Stylosanthes guianensis, and Trifolium repens, using GENEDOC 2.7 software [7,28].

2.4. Subcellular Localization

Protoplasts were prepared from the leaves of Arabidopsis thaliana seedlings and then transfected with the pEGOEP35S::GsEXPA8 subcellular localization vector or pEGOEP35S::GFP empty vector with PEG4000. They were observed and photographed under a confocal laser microscope. K599 Agrobacterium was obtained by transferring these recombinant plasmids into Agrobacterium GV3101. Following its propagation, the bacterial sediments were collected and suspended in 10 mmol/L MgCl2 aqueous solution. Acetosyringone (AS, 200 μmol/L) was added, and the infection solution was left at room temperature for 3 h. Four-week-old tobacco seedlings were transferred to a dark culture for 1 day, and then two leaves on each plant were injected with the infective liquid and observed under a confocal laser microscope after 2 days [29,30].

2.5. Stable and Transient GsEXPA8 Overexpression in Soybean

Soybean seeds were cultured until germination. Portions of the hypocotyls were cut off. The seed coats were peeled, and the two cotyledons were separated and clipped with the nodes. Two true leaves were removed, and a knife tip was used to cut to growing points to create explants. The recombinant plasmid pEGOEP35S::GsEXPA8-GFP was introduced into Agrobacterium GV3101. The bacterial precipitation was collected and suspended in 10 mmol/L MgCl2 aqueous solution. Then, 200 μmol/L AS was added, and the infective solution (OD600 = 0.5) was left at room temperature for 3 h. Through co-culture and recovery, screening, elongation, and rooting cultures, T0 generation-regenerated plants were obtained. The leaves were tested with phosphinothricin acetyltransferase (PAT)/bialaphos resistance (Bar) transgenic test strips (AG-002-GSLF; Ajin Biotechnology Co., Ltd., Tianjin, China). The positive plants were retained as T0 generation transgenic plants. The T2 generation plants were used in the experiments.
The plants were watered every 3 days with water or 50 mM NaHCO3. The soybean seedlings were cultivated in an artificial climate chamber under 16 h light at 28 °C with 80% soil moisture. When the cotyledons were fully developed and the seedlings were about 5 cm tall, they were impregnated with transformed pEGOEP35S::GFP and pEGOEP35S::GsEXPA8-GFP in K599 Agrobacterium (OD600 = 0.6–1.0) at the hypocotyls using a sterile syringe. When hairy roots appeared at the injection sites, these sites and roots were covered with vermiculite and allowed to absorb moisture. When the hairy roots were 4–8 cm long, the initial roots were cut off, and the roots left were buried in the soil mixture to keep moist. After about 15 days of growth, healthy transgenic chimeric soybeans and control plants with similar size and hairy root numbers were selected for stress treatment [31,32]. There were two groups of transgenic plants, and they were named OE1 and OE2.

2.6. Determination of Root Physiological Indexes

The WT and transgenic plants were treated with 50 mM NaHCO3, and the phenotype changed significantly after 15 days. The physiological indexes of roots under normal conditions and alkali stress were determined. The roots of WT, OE1, OE2, and OE5 plants were sampled. Every five plant roots from each line were gathered as one group, and samples were collected from three groups. The physiological indexes of the hairy roots were determined with a peroxidase (POD) kit (No. M0105; Suzhou Mengxi Biological Medicine Technology Co., Ltd., Suzhou, China) and a malondialdehyde (MDA) kit (No. G0109W; Suzhou Gris Biotechnology Co., Ltd., Suzhou, China) according to the kits’ instructions.

2.7. Analysis of Root Morphology and Gene Tissue Localization in Hairy Roots of WT and GsEXPA8-Overexpressing Plants

Transient GsEXPA8-overexpressing plants (OE1 and OE2) and WT plants were grown normally. The hairy roots of GsEXPA8-overexpressing plants showed green fluorescence under a laser confocal electron microscope as GsEXPA8 fused with the GFP protein, so it was easy to obtain positive transgenic plants. The roots were also stained with propidium iodide (PI) to show the cell walls. The roots of the WT and overexpressed plants were cleaned thoroughly and scanned using a root scanner (LA-S; Wanshen, Hangzhou, China) according to the manufacturer’s instructions. Key morphological indexes, such as the root diameter and length; numbers of connections, root segments, root tips, forks, and crossings; root volume; and average diameter were measured. In addition, the total weights and root weights were obtained as described previously [33].

2.8. Western Blotting

Leaves were collected from the transgenic GsEXPA8-overexpressing strains and WT plants. The total protein samples were extracted, and sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis gels were prepared and fixed in an electrophoresis tank. A sufficient amount of 1× SDS electrophoresis buffer was poured into the tank, and the protein samples were added for electrophoretic separation. When the proteins were transferred to the adhesive concentrate, the voltage was changed from 80 V to 120 V, and electrophoresis was stopped when the proteins reached the bottom of the concentrate. The gels were assembled using a protein transfer device, and the proteins were transferred to polyvinylidene difluoride (PVDF) membranes via 45 min of 200 mA electrophoresis. The membranes were incubated with 5% skim milk powder for 2 h at room temperature and then with the primary antibody at 4 °C overnight. On the second day, after 1 h incubation with the primary antibody, the samples were washed three times with 1× Tris-buffered saline with Tween 20 (TBST), and 5% skim milk powder containing the secondary antibody was added. The samples were incubated at room temperature for 1 h and washed three times with 1× TBST. The target protein was detected using a gel imaging system [34].

2.9. Immunochromatographic Detection

Five leaves (about 0.3 g) from five individual plants were pooled together to form a group. Five groups of transgenic plants and one group of wild-type plants were selected for the experiment. The plant leaf tissue was placed in a disposable extraction tube. The tissue was gently crushed with a pestle for 20–30 s to break down cell structures and release the contents of the cells. Then, 1–2 mL of extraction buffer was added, and the tissue was homogenized with the pestle for another 20–30 s to ensure that the extraction buffer was fully mixed with the tissue. Next, 50–100 µL of the extract was dropped onto the PAT/Bar transgenic test strip. The results were evaluated according to the recommended incubation time in the kit instructions. If a clear color change was observed at the test strip position compared to the control group, it indicated the presence of transgenic material in the sample; if no color change was observed, it was a negative result. The samples were tested using PAT/Bar transgenic test strips (AG-002-GSLF; Ajin Biotechnology Co., Ltd., Tianjin, China). [35].

2.10. 3,3-Diaminobenzidine Staining

3,3-Diaminobenzidine staining solution was prepared and placed in conical bottles, and soybean leaf samples from WT and GsEXPA8 transient overexpression plants (OE1 and OE2) under 0 and 100 mM NaHCO3 treatment were added. The samples were vacuumed for 10 min using a vacuum pump, removed from the pump, and stained at 28 °C away from light for 12–16 h. The staining status was checked about every 6 h. When staining was complete, the solution was discarded, and the samples were boiled in ethanol decolorizing solution for 5 min, until the chlorophyll had been completely removed. After cooling, the samples were transferred to anhydrous ethanol and washed in a horizontal shaker for 30 min. They were then observed and recorded by a digital camera.

2.11. Statistical Analysis

Means and standard deviations of all study variables were calculated and compared between samples using the Student’s t-test. For multiple comparisons, two-factor analysis of variance and post hoc Tukey testing were performed using GraphPad PRISM 9.0.2 software. The significance level was set to α = 0.05.

3. Results

3.1. GsEXPA8 Expression Was Significantly Upregulated Under Alkali Stress and ABA Treatment

Under 50 mM NaHCO3 treatment, most expansin family genes in the wild soybean were upregulated at 3 and 12 h, and the expression of GsEXPA8 was significantly upregulated after 12 h of treatment compared with that of other genes in the same family. The result was in consonance with the prediction data in Supplementary Figure S1. Therefore, GsEXPA8 positively regulates the alkaline stress pathway at later stages of stress treatment (Figure 1A). In addition GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA12, and GsEXPA23 responded to 15 mM ABA and 5 μM IAA treatment. GsEXPA8 was significantly upregulated under ABA treatment, and its expression level was higher than that under IAA treatment (Figure 1B), suggesting that it may regulate root development through the ABA and IAA pathways. Meanwhile, GsEXPA8 may contribute to both NaHCO3 stress and the ABA pathway.
The BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 30 October 2024) in the NCBI database was used to identify EXPA8 protein sequences in Euphorbia peplus, Hibiscus trionum, Jatropha curcas, Manihot esculenta, Hevea brasiliensis, Cannabis sativa, Arachis ipaensis, Arachis duranensis, Stylosanthes guianensis, Stylosanthes scabra, Pistacia vera, and Trifolium repens. The phylogenetic tree was constructed using the neighbor-joining method (NJ). EXPA8 in Medicago truncatula, Glycine max, and Glycine soja had high degrees of similarity. Obviously, GmEXPA8 and GsEXPA8 had high homology. AtEXPA14, AtEXPA15, AtEXPA10, and AtEXPA1 were found to be located on the same branch. AtEXPA17, AtEXPA20, AtEXPA13, AtEXPA24, AtEXPA21, AtEXPA22, AtEXPA25, and AtEXPA23 had high degrees of similarity. The AtEXPA4, AtEXPA16, AtEXPA6, GmEXPA4, GmEXPA1, GmEXPA5a, GmEXPA5b, and GmEXPA5c sequences were closed. AtEXPA8 showed a low degree of homology with these genes. These results indicate that the EXPA8 sequences of wild soybean and cultivated soybean are close to each other but different from those of Arabidopsis thaliana (Figure 2A). In Figure 2B, sequence alignment and comparison were performed in Glycine soja, Glycine max, Stylosanthes guianensis, Arachis duranensis, Arachis ipaensis, Mucuna pruriens, Medicago truncatula, Trifolium repens, Pistacia vera, and Arabidopsis thaliana. The results show that these EXPA8 proteins have two conserved domains, the DPBB_EXPA and expansin domains, implying that GsEXPA8 may participate in root development and the abiotic stress pathway as it functions in other species in previous research.

3.2. When the Cell Wall Was Present, GsEXPA8 Relocated from the Cytoplasm to the Membrane and Cell Wall

In protoplasts, the empty carrier pEGOEP35S::GFP was expressed in the nucleus and cytoplasm, and pEGOEP35S::GsEXPA8-GFP was dispersed in the non-nuclear and non-membrane regions, indicating that GsEXPA8 was expressed in the cytoplasm in the absence of a cell wall. In tobacco, pEGOEP35S::GFP was expressed in the nucleus, cell wall, and cytoplasm, and pEGOEP35S::GsEXPA8-GFP was expressed in the cell membrane or nucleus, suggesting that GsEXPA8 transferred from the cytoplasm to the membrane or cell wall in the presence of a cell wall. These results suggest that GsEXPA8 may regulate plant cell growth through the expansion of the cell membrane or wall (Figure 3).

3.3. GsEXPA8 Overexpression Increased Soybean Alkali Stress Tolerance

The GsEXPA8 protein and green fluorescent protein (GFP) were co-expressed in the expression vector transformed into wild soybean by cotyledon node infection under alkali treatment. GFP labels were negative in the WT and positive in the OE (overexpression)-1, OE-2, and OE-5 strains (Figure 4A). The WT plants exhibited only protein detection bands, with no basta-positive band. The transgenic soybean plants showed positive lines (Figure 4B). Thus, OE-1, OE-2, and OE-5 were selected as experimental lines.
The WT and OE plants grew well and had dark green leaves under no treatment (Figure 4C). After 5 days of NaHCO3 treatment, the WT leaves showed wilting, yellowing, curling, and shrinking, whereas only some OE leaves showed yellowing, and the plants were growing normally. After 15 days of treatment, the WT plants had wilted completely, with thin stems and curled, dry, and wrinkled leaves, and were not growing normally. Some leaves of the OE strains remained green, and most leaves remained capable of photosynthesis. The MDA content of the OE plant roots did not differ significantly from that of the WT plant roots before treatment but was significantly less than that of the WT after treatment (Figure 4D), reflecting the preservation of membrane permeability in the OE roots and severe damage in the WT roots. POD activity in the OE plants was significantly greater than that in the WT before treatment, whereas little difference was observed after treatment (Figure 4E). This result suggests that GsEXPA8 improves POD activity in soybean plants under normal conditions and helps to maintain cell membrane permeability under alkaline treatment.
The leaf transpiration rate (Tr) was similar in the OE and control plants before treatment but lower in the OE plants than the control plants after treatment (Figure 4F). The OE plants showed more net photosynthesis (Pn) than the control under untreated and alkaline treatment conditions (Figure 4G). After alkali treatment, the OE plants showed significantly less stomatal conductance (Gs) and significantly more water usage effectiveness (WUE) than the control (Figure 4H,I). These results indicate that GsEXPA8 overexpression directly improved the plants’ photosynthetic capacity and WUE via Tr and Gs reduction under alkali stress, improving alkaline tolerance.

3.4. Transient GsEXPA8 Overexpression Promoted Root Morphology Alteration

In WT plants into which the pEGOEP35S-GFP empty vector had been transformed via Agrobacterium rhizogenes, GFP signals were detected in the cell wall, membrane, and cytoplasm. After the transformation of pEGOEP35S-EXPA8-GFP, GsEXPA8 was expressed mainly in the two outermost cell layers near the root tip (Figure 5A), reflecting its regulation of outer root cell development (Figure 5A). PI staining shows the location of the cell wall, and it can localize the cell edge. We predicted that GsEXPA8 may work as a loose protein to promote root growth.
In plants treated with the empty bacterium K599 or strain K599 containing the pEGOEP35S::GsEXPA8-GFP vector, as well as hair root transformation, the OE root systems were more robust and developed than the WT root systems (Figure 5B). Under alkali treatment, the leaves of the OE plants were lighter in color in the staining experiment than those of the WT plants, reflecting less damage and ROS accumulation (Figure 5C). The stem lengths did not differ between the WT and OE plants, whereas the OE plant roots were shorter than the WT roots (Figure 5D). Compared with the WT, the OE plants had significantly fewer connections, nodes, tips, and crossings; the number of forks did not differ (Figure 5E). The mean root diameter and volume were significantly greater in the OE plants than in the WT, whereas the total and root weights did not differ (Figure 5F–H). These results indicate that GsEXPA8 overexpression promoted the development of coarser, shorter, and larger roots, thereby improving plant alkaline tolerance.

3.5. GsEXPA8 Overexpression Increased Alkali-Tolerant Gene Expression

The WT and OE plants were treated with 50 mM NaHCO3, and the relative expression levels of key alkali stress genes, including GmKIN1, GmRD22, GmDnaJA6, GmNFYC1, and GmMYB14, were measured at 0, 3, 6, and 12 h. Relative to the WT, the OE plants had significantly higher relative expression levels of the following: GmKIN1 and GmNFYC1, which were responsible for sustained responses to alkali stress at 3, 6, and 12 h after NaHCO3 treatment; GmRD22 and GmDnaJA6, the downstream functional genes, at 6 and 12 h; and GmMYB14, which is a transcription factor gene that responds to alkali stress, at 0, 3, and 6 h. These results suggest that GsEXPA8 transfer improves plant alkaline tolerance via the regulation of related genes under alkali stress (Figure 6).

4. Discussion

4.1. Roles of GsEXPA8 Under Sodium Bicarbonate Stress

Wild soybean is tolerant of abiotic stresses, including salt, drought, low temperature, and alkaline stresses. Many alkaline resistance-related genes, such as Gshdz4 [1], GsNAC019 [4], and GsERF7 [36], have been reported. Cultivated soybean tolerance could be enhanced by overexpressing key functional genes from wild soybean, which is an effective way for molecular breeding. So, we tried to mine the response of EXPA to alkaline stress, which has not been reported, and GsEXPA8 was found. We also checked the previous study, and we found that it responds to alkali stress under 50 mM NaHCO3 at 12 h and 24 h after treatment (Supplementary Figure S1) (data: https://link.springer.com/article/10.1186/1471-2229-10-153, accessed on 30 October 2024, Electronic Supplementary Material). What is interesting is that it was also induced by low nitrogen treatment (Supplementary Figure S2) [37]. So, we predicted that GsEXPA8 participates in nutrition absorption or root development. Some genes’ functions were analyzed in Arabidopsis [1,4,34] or the hair roots of soybean [2], which could not recover the real influence of the new gene. In this study, we used both stable and transient methods to investigate the role of GsEXPA8 in soybean. Therefore, GsEXPA8’s function was shown accurately. Finally, we proved that the crossover of the alkali-tolerance and hormone pathways was reflected by upregulated GsEXPA8 expression in wild soybean after 12 h alkali stress and ABA treatment, and overexpressing GsEXPA8 could enhance the alkaline resistance of soybean. These results indicate that GsEXPA8 is mainly involved in ABA-mediated alkaline stress resistance in wild soybean. Similarly, GsEXPA9, GsEXPA12, and GsEXPA23 are involved in the ABA and IAA regulatory pathways but are not sensitive to GA or JA signals [19]. Furthermore, the reason why GsEXPA8 could control resistance was preliminarily due to special protein localization. The potential of GsEXPB1 has been shown to localize to plant cell walls [19]. SmEXLA1 and SmEXLB1 are localized in the nucleus and cell membrane, and SmEXPA2 is localized in the cell wall [2]. Thus, the localization of the EXPA protein varies. In this study, GsEXPA8-GFP was located in the cytoplasm in the absence of a cell wall and the membrane or wall in the presence of a wall. Sucrose was used to break the cell wall rapidly, preventing plasmolysis. We did not obtain a completed cell. These findings suggest that GsEXPA8 functions between the cell membrane and wall, inducing expansion and the completion of elongation or enlargement.

4.2. Relationship of GsEXPA8 to Root Development and Increased Alkali Stress

Roots are directly damaged by saline–alkali soil. The morphology of the plant root system is greatly important and differs when they cope with different stresses [38,39]. Changes in root morphology, like root length, root diameter, and physiological indexes, are the most direct strategies for soil nutrient utilization under stresses. For example, root morphology and rhizosphere characteristics were related to the salt tolerance of Suaeda salsa and Beta vulgaris. Expansin proteins are involved in root development. GmEXLB1::GUS signals were detected in different developmental stages of lateral root formation transgenic Arabidopsis roots [25]. GsEXLB14 enhances the salt and drought tolerance of transgenic soybean hairy roots [2]. In this study, transgenic plants with stable GsEXPA8 expression showed greater resistance to alkali stress than WT plants after 15 days of treatment. The roots in these plants showed more POD activity in their roots before treatment, a slight reduction in MDA content after treatment, and enhanced leaf photosynthetic ability. These findings suggest a change in the amount of plant growth, but their stable expression did not reflect root changes. We especially used a transient method to observe the root morphology. Significant changes in root morphology were detected following alkaline treatments. GsEXPA8 overexpression induced the growth of thicker, shorter roots, thereby enhancing root function via the improvement of nutrient absorption and promoting plant growth under alkali stress. However, long-term detection strategies are required to examine the effect when plants are grown in fields.

4.3. The Regulatory Pathway of GsEXPA8 Gene Expression Involves Interactions with Marker Genes

GmKIN1 and GmRD29B are mainly induced by ABA, cold, and drought [1]. GmRD22 encodes a BURP domain protein from soybean and enhances its tolerance of abiotic stresses [40]. Plant DnaJA proteins act as molecular chaperones in response to environmental stressors [40]. GmDnaJA6 has been identified as a candidate regulator of saline and alkaline stress resistance, and soybean overexpressing has shown increased saline and alkaline tolerance [41]. GmNFYC1 expression is induced by drought, salt, and ABA treatment [42]. Stable GmMYB14-OE (GmMYB14-OE) transgenic soybean plants displayed semi-dwarfism, with a compact plant architecture (reduced height, internode length, leaf area, and leaf petiole length and angle) associated with decreased cell size and had improved yields under high-density field conditions [43]. The ability of GsEXPA8 to upregulate GmKIN1, GmRD22, GmDnaJA6, GmNFYC1, and GmMYB14 suggests that it is an important regulator of bicarbonate resistance and that it participates in the coordination of plant defense gene expression. After the promoter sequence analysis of GsEXPA8, we found that it contains the NAC transcription factor binding motif [4]. GsEXPA8 may be located in the regulation network of GmMYB14 and GsNAC019. However, the mechanism by which GsEXPA8 regulates alkaline stress via the ABA signal pathway is unknown. The reason for the localization of GsEXPA8 to the cell wall and the role of GsEXPA8 in cell expansion and root thickening need to be investigated further.

4.4. GsEXPA8 May Work in an Eco-Physiological System

Alkali stress can trigger physiological drought stress and oxidative stress and produce a large number of reactive oxygen species (ROS) [44]. Hydrogen peroxide, superoxide anion, and nitric oxide can not only lead to plasma membrane damage and DNA cleavage in functional cells but also serve as signals for downstream gene expression, leading to programmed cell death [44]. This damage occurs in both root and leaf tissues (Figure 4D,E and Figure 5C). Photosynthesis, one of the most crucial biological processes for plants, is greatly affected by abiotic stress [45]. A gradual decrease in CO2 assimilation rates, reduced leaf size, stem extension, and root proliferation under physiological drought stress, reduces water-use efficiency, disrupts photosynthetic pigments, and reduces gas exchange, adversely affecting the plants (Figure 5C). However, in this study, the overexpression of GsEXPA8 may enhance root nutrient absorption and improve ROS scavenging activity, avoiding the excess production of reactive oxygen species (ROS) in leaves [46,47,48]. Consequently, the transgenic plants exhibit stronger photosynthetic capacity under stress [38].
In the current study, Bisphenol A (BPA) acts as a detrimental substance that disrupts the endocrine system in animals and impedes the growth and development of plants [49]. BPA enhances ROS levels, and ROS increases the IAA content but reduces cell division activity [49]. ROS scavenger treatment reverses BPA-triggered root growth retardation, auxin accumulation, and cell division inhibition. Plants will react to the environment by regulating key gene expression levels, leading to ecological environment changes. Knocking out GmTAP1 could create novel germplasm with increased resistance to soybean root rot [50]. We did not use CRISPR to reduce expression due to genetic redundancy, and we aimed to obtain the function of wild soybean genes, not the domesticated soybean genes. We also detected changes in microbial composition around the roots of wild-type (WT) and transgenic lines, which were different, and we will explain this in the future. In summary, GsEXPA8 improves ROS scavenging ability and affects the eco-physiological system of plants.

5. Conclusions

Saline and alkaline soils restrict soybean planting. The expression of GsEXPA8 in transgenic soybean plants was significantly upregulated under alkali stress and ABA treatment in this study. In the presence of a cell wall, GsEXPA8 relocated from the cytoplasm to the membrane and cell wall. The overexpression of GsEXPA8 increased the expression of alkali-tolerant genes and thus alkali stress tolerance. Its transient overexpression promoted the development of coarser, shorter roots with altered morphology. These findings provide support for the molecular breeding of saline–alkali-tolerant soybean. Sodium bicarbonate (NaHCO3) stress conditions cannot fully mimic natural saline–alkali soil environments where other factors like nutrient deficiencies, fluctuating pH levels, and microbial interactions also play significant roles. The focus on immediate and short-term responses to alkali stress (up to 12 h for expression profiling and 15 days for root phenotype analysis) may overlook longer-term physiological and adaptive changes. Transient expression analysis adds insights but lacks long-term stability data. In the future, specific pathways regulated by GsEXPA8 will be studied, and the phenotype experiments will be performed in the field with T3 generation.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy15010016/s1, Figure S1: Fold change of GsEXPA8 under alkali stress in transcriptome sequencing data online. GsEXPA8 was induced by 50 mM NaHCO3 at 12 h and 24 h; Figure S2: FPKM of GsEXPA8 under CK and low nitrogen treatment in transcriptome sequencing data online. GsEXPA8 was induced by low nitrogen treatment.

Author Contributions

L.C. and J.Z. designed this project; M.L., J.T., S.M., Y.L., X.W. and X.D. (Xinlei Du) carried out assays and performed data analyses; X.S., Y.Z. (Yucheng Zeng), Y.Z. (Yulong Zeng), X.D. (Xiaodong Ding), Y.H., J.Z. and L.C. supported this project; J.Z. and L.C. prepared the manuscript and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The National Natural Science Foundation of China (32001505) to L.C.; The Natural Science Foundation of Heilongjiang Province (LH2021C058) to J.Z.; The National Natural Science Foundation of China (32272048) to X.D.; the National Natural Science Foundation of China (U22A20473) to Y.H.; the Harbin University Young PhD. Research Foundation Project (HUDF2019104) to J.Z.; and the Heilongjiang Academy of Agricultural Sciences (2021YYYF006) to X.S.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its Supplementary Information files.

Conflicts of Interest

Author Yucheng Zeng and Yulong Zeng were employed by the company Hangzhou Fusheng Agricultural Technology Development Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Cao, L.; Yu, Y.; Mu, H.; Chen, C.; Duan, X.; Zhu, P.; Chen, R.; Li, Q.; Zhu, Y.; Ding, X. A novel Glycine soja homeodomain-leucine zipper (HD-Zip) I gene, Gshdz4, positively regulates bicarbonate tolerance and responds to osmotic stress in Arabidopsis. BMC Plant Biol. 2016, 16, 184. [Google Scholar] [CrossRef] [PubMed]
  2. Wang, L.; Zhang, T.; Li, C.; Zhou, C.; Liu, B.; Wu, Y.; He, F.; Xu, Y.; Li, F.; Feng, X. Overexpression of Wild Soybean Expansin Gene GsEXLB14 Enhanced the Tolerance of Transgenic Soybean Hairy Roots to Salt and Drought Stresses. Plants 2024, 13, 1656. [Google Scholar] [CrossRef] [PubMed]
  3. Chen, C.; Yu, Y.; Ding, X.; Liu, B.; Duanmu, H.; Zhu, D.; Sun, X.; Cao, L.; Zaib Un, N.; Li, Q.; et al. Genome-wide analysis and expression profiling of PP2C clade D under saline and alkali stresses in wild soybean and Arabidopsis. Protoplasma 2018, 255, 643–654. [Google Scholar] [CrossRef] [PubMed]
  4. Cao, L.; Yu, Y.; Ding, X.; Zhu, D.; Yang, F.; Liu, B.; Sun, X.; Duan, X.; Yin, K.; Zhu, Y. The Glycine soja NAC transcription factor GsNAC019 mediates the regulation of plant alkaline tolerance and ABA sensitivity. Plant Mol. Biol. 2017, 95, 253–268. [Google Scholar] [CrossRef]
  5. Duan, X.; Yu, Y.; Duanmu, H.; Chen, C.; Sun, X.; Cao, L.; Li, Q.; Ding, X.; Liu, B.; Zhu, Y. GsSLAH3, a Glycine soja slow type anion channel homolog, positively modulates plant bicarbonate stress tolerance. Physiol. Plant 2018, 164, 145–162. [Google Scholar] [CrossRef]
  6. McQueen-Mason, S.; Cosgrove, D.J. Disruption of hydrogen bonding between plant cell wall polymers by proteins that induce wall extension. Proc. Natl. Acad. Sci. USA 1994, 91, 6574–6578. [Google Scholar] [CrossRef]
  7. Kende, H.; Bradford, K.; Brummell, D.; Cho, H.T.; Cosgrove, D.; Fleming, A.; Gehring, C.; Lee, Y.; McQueen-Mason, S.; Rose, J.; et al. Nomenclature for members of the expansin superfamily of genes and proteins. Plant Mol. Biol. 2004, 55, 311–314. [Google Scholar] [CrossRef]
  8. Zou, H.; Wenwen, Y.; Zang, G.; Kang, Z.; Zhang, Z.; Huang, J.; Wang, G. OsEXPB2, a β-expansin gene, is involved in rice root system architecture. Mol. Breed. 2015, 35, 41. [Google Scholar] [CrossRef]
  9. Kaleem, F.; Shahzad, M.; Shabir, G.; Aslam, K.; Shah, S.M.; Khan, A.R. Salt Stress Induces Genotype-specific DNA Hypomethylation in ZmEXPB2 and ZmXET1 Genes in Maize. Cereal Res. Commun. 2019, 47, 216–227. [Google Scholar] [CrossRef]
  10. Li, F.; Xing, S.; Guo, Q.; Zhao, M.; Zhang, J.; Gao, Q.; Wang, G.; Wang, W. Drought tolerance through over-expression of the expansin gene TaEXPB23 in transgenic tobacco. J. Plant Physiol. 2011, 168, 960–966. [Google Scholar] [CrossRef]
  11. Li, A.; Han, Y.; Wang, X.; Chen, Y.; Zhao, M.; Zhou, S.-M.; Wang, W. Root-specific expression of wheat expansin gene TaEXPB23 enhances root growth and water stress tolerance in tobacco. Environ. Exp. Bot. 2015, 110, 73–84. [Google Scholar] [CrossRef]
  12. Feng, X.; Xu, Y.; Peng, L.; Yu, X.; Zhao, Q.; Feng, S.; Zhao, Z.; Li, F.; Hu, B. TaEXPB7-B, a β-expansin gene involved in low-temperature stress and abscisic acid responses, promotes growth and cold resistance in Arabidopsis thaliana. J. Plant Physiol. 2019, 240, 153004. [Google Scholar] [CrossRef] [PubMed]
  13. Kwon, Y.R.; Lee, H.J.; Kim, K.H.; Hong, S.W.; Lee, S.J.; Lee, H. Ectopic expression of Expansin3 or Expansinbeta1 causes enhanced hormone and salt stress sensitivity in Arabidopsis. Biotechnol. Lett. 2008, 30, 1281–1288. [Google Scholar] [CrossRef] [PubMed]
  14. Dong, B.; Wang, Q.; Zhou, D.; Wang, Y.; Miao, Y.; Zhong, S.; Fang, Q.; Yang, L.; Xiao, Z.; Zhao, H. Abiotic stress treatment reveals expansin like A gene OfEXLA1 improving salt and drought tolerance of Osmanthus fragrans by responding to abscisic acid. Hortic. Plant J. 2024, 10, 537–585. [Google Scholar] [CrossRef]
  15. Zhang, H.; Ding, Y.; Zhi, J.; Li, X.; Liu, H.; Xu, J. Over-expression of the poplar expansin gene PtoEXPA12 in tobacco plants enhanced cadmium accumulation. Int. J. Biol. Macromol. 2018, 116, 676–682. [Google Scholar] [CrossRef]
  16. Zhu, Y.; Wu, N.; Song, W.; Yin, G.; Qin, Y.; Yan, Y.; Hu, Y. Soybean (Glycine max) expansin gene superfamily origins: Segmental and tandem duplication events followed by divergent selection among subfamilies. BMC Plant Biol. 2014, 14, 93. [Google Scholar] [CrossRef]
  17. Lee, D.K.; Ahn, J.H.; Song, S.K.; Choi, Y.D.; Lee, J.S. Expression of an expansin gene is correlated with root elongation in soybean. Plant Physiol. 2003, 131, 985–997. [Google Scholar] [CrossRef]
  18. Yang, Z.; Gao, Z.; Zhou, H.; He, Y.; Liu, Y.; Lai, Y.; Zheng, J.; Li, X.; Liao, H. GmPTF1 modifies root architecture responses to phosphate starvation primarily through regulating GmEXPB2 expression in soybean. Plant J. 2021, 107, 525–543. [Google Scholar] [CrossRef]
  19. Feng, X.; Li, C.; He, F.; Xu, Y.; Li, L.; Wang, X.; Chen, Q.; Li, F. Genome-Wide Identification of Expansin Genes in Wild Soybean (Glycine soja) and Functional Characterization of Expansin B1 (GsEXPB1) in Soybean Hair Root. Int. J. Mol. Sci. 2022, 23, 5407. [Google Scholar] [CrossRef]
  20. He, X.; Zeng, J.; Cao, F.; Ahmed, I.M.; Zhang, G.; Vincze, E.; Wu, F. HvEXPB7, a novel β-expansin gene revealed by the root hair transcriptome of Tibetan wild barley, improves root hair growth under drought stress. J. Exp. Bot. 2015, 66, 7405–7419. [Google Scholar] [CrossRef]
  21. Zou, C.-L.; Wang, Y.-B.; Wang, B.; Liu, D.; Liu, L.; Li, C.-F. Effects of alkali stress on dry matter accumulation, root morphology, ion balance, free polyamines, and organic acids of sugar beet. Acta Physiol. Plant. 2021, 43, 13. [Google Scholar] [CrossRef]
  22. Harb, A.; Asaad, H. Profiling the expression of expansin genes in barley roots under salinity stress at the germination stage. J. Plant Interact. 2024, 19, 2360938. [Google Scholar] [CrossRef]
  23. Peng, L.N.; Xu, Y.Q.; Wang, X.; Feng, X.; Zhao, Q.Q.; Feng, S.S.; Zhao, Z.Y.; Hu, B.Z.; Li, F.L. Overexpression of paralogues of the wheat expansin gene TaEXPA8 improves low-temperature tolerance in Arabidopsis. Plant Biol. 2019, 21, 1119–1131. [Google Scholar] [CrossRef]
  24. Lo, T.S.; Le, H.D.; Nguyen, V.T.; Chu, H.H.; Le, V.-S.; Chu, H.M. Overexpression of a soybean expansin gene, GmEXP1, improvesdrought tolerance in transgenic tobacco. Turk. J. Bot. 2015, 39, 988–995. [Google Scholar] [CrossRef]
  25. Kong, Y.; Wang, B.; Du, H.; Li, W.; Li, X.; Zhang, C. GmEXLB1, a Soybean Expansin-Like B Gene, Alters Root Architecture to Improve Phosphorus Acquisition in Arabidopsis. Front. Plant Sci. 2019, 10, 808. [Google Scholar] [CrossRef]
  26. Chen, X.; Jiang, X.; Sun, X.; Hu, Z.; Gao, F.; Wang, X.; Zhang, H.; Chen, R.; Jiang, Q. Gene editing and overexpression of soybean miR396a reveals its role in salinity tolerance and development. Crop J. 2024. [Google Scholar] [CrossRef]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  28. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  29. Li, X.; Wang, X.; Yang, Y.; Li, R.; He, Q.; Fang, X.; Luu, D.T.; Maurel, C.; Lin, J. Single-molecule analysis of PIP2;1 dynamics and partitioning reveals multiple modes of Arabidopsis plasma membrane aquaporin regulation. Plant Cell. 2011, 23, 3780–3797. [Google Scholar] [CrossRef]
  30. Liang, M.; Li, H.; Zhou, F.; Li, H.; Liu, J.; Hao, Y.; Wang, Y.; Zhao, H.; Han, S. Subcellular Distribution of NTL Transcription Factors in Arabidopsis thaliana. Traffic 2015, 16, 1062–1074. [Google Scholar] [CrossRef]
  31. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed]
  32. Cui, Y.; Barampuram, S.; Stacey, M.G.; Hancock, C.N.; Findley, S.; Mathieu, M.; Zhang, Z.; Parrott, W.A.; Stacey, G. Tnt1 retrotransposon mutagenesis: A tool for soybean functional genomics. Plant Physiol. 2013, 161, 36–47. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, J.; Zhang, D.; Yuan, Y.; Chen, P.; Zhang, P.; Jin, F.; Yang, Q.; Feng, B. A promising crop for cadmium-contamination remediation: Broomcorn millet. Ecotoxicol. Environ. Saf. 2021, 224, 112669. [Google Scholar] [CrossRef] [PubMed]
  34. Sule, R.; Rivera, G.; Gomes, A.V. Western blotting (immunoblotting): History, theory, uses, protocol and problems. Biotechniques 2023, 75, 99–114. [Google Scholar] [CrossRef]
  35. Christ, B.; Hochstrasser, R.; Guyer, L.; Francisco, R.; Aubry, S.; Hörtensteiner, S.; Weng, J.K. Non-specific activities of the major herbicide-resistance gene BAR. Nat. Plants 2017, 3, 937–945. [Google Scholar] [CrossRef]
  36. Feng, X.; Feng, P.; Yu, H.; Yu, X.; Sun, Q.; Liu, S.; Minh, T.N.; Chen, J.; Wang, D.; Zhang, Q.; et al. GsSnRK1 interplays with transcription factor GsERF7 from wild soybean to regulate soybean stress resistance. Plant Cell Environ. 2020, 43, 1192–1211. [Google Scholar] [CrossRef]
  37. Sun, Q.; Lu, H.R.; Zhang, Q.; Wang, D.; Chen, J.; Xiao, J.L.; Ding, X.D.; Li, Q. Transcriptome sequencing of wild soybean revealed gene expression dynamics under low nitrogen stress. J. Appl. Genet. 2021, 62, 389–404. [Google Scholar] [CrossRef]
  38. Acosta-Motos, J.R.; Ortuno, M.F.; Bernal-Vicente, A.; Diaz-Vivancos, P.; Sanchez-Blanco, M.J.; Hernandez, J.A. Plant responses to salt stress: Adaptive mechanisms. Agronomy 2017, 7, 18. [Google Scholar] [CrossRef]
  39. Witzel, K.; Matros, A.; Möller, A.L.B.; Ramireddy, E.; Finnie, C.; Peukert, M.; Rutten, T.; Herzog, A.; Kunze, G.; Melzer, M.J.; et al. Plasma membrane proteome analysis identifies a role of barley membrane steroid binding protein in root architecture response to salinity. Plant Cell Environ. 2018, 41, 1311–1330. [Google Scholar] [CrossRef]
  40. Wang, H.; Zhou, L.; Fu, Y.; Cheung, M.Y.; Wong, F.L.; Phang, T.H.; Sun, Z.; Lam, H.M. Expression of an apoplast-localized BURP-domain protein from soybean (GmRD22) enhances tolerance towards abiotic stress. Plant Cell Environ. 2012, 35, 1932–1947. [Google Scholar] [CrossRef]
  41. Zhang, B.; Liu, Z.; Zhou, R.; Cheng, P.; Li, H.; Wang, Z.; Liu, Y.; Li, M.; Zhao, Z.; Hu, Z.; et al. Genome-wide analysis of soybean DnaJA-family genes and functional characterization of GmDnaJA6 responses to saline and alkaline stress. Crop J. 2023, 11, 1230–1241. [Google Scholar] [CrossRef]
  42. Xun, H.; Yang, X.; He, H.; Wang, M.; Guo, P.; Wang, Y.; Pang, J.; Dong, Y.; Feng, X.; Wang, S.; et al. Over-expression of GmKR3, a TIR-NBS-LRR type R gene, confers resistance to multiple viruses in soybean. Plant Mol. Biol. 2018, 99, 95–111. [Google Scholar] [CrossRef] [PubMed]
  43. Chen, L.; Yang, H.; Fang, Y.; Guo, W.; Chen, H.; Zhang, X.; Dai, W.; Chen, S.; Hao, Q.; Yuan, S.; et al. Overexpression of GmMYB14 improves high-density yield and drought tolerance of soybean through regulating plant architecture mediated by the brassinosteroid pathway. Plant Biotechnol. J. 2020, 19, 702–716. [Google Scholar] [CrossRef]
  44. Hura, T.; Hura, K.; Ostrowska, A. Drought-Stress Induced Physiological and Molecular Changes in Plants. Int. J. Mol. Sci. 2022, 23, 4698. [Google Scholar] [CrossRef]
  45. Patel, J.; Khatri, K.; Khandwal, D.; Gupta, N.K.; Choudhary, B.; Hapani, D.; Koshiya, J.; Syed, S.N.; Phillips, D.W.; Jones, H.D.; et al. Modulation of physio-biochemical and photosynthesis parameters by overexpressing SbPIP2 gene improved abiotic stress tolerance of transgenic tobacco. Physiol. Plant. 2024, 176, e14384. [Google Scholar] [CrossRef]
  46. Sunil, S.; Saini, R. Photorespiration is complemented by cyclic electron flow and the alternative oxidase pathway to optimize photosynthesis and protect against abiotic stress. Photosynth. Res. 2019, 139, 67–79. [Google Scholar] [CrossRef]
  47. Hura, T.; Hura, K.; Ostrowska, A. Drought stress-induced physiological mechanisms, signaling pathways and molecular response of chloroplasts in common vegetable crops. Crit. Rev. Biotechnol. 2021, 41, 669–691. [Google Scholar]
  48. Suzuki, N.; Koussevitzky, S.; Mittler, R.; Miller, G. ROS and redox signaling in the response of plants to abiotic stress. Plant Cell Environ. 2012, 35, 259–270. [Google Scholar] [CrossRef]
  49. Bahmani, R.; Kim, D.; Modareszadeh, M.; Hwang, S. Ethylene and ROS mediate root growth inhibition induced by the endocrine disruptor bisphenol A (BPA). Plant Physiol. Biochem. 2023, 205, 108212. [Google Scholar] [CrossRef]
  50. Liu, T.; Ji, J.; Cheng, Y.; Zhang, S.; Wang, Z.; Duan, K.; Wang, Y. CRISPR/Cas9-mediated editing of GmTAP1 confers enhanced resistance to Phytophthora sojae in soybean. J. Integr. Plant Biol. 2023, 65, 13476. [Google Scholar] [CrossRef]
Figure 1. Heat maps of expansin gene expression. (A) Heat maps of expression of GsEXPA1, GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA10, GsEXPA11, GsEXPA12, GsEXPA15, and GsEXPA20 in wild soybean after 50 mM NaHCO3 treatment for 0 h, 3 h, 6 h, and 12 h, showing that relative expression level of GsEXPA8 was significantly induced by 50 mM NaHCO3 treatment at 12 h. (B) The relative expression level of GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA12, and GsEXPA23 in wild soybean after 15 mM ABA, 5 μM IAA, 0.5 μM GA, or 10 μM JA treatment for 0 h and 12 h. GsEXPA8 expression significantly responded to 15 mM ABA treatment. The expansin gene responded to ABA and IAA, except for GsEXPA6. Bars represent the relative expression values of genes after being calculated by 2−ΔΔCT method.
Figure 1. Heat maps of expansin gene expression. (A) Heat maps of expression of GsEXPA1, GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA10, GsEXPA11, GsEXPA12, GsEXPA15, and GsEXPA20 in wild soybean after 50 mM NaHCO3 treatment for 0 h, 3 h, 6 h, and 12 h, showing that relative expression level of GsEXPA8 was significantly induced by 50 mM NaHCO3 treatment at 12 h. (B) The relative expression level of GsEXPA6, GsEXPA8, GsEXPA9, GsEXPA12, and GsEXPA23 in wild soybean after 15 mM ABA, 5 μM IAA, 0.5 μM GA, or 10 μM JA treatment for 0 h and 12 h. GsEXPA8 expression significantly responded to 15 mM ABA treatment. The expansin gene responded to ABA and IAA, except for GsEXPA6. Bars represent the relative expression values of genes after being calculated by 2−ΔΔCT method.
Agronomy 15 00016 g001
Figure 2. Phylogenetic tree construction and sequence alignment results. (A) Phylogenetic tree construction with wild soybean GsEXPA8 and expansin family members in other species, including Arachis ipaensis, Arachis duranensis, Arabidopsis thaliana, Cannabis sativa, Euphorbia peplus, Hevea brasiliensis, Hibiscus trionum, Manihot esculenta, Mucuna pruriens, Medicago truncatula, Pistacia vera, Jatropha curcas, Glycine max, Stylosanthes scabra, Stylosanthes guianensis, and Trifolium repens. (B) Comparison of conserved domain sequences of EXPA8 proteins in different species, including Glycine soja, Glycine max, Stylosanthes guianensis, Arachis duranensis, Arachis ipaensis, Mucuna pruriens, Medicago truncatula, Trifolium repens, Pistacia vera, and Arabidopsis thaliana. The red box shows the DPBB_EXPA domain, and the green box shows the expansin domain. In multiple sequence alignments, ‘*’ usually indicates that the amino acids of all sequences at that location are exactly the same, but in some cases it may also indicate alignments that are highly conserved or have high confidence, even if the amino acids are not exactly the same.
Figure 2. Phylogenetic tree construction and sequence alignment results. (A) Phylogenetic tree construction with wild soybean GsEXPA8 and expansin family members in other species, including Arachis ipaensis, Arachis duranensis, Arabidopsis thaliana, Cannabis sativa, Euphorbia peplus, Hevea brasiliensis, Hibiscus trionum, Manihot esculenta, Mucuna pruriens, Medicago truncatula, Pistacia vera, Jatropha curcas, Glycine max, Stylosanthes scabra, Stylosanthes guianensis, and Trifolium repens. (B) Comparison of conserved domain sequences of EXPA8 proteins in different species, including Glycine soja, Glycine max, Stylosanthes guianensis, Arachis duranensis, Arachis ipaensis, Mucuna pruriens, Medicago truncatula, Trifolium repens, Pistacia vera, and Arabidopsis thaliana. The red box shows the DPBB_EXPA domain, and the green box shows the expansin domain. In multiple sequence alignments, ‘*’ usually indicates that the amino acids of all sequences at that location are exactly the same, but in some cases it may also indicate alignments that are highly conserved or have high confidence, even if the amino acids are not exactly the same.
Agronomy 15 00016 g002
Figure 3. Subcellular localization of GsEXPA8. (A) pEGOEP35S::GFP was expressed in the whole Arabidopsis protoplast. pEGOEP35S::GsEXPA8-GFP was expressed in the cytoplasm of Arabidopsis protoplasts and cell membrane. (B) pEGOEP35S::GFP was expressed and distributed throughout the cell. pEGOEP35S::GsEXPA8-GFP was expressed in cell membrane and cell wall of tobacco leaves. The green signal is from the green fluorescent protein under confocal microscope scanning.
Figure 3. Subcellular localization of GsEXPA8. (A) pEGOEP35S::GFP was expressed in the whole Arabidopsis protoplast. pEGOEP35S::GsEXPA8-GFP was expressed in the cytoplasm of Arabidopsis protoplasts and cell membrane. (B) pEGOEP35S::GFP was expressed and distributed throughout the cell. pEGOEP35S::GsEXPA8-GFP was expressed in cell membrane and cell wall of tobacco leaves. The green signal is from the green fluorescent protein under confocal microscope scanning.
Agronomy 15 00016 g003
Figure 4. Phenotype experiments in WT and GsEXPA8 stable transgenic plants under alkaline stress. (A) Western blotting detection of GFP-tag. (B) Identification of GsEXPA8-overexpressing plants by immunochromatographic testing method. Control line and positive line are shown by red arrows. (C) GsEXPA8 transgenic and WT soybean phenotypes after 0, 5, and 15 days of alkaline stress. (D) Malondialdehyde (MDA) content of CK (control group) and alkaline stress treatment (15 days) group. (E) Peroxidase (POD) activity of CK and alkaline stress treatment group. (F) Transpiration rate (Tr) of GsEXPA8 transgenic and WT soybeans. (G) Net photosynthesis (Pn) of GsEXPA8 transgenic and WT soybeans. (H) Stomatal conductance (Gs) of GsEXPA8 transgenic and WT soybeans. (I) Water usage effectiveness (WUE) of GsEXPA8 transgenic and WT soybeans. Values with different letters show different levels of significance, but those with the same letter mean no significance.
Figure 4. Phenotype experiments in WT and GsEXPA8 stable transgenic plants under alkaline stress. (A) Western blotting detection of GFP-tag. (B) Identification of GsEXPA8-overexpressing plants by immunochromatographic testing method. Control line and positive line are shown by red arrows. (C) GsEXPA8 transgenic and WT soybean phenotypes after 0, 5, and 15 days of alkaline stress. (D) Malondialdehyde (MDA) content of CK (control group) and alkaline stress treatment (15 days) group. (E) Peroxidase (POD) activity of CK and alkaline stress treatment group. (F) Transpiration rate (Tr) of GsEXPA8 transgenic and WT soybeans. (G) Net photosynthesis (Pn) of GsEXPA8 transgenic and WT soybeans. (H) Stomatal conductance (Gs) of GsEXPA8 transgenic and WT soybeans. (I) Water usage effectiveness (WUE) of GsEXPA8 transgenic and WT soybeans. Values with different letters show different levels of significance, but those with the same letter mean no significance.
Agronomy 15 00016 g004
Figure 5. Root morphology of WT and GsEXPA8 transient overexpression soybean hair roots. (A) Localization of GsEXPA8 in root tips of GsEXPA8 transient overexpression lines. GFP, green fluorescent protein, was detected as GsEXPA8 and was fused with GFP-tag. PI, propidium iodide, was used to stain dead cell walls. (B) Root morphological characteristics in WT and GsEXPA8 transient overexpression soybean hair roots. (C) DAB staining of WT and GsEXPA8 transient overexpression soybean leaves under 0 and 100 mM NaHCO3 stress. (D) Stem and root lengths of WT and GsEXPA8 transient overexpression soybean plants. (E) Root volumes of WT and GsEXPA8 transient overexpression soybean plants. (F) Average diameters of WT and GsEXPA8 transient overexpression soybean plants. (G) Numbers of root connections, root segments, root tips, crossings, and forks of WT and GsEXPA8 transient overexpression soybean plants. (H) Total and root weights of WT and GsEXPA8 transient overexpression soybean plants. Values with different letters show different levels of significance, but those with the same letter mean no significance.
Figure 5. Root morphology of WT and GsEXPA8 transient overexpression soybean hair roots. (A) Localization of GsEXPA8 in root tips of GsEXPA8 transient overexpression lines. GFP, green fluorescent protein, was detected as GsEXPA8 and was fused with GFP-tag. PI, propidium iodide, was used to stain dead cell walls. (B) Root morphological characteristics in WT and GsEXPA8 transient overexpression soybean hair roots. (C) DAB staining of WT and GsEXPA8 transient overexpression soybean leaves under 0 and 100 mM NaHCO3 stress. (D) Stem and root lengths of WT and GsEXPA8 transient overexpression soybean plants. (E) Root volumes of WT and GsEXPA8 transient overexpression soybean plants. (F) Average diameters of WT and GsEXPA8 transient overexpression soybean plants. (G) Numbers of root connections, root segments, root tips, crossings, and forks of WT and GsEXPA8 transient overexpression soybean plants. (H) Total and root weights of WT and GsEXPA8 transient overexpression soybean plants. Values with different letters show different levels of significance, but those with the same letter mean no significance.
Agronomy 15 00016 g005
Figure 6. Relative expression levels of alkali stress response genes in stable transgenic soybean roots under normal and alkaline stress conditions. (A) GsKIN1; (B) GsRD22; (C) GsDnaJA6; (D) GsNFYC1; (E) GsMYB14. Values with different letters show different levels of significance, but those with the same letter mean no significance.
Figure 6. Relative expression levels of alkali stress response genes in stable transgenic soybean roots under normal and alkaline stress conditions. (A) GsKIN1; (B) GsRD22; (C) GsDnaJA6; (D) GsNFYC1; (E) GsMYB14. Values with different letters show different levels of significance, but those with the same letter mean no significance.
Agronomy 15 00016 g006
Table 1. Primers for qPCR analysis.
Table 1. Primers for qPCR analysis.
Primer NamesPrimer Sequences (5′-3′)
qEA1-RCCAAGAAGAGCCATTTTCCTTGAA
qEA1-F ATTTGCATGGTCCCAACCGT
qEA6-R CACACGCTCCTCCCATAGTT
qEA6-F TCTCCATTCTCTCTCTCTTACTCAC
qEA8-FGGTATGGCACTAACACTG
qEA8-RTCTAGACCCTTTGATGGA
qEA9-R AAACTGAGCTCAATGCTGCC
qEA9-F AGGCTCTGGAACATTTGGAGG
qEA10-F TGACTGCCCCTATTGAAGGC
qEA10-R ACAAACTTGAGCCATTTTTCTTTTG
qEA11-F CCTCTGGGACAATGGGAGGA
qEA11-R CACTCCCCACACGATGCTC
qEA12-F ATTTTTGCTTTGTTCTAAGTGCAG
qEA12-R CCACATGCTCCCCCAAGG
qEA15-R GGTACCAGCAATTCATCTGAGAG
qEA15-F CTGGCAGAGCAACTCCTACC
qEA20-R CATAACCACATGCTCCTTCTGT
qEA20-F AGACCAGGAGTGGAAGAAAGC
qEA23-F CAGTCGTCATCGAAGAAGTGGA
qEA23-R AGCCACAAGCACCCTGCAT
qGmACTIN4-FGTGTCAGCCATACTGTCCCCATTT
qGmACTIN4-RGTTTCAAGCTCTTGCTCGTAATCA
Table 2. Primers for marker gene qPCR analysis.
Table 2. Primers for marker gene qPCR analysis.
Primer NamesPrimer Sequences (5′-3′)
qRD22-F TCGTCTCCTACCCATTTTTACTTTA
qRD22-RTCCACCCAATCGGGGTAA
qDnaJA6-FAGCAGTGGCTAAGCTAGCAG
qDnaJA6-R TCCCGCGAAAATCTGAGGAT
qMYB14-F ACATCTGGGTAACAGATGGTC
qMYB14-R GTGGCTACTGAGTCTTGTTGA
qNFYC1-FGCTCTTGGAATCACACTGAAG
qNFYC1-RGGCATGTAGCAGTATGGAAG
qKIN1-FATCTCCATAACGGACTTCGGTG
qKIN1-RATTCCCCAACTCCTGCGTGG
qGmACTIN4-FGTGTCAGCCATACTGTCCCCATTT
qGmACTIN4-RGTTTCAAGCTCTTGCTCGTAATCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, M.; Tang, J.; Ma, S.; Liu, Y.; Wang, X.; Du, X.; Sun, X.; Zeng, Y.; Zeng, Y.; Ding, X.; et al. GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology. Agronomy 2025, 15, 16. https://doi.org/10.3390/agronomy15010016

AMA Style

Liu M, Tang J, Ma S, Liu Y, Wang X, Du X, Sun X, Zeng Y, Zeng Y, Ding X, et al. GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology. Agronomy. 2025; 15(1):16. https://doi.org/10.3390/agronomy15010016

Chicago/Turabian Style

Liu, Mengyu, Jixiang Tang, Shengjie Ma, Yujing Liu, Xiaoyu Wang, Xinlei Du, Xiaohuan Sun, Yucheng Zeng, Yulong Zeng, Xiaodong Ding, and et al. 2025. "GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology" Agronomy 15, no. 1: 16. https://doi.org/10.3390/agronomy15010016

APA Style

Liu, M., Tang, J., Ma, S., Liu, Y., Wang, X., Du, X., Sun, X., Zeng, Y., Zeng, Y., Ding, X., Han, Y., Zhang, J., & Cao, L. (2025). GsEXPA8 Enhances Soybean Tolerance of NaHCO3 Stress by Regulating Root Morphology. Agronomy, 15(1), 16. https://doi.org/10.3390/agronomy15010016

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop