Effects of Nitrogen Fertilization on Soil CH4, CO2, and N2O Emissions and Their Global Warming Potential in Agricultural Peatlands
Abstract
1. Introduction
2. Materials and Methods
2.1. Site Description
2.2. CH4, CO2 and N2O Efflux and Depths Concentrations Measurement
2.3. Soil Collection and Measurement
2.4. DNA Extraction and Quantitative PCR
2.5. Statistical Analysis
3. Results
3.1. The CH4 Efflux and Concentrations in the Soil Profiles
3.2. The CO2 Efflux and Concentrations in the Soil Profiles
3.3. The N2O Efflux and Concentrations in the Soil Profiles
3.4. The Global Warming Potential (GWP) Response to N Fertilization
3.5. Abundance of CH4- and N2O-Related Genes
3.6. Environmental and Microbiological Factors on CH4, CO2 and N2O
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Doroski, A.A.; Helton, A.M.; Vadas, T.M. Greenhouse gas fluxes from coastal wetlands at the intersection of urban pollution and saltwater intrusion: A soil core experiment. Soil Biol. Biochem. 2019, 131, 44–53. [Google Scholar] [CrossRef]
- Monteux, S.; Keuper, F.; Fontaine, S.; Gavazov, K.; Hallin, S.; Juhanson, J.; Krab, E.J.; Revaillot, S.; Verbruggen, E.; Walz, J.; et al. Carbon and nitrogen cycling in Yedoma permafrost controlled by microbial functional limitations. Nat. Geosci. 2020, 13, 794–798. [Google Scholar] [CrossRef]
- Moore, T.R.; Knorr, K.H.; Thompson, L.; Roy, C.; Bubier, J.L. The effect of long-term fertilization on peat in an ombrotrophic bog. Geoderma 2019, 343, 176–186. [Google Scholar] [CrossRef]
- Aryal, B.; Gurung, R.; Camargo, A.F.; Fongaro, G.; Treichel, H.; Mainali, B.; Angove, M.J.; Ngo, H.H.; Guo, W.S.; Puadel, S.R. Nitrous oxide emission in altered nitrogen cycle and implications for climate change. Environ. Pollut. 2022, 314, 120272. [Google Scholar] [CrossRef]
- Dincă, L.C.; Grenni, P.; Onet, C.; Onet, A. Fertilization and Soil Microbial Community: A Review. Appl. Sci. 2022, 12, 1198. [Google Scholar] [CrossRef]
- Gong, Y.; Wu, J.; Vogt, J.; Ma, W. Greenhouse gas emissions from peatlands under manipulated warming, nitrogen addition, and vegetation composition change: A review and data synthesis. Environ. Rev. 2020, 28, 428–437. [Google Scholar] [CrossRef]
- Maslov, M.N.; Maslova, O.A. Temperate peatlands use-management effects on seasonal patterns of soil microbial activity and nitrogen availability. CATENA 2020, 190, 104548. [Google Scholar] [CrossRef]
- Anthony, T.L.; Silver, W.L. Hot moments drive extreme nitrous oxide and methane emissions from agricultural peatlands. Glob. Change Biol. 2021, 27, 5141–5153. [Google Scholar] [CrossRef]
- Chen, M.; Chang, L.; Zhang, J.; Guo, F.; Vymazal, J.; He, Q.; Chen, Y. Global nitrogen input on wetland ecosystem: The driving mechanism of soil labile carbon and nitrogen on greenhouse gas emissions. Environ. Sci. Ecotechnol. 2020, 4, 100063. [Google Scholar] [CrossRef]
- Legierse, A.; Struik, Q.; Smith, G.; Echeveste Medrano, M.J.; Weideveld, S.; van Dijk, G.; Smolders, A.J.P.; Jetten, M.; Veraart, A.J.; Welte, C.U.; et al. Nitrate-dependent anaerobic methane oxidation (N-DAMO) as a bioremediation strategy for waters affected by agricultural runoff. FEMS Microbiol. Lett. 2023, 370, fnad041. [Google Scholar] [CrossRef]
- Shi, Y.; Ma, Q.; Kuzyakov, Y.; Sheng, L.; Liu, H.; Wang, Z. Nitrite-dependent anaerobic oxidation decreases methane emissions from peatlands. Soil Biol. Biochem. 2022, 169, 108658. [Google Scholar] [CrossRef]
- Zhang, W.; Hu, Z.; Audet, J.; Davidson, T.A.; Kang, E.; Kang, X.; Li, Y.; Zhang, X.; Wang, J. Effects of water table level and nitrogen deposition on methane and nitrous oxide emissions in an alpine peatland. Biogeosciences 2022, 19, 5187–5197. [Google Scholar] [CrossRef]
- Meng, X.; Zhu, Z.; Xue, J.; Wang, C.; Sun, X. Methane and Nitrous Oxide Emissions from a Temperate Peatland under Simulated Enhanced Nitrogen Deposition. Sustainability 2023, 15, 1010. [Google Scholar] [CrossRef]
- Sihi, D.; Inglett, P.W.; Gerber, S.; Inglett, K.S. Rate of warming affects temperature sensitivity of anaerobic peat decomposition and greenhouse gas production. Glob. Change Biol. 2018, 24, e259–e274. [Google Scholar] [CrossRef]
- Munir, T.M.; Khadka, B.; Xu, B.; Strack, M. Mineral nitrogen and phosphorus pools affected by water table lowering and warming in a boreal forested peatland. Ecohydrology 2017, 10, e1893. [Google Scholar] [CrossRef]
- Daly, E.J.; Hernandez-Ramirez, G.; Congreves, K.A.; Clough, T.; Voigt, C.; Harris, E.; Ruser, R. Soil organic nitrogen priming to nitrous oxide: A synthesis. Soil Biol. Biochem. 2024, 189, 109254. [Google Scholar] [CrossRef]
- Leeson, S.R.; Levy, P.E.; van Dijk, N.; Drewer, J.; Robinson, S.; Jones, M.R.; Kentisbeer, J.; lan, W.; Sutton, M.A.; Sheppard, L.J. Nitrous oxide emissions from a peatbog after 13 years of experimental nitrogen deposition. Biogeosciences 2017, 14, 5753–5764. [Google Scholar] [CrossRef]
- Yi, B.; Lu, F.; Bu, Z.J. Nitrogen addition turns a temperate peatland from a near-zero source into a strong sink of nitrous oxide. Plant Soil Environ. 2022, 68, 49–58. [Google Scholar] [CrossRef]
- Nabuurs, G.J.; Mrabet, R.; Hatab, A.A.; Bustamante, M.; Clark, H.; Havlík, P.; House, J.I.; Mbow, C.; Ninan, K.N.; Popp, A.; et al. Agriculture, Forestry and Other Land Uses (AFOLU). In Climate Change 2022: Mitigation of Climate Change; Shukla, P.R., Skea, J., Slade, R., Al Khourdajie, A., van Diemen, R., McCollum, D., Pathak, M., Some, S., Vyas, P., Fradera, R., et al., Eds.; Cambridge University Press: Cambridge, UK; New York, NY, USA, 2023. [Google Scholar] [CrossRef]
- Ettwig, K.F.; Van Alen, T.; van de Pas-Schoonen, K.T.; Jetten, M.S.; Strous, M. Enrichment and molecular detection of denitrifying methanotrophic bacteria of the NC10 phylum. Appl. Environ. Microbiol. 2009, 75, 3656–3662. [Google Scholar] [CrossRef]
- Vaksmaa, A.; Van Alen, T.A.; Ettwig, K.F.; Lupotto, E.; Valè, G.; Jetten, M.S.; Lüke, C. Stratification of diversity and activity of methanogenic and methanotrophic microorganisms in a nitrogen-fertilized Italian paddy soil. Front. Microbiol. 2017, 8, 2127. [Google Scholar] [CrossRef]
- Wang, S.; Lan, B.; Yu, L.; Xiao, M.; Jiang, L.; Qin, Y.; Jin, Y.; Zhou, Y.; Armanbek, G.; Ma, J.; et al. Ammonium-derived nitrous oxide is a global source in streams. Nat. Commun. 2024, 15, 4085. [Google Scholar] [CrossRef]
- Hallin, S.; Jones, C.M.; Schloter, M.; Philippot, L. Relationship between N-cycling communities and ecosystem functioning in a 50-year-old fertilization experiment. ISME J. 2009, 3, 597–605. [Google Scholar] [CrossRef] [PubMed]
- Michotey, V.; Mejean, V.; Bonin, P. Comparison of methods for quantification of cytochrome cd 1-denitrifying bacteria in environmental marine samples. Appl. Environ. Microbiol. 2000, 66, 1564–1571. [Google Scholar] [CrossRef]
- Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L. Quantitative detection of the nosZ gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S rRNA, narG, nirK, and nosZ genes in soils. Appl. Environ. Microbiol. 2006, 72, 5181–5189. [Google Scholar] [CrossRef] [PubMed]
- Bru, D.; Sarr, A.; Philippot, L. Relative abundances of proteobacterial membrane-bound and periplasmic nitrate reductases in selected environments. Appl. Environ. Microbiol. 2007, 73, 5971–5974. [Google Scholar] [CrossRef]
- Zhao, J.; Weldon, S.; Barthelmes, A.; Swails, E.; Hergoualc’h, K.; Mander, Ü.; Qin, C.; Connolly, J.; Silver, W.L.; Campbell, D.I. Global observation gaps of peatland greenhouse gas balances: Needs and obstacles. Biogeochemistry 2024, 167, 427–442. [Google Scholar] [CrossRef]
- Shi, Y.; Zhang, X.; Wang, Z.; Xu, Z.; He, C.; Sheng, L.; Liu, H.; Wang, Z. Shift in nitrogen transformation in peatland soil by nitrogen inputs. Sci. Total Environ. 2021, 764, 142924. [Google Scholar] [CrossRef]
- Wei, H.; Song, X.; Liu, Y.; Wang, R.; Zheng, X.; Butterbach-Bahl, K.; Venterea, R.T.; Wu, D.; Ju, X. In Situ 15N-N2O site preference and O2 concentration dynamics disclose the complexity of N2O production processes in agricultural soil. Glob. Change Biol. 2023, 29, 4910–4923. [Google Scholar] [CrossRef]
- Zhang, Y.; Chen, J.; Cheng, X. Revisiting the relationships between soil nitrous oxide emissions and microbial functional gene abundances. Glob. Change Biol. 2023, 29, 4697–4699. [Google Scholar] [CrossRef]
- Lee, J.; Oh, Y.; Lee, S.T.; Seo, Y.O.; Yun, J.; Yang, Y.; Kim, J.; Zhuang, Q.; Kang, H. Soil organic carbon is a key determinant of CH4 sink in global forest soils. Nat. Commun. 2023, 14, 3110. [Google Scholar] [CrossRef]
- Yang, L.; Zhu, G.; Ju, X.; Liu, R. How nitrification-related N2O is associated with soil ammonia oxidizers in two contrasting soils in China? Sci. Total Environ. 2021, 770, 143212. [Google Scholar] [CrossRef] [PubMed]
- Abalos, D.; Liang, Z.; Dörsch, P.; Elsgaard, L. Trade-offs in greenhouse gas emissions across a liming-induced gradient of soil pH: Role of microbial structure and functioning. Soil Biol. Biochem. 2020, 150, 108006. [Google Scholar] [CrossRef]
Specificity | Primer | Sequence (5’-3’) | Thermal Profiles |
---|---|---|---|
NC10 | p1F | GGGCTTGACATCCCACGAACCTG | 3 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s at 63 °C and 30 s at 72 °C [20] |
p1R | CGCCTTCCTCCAGCTTGACGC | ||
p2F | GGGGAACTGCCAGCGTCAAG | 3 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s at 63 °C and 30 s at 72 °C [20] | |
p2R | CTCAGCGACTTCGAGTACAG | ||
mcrA | 159F | AAAGTGCGGAGCAGCAATCACC | 5 min at 96 °C, 45 cycles of 30 s at 96 °C, 30 s at 57 °C and 30 s 72 °C [21] |
345R | TCGTCCCATTCCTGCTGCATTGC | ||
AOA-amoA | archea-amoAF | STAATGGTCTGGCTTAGACG | 5 min at 95 °C, 35 cycles of 45 s at 94 °C, 1 min at 53 °C and 1 min at 72 °C [22] |
archea-amoAR | GCGGCCATCCATCTGTATGT | ||
AOB-amoA | amoA-1F | GGGGTTTCTACTGGTGGT | 5 min at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 55 °C and 1 min at 72 °C [22] |
amoA-2R | CCCCTCKGSAAAGCCTTCTTC | ||
nirK | FlaCu | ATCATGGTSCTGCCGCG | 2 min at 95 °C, 40 cycles of 20 s at 95 °C, 30 s at 63 °C, 30 s at 73 °C and 15 s at 85 °C [23] |
R3Cu | TTGGTGTTRGACTAGCTCCG | ||
nirS | cd3aF | GTSAACGTSAAGGARACSGG | 3 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 59 °C and 1 min at 72 °C [24] |
R3cd | GASTTCGGRTGSGTCTTGA | ||
nosZ | nosZ2F | CGCRACGGCAASAAG GTSMSSGT | 5 min at 95 °C, 40 cycles of 30 s at 95 °C, 30 s at 54 °C, 40 s at 72 °C [25] |
nosZ2R | CAKRTGCAKSGCRTGGCAGAA | ||
narG | narGf | TCGCCSATYCCGGCSATGTC | 3 min at 95 °C, 35 cycles of 30 s at 94 °C, 30 s at 57 °C and 30 s at 72 °C [26] |
narGr | GAGTTGTACCAGTCRGCSGAYTCSG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, Y.; Wei, X.; Sheng, L.; Yang, X. Effects of Nitrogen Fertilization on Soil CH4, CO2, and N2O Emissions and Their Global Warming Potential in Agricultural Peatlands. Agronomy 2025, 15, 115. https://doi.org/10.3390/agronomy15010115
Shi Y, Wei X, Sheng L, Yang X. Effects of Nitrogen Fertilization on Soil CH4, CO2, and N2O Emissions and Their Global Warming Potential in Agricultural Peatlands. Agronomy. 2025; 15(1):115. https://doi.org/10.3390/agronomy15010115
Chicago/Turabian StyleShi, Yao, Xiaowei Wei, Lianxi Sheng, and Xuechen Yang. 2025. "Effects of Nitrogen Fertilization on Soil CH4, CO2, and N2O Emissions and Their Global Warming Potential in Agricultural Peatlands" Agronomy 15, no. 1: 115. https://doi.org/10.3390/agronomy15010115
APA StyleShi, Y., Wei, X., Sheng, L., & Yang, X. (2025). Effects of Nitrogen Fertilization on Soil CH4, CO2, and N2O Emissions and Their Global Warming Potential in Agricultural Peatlands. Agronomy, 15(1), 115. https://doi.org/10.3390/agronomy15010115