A205V, D376E, W574L, S653T, and S653N Substitutions in Acetohydroxy Acid Synthase from Amaranthus retroflexus L. Show Different Functional Impacts on Herbicide Resistance
Abstract
1. Introduction
2. Materials and Methods
2.1. Sources of Plant Material
2.2. Identification of ArAHAS Gene Mutations
2.3. Whole-Plant Dose Responses to Nicosulfuron
2.4. In Vitro ArAHAS Activity Assay
2.5. Vmax and Km (Pyruvate) Assay for ArAHAS
2.6. ArAHAS Feedback-Regulation Assays
2.7. Determination of Free Amino Acids in A. retroflexus
2.8. Determination of Cross Resistance
2.9. Molecular Binding Mode Analysis for ArAHAS and Nicosulfuron
2.10. Data Analysis
3. Results
3.1. Dose–Response Assays
3.2. ArAHAS Gene Sequence Analyses
3.3. In Vitro ArAHAS-Activity Assays
3.4. Km (Pyruvate) and Vmax Assays for ArAHAS
3.5. ArAHAS Feedback-Regulation Assay
3.6. Determination of Free Amino Acids in A. retroflexus
3.7. Computational Analysis of AHAS Binding with Nicosulfuron
3.8. Determination of Cross Resistance
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ash, C. Meeting resistance. Science 2018, 360, 726–727. [Google Scholar] [CrossRef] [PubMed]
- Gould, F.; Brown, Z.S.; Kuzma, J. Wicked evolution: Can we address the sociobiological dilemma of pesticide resistance? Science 2018, 360, 728–732. [Google Scholar] [CrossRef] [PubMed]
- Yu, Q.; Powles, S.B. Resistance to AHAS inhibitor herbicides: Current understanding. Pest Manag. Sci. 2014, 70, 1340–1350. [Google Scholar] [CrossRef] [PubMed]
- Gaines, T.A.; Duke, S.O.; Morran, S.; Rigon, C.A.G.; Tranel, P.J.; Küpper, A.; Dayan, F.E. Mechanisms of evolved herbicide resistance. J. Biol. Chem. 2020, 295, 10307–10330. [Google Scholar] [CrossRef] [PubMed]
- Duke, S.O.; Dayan, F.E. The search for new herbicide mechanisms of action: Is there a ‘holy grail’? Pest Manag. Sci. 2022, 78, 1303–1313. [Google Scholar] [CrossRef]
- Huang, Z.; Chen, J.; Zhang, C.; Huang, H.; Wei, S.; Zhou, X.; Chen, J.; Wang, X. Target-site basis for resistance to imazethapyr in redroot amaranth (Amaranthus retroflexus L.). Pestic. Biochem. Physiol. 2015, 128, 10–15. [Google Scholar] [CrossRef]
- Wang, H.; Wang, H.; Zhao, N.; Zhu, B.; Sun, P.; Liu, W.; Wang, J. Multiple resistance to PPO and ALS inhibitors in redroot pigweed (Amaranthus retroflexus). Weed Sci. 2020, 68, 19–26. [Google Scholar] [CrossRef]
- McCourt, J.A.; Pang, S.S.; King-Scott, J.; Guddat, L.W.; Duggleby, R.G. Herbicide-binding sites revealed in the structure of plant acetohydroxyacid synthase. Proc. Natl. Acad. Sci. USA 2006, 103, 569–573. [Google Scholar] [CrossRef]
- Lonhienne, T.; Garcia, M.D.; Pierens, G.; Mobli, M.; Nouwens, A.; Guddat, L.W. Structural insights into the mechanism of inhibition of AHAS by herbicides. Proc. Natl. Acad. Sci. USA 2018, 115, E1945–E1954. [Google Scholar] [CrossRef]
- Lonhienne, T.; Low, Y.S.; Garcia, M.D.; Croll, T.; Gao, Y.; Wang, Q.; Brillault, L.; Williams, C.M.; Fraser, J.A.; McGeary, R.P.; et al. Structures of fungal and plant acetohydroxyacid synthases. Nature 2020, 586, 317–321. [Google Scholar] [CrossRef]
- Chen, J.; Huang, Z.; Zhang, C.; Huang, H.; Wei, S.; Chen, J.; Wang, X. Molecular basis of resistance to imazethapyr in redroot pigweed (Amaranthus retroflexus L.) populations from China. Pestic. Biochem. Physiol. 2015, 124, 43–47. [Google Scholar] [CrossRef] [PubMed]
- Garcia, M.D.; Nouwens, A.; Lonhienne, T.G.; Guddat, L.W. Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families. Proc. Natl. Acad. Sci. USA 2017, 114, E1091–E1100. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Merchant, A.; Xiang, S.; Zong, T.; Zhou, X.; Bai, L. Managing herbicide resistance in China. Weed Sci. 2021, 69, 4–17. [Google Scholar] [CrossRef]
- Garcia, M.D.; Chua, S.M.H.; Low, Y.S.; Lee, Y.T.; Agnew-Francis, K.; Wang, J.G.; Nouwens, A.; Lonhienne, T.; Williams, C.M.; Fraser, J.A.; et al. Commercial AHAS-inhibiting herbicides are promising drug leads for the treatment of human fungal pathogenic infections. Proc. Natl. Acad. Sci. USA 2018, 115, E9649–E9658. [Google Scholar] [CrossRef]
- Heap, I. The International Herbicide-Resistant Weed Database. 2024. Available online: www.weedscience.org (accessed on 1 June 2024).
- Neve, P.; Vila-Aiub, M.; Roux, F. Evolutionary-thinking in agricultural weed management. New Phytol. 2009, 184, 783–793. [Google Scholar] [CrossRef]
- Délye, C.; Jasieniuk, M.; Le Corre, V. Deciphering the evolution of herbicide resistance in weeds. Trends Genet. 2013, 29, 649–658. [Google Scholar] [CrossRef]
- Cao, Y.; Zhou, X.; Huang, Z. Amino acid substitution (Gly-654-Tyr) in acetolactate synthase (ALS) confers broad spectrum resistance to ALS-inhibiting herbicides. Pest Manag. Sci. 2022, 78, 541–549. [Google Scholar] [CrossRef]
- Wang, R.; Han, Y.; Sun, Y.; Huang, H.; Wei, S.; Huang, Z. Growth and competitiveness of ALS-inhibiting herbicide-resistant Amaranthus retroflexus L. Plants 2022, 11, 2639. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. A rapid total DNA preparation procedure for fresh plant tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Yu, Q.; Han, H.; Vila-Aiub, M.M.; Powles, S.B. AHAS herbicide resistance endowing mutations: Effect on AHAS functionality and plant growth. J. Exp. Bot. 2010, 61, 3925–3934. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Li, X.; Wang, K.; Zhao, P.; Li, J.; Wang, W.; Ahmed, M.; Shafi, J.; Zhao, B.; Fu, D.; et al. Molecular basis of cross-resistance to acetohydroxy acid synthase-inhibiting herbicides in Sagittaria trifolia L. Pestic. Biochem. Physiol. 2021, 173, 104795. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Zhao, N.; Yan, Y.; Du, L.; Zhang, X.; Liu, W.; Wang, J. Unravelling the effect of two herbicide resistance mutations on acetolactate synthase kinetics and growth traits. J. Exp. Bot. 2020, 71, 3535–3542. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Wang, M.; Chen, Y.; Deng, Y.; Zhang, L.; Bai, T.; Ji, M. Occurrence and mechanism of target-site resistance to bensulfuron-methyl in Monochoria korsakowii from China. Pestic. Biochem. Physiol. 2023, 191, 105379. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Cai, W.; Shao, X. Quantitative analysis of 17 amino acids in tobacco leaves using an amino acid analyzer and chemometric resolution. J. Sep. Sci. 2015, 38, 2053–2058. [Google Scholar] [CrossRef]
- Ta, H.Y.; Collin, F.; Perquis, L.; Poinsot, V.; Ong-Meang, V.; Couderc, F. Twenty years of amino acid determination using capillary electrophoresis: A review. Anal. Chim. Acta 2021, 1174, 338233. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Liu, C.; Long, W.; Gao, J.; Zhang, J.; Chen, S.; Pu, H.; Hu, M. Development and molecular analysis of a novel acetohydroxyacid synthase rapeseed mutant with high resistance to sulfonylurea herbicides. Crop J. 2022, 10, 56–66. [Google Scholar] [CrossRef]
- Torsten, S. SWISS-MODEL. 2023. Available online: https://swissmodel.expasy.org/ (accessed on 27 November 2023).
- Seefeldt, S.S.; Jensen, J.E.; Fuerst, E.P. Log-Logistic analysis of herbicide dose-response relationships. Weed Technol. 1995, 9, 218–227. [Google Scholar] [CrossRef]
- Lipovetsky, S. Double logistic curve in regression modeling. J. Appl. Stat. 2010, 37, 1785–1793. [Google Scholar] [CrossRef]
- Kawamata, S. NLR Ana v6.6d. 2012. Available online: https://itcweb.cc.affrc.go.jp/affrit/web-links-en (accessed on 27 November 2023). (In Japanese).
- Yamato, S.; Sada, Y.; Ikeda, H. Characterization of acetolactate synthase from sulfonylurea herbicide-resistant Schoenoplectus juncoides. Weed Biol. Manag. 2013, 13, 104–133. [Google Scholar] [CrossRef]
- Michaelis, M.; Menten, M.L. Die kinetik der invertinwirkung. Biochem. J. 1913, 49, 333–369. [Google Scholar]
- Peletier, L.A.; Gabrielsson, J. Impact of enzyme turnover on the dynamics of the Michaelis-Menten model. Math. Biosci. 2022, 346, 108795. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Cui, H.; Wang, C.; Wu, T.; Zhang, C.; Huang, H.; Wei, S. Investigation of resistance mechanism to fomesafen in Amaranthus retroflexus L. Pestic. Biochem. Physiol. 2020, 165, 104560. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Huang, H.; Chen, J.; Chen, J.; Wei, S.; Zhang, C. Nicosulfuron-resistant Amaranthus retroflexus L. in northeast China. Crop Prot. 2019, 122, 79–83. [Google Scholar] [CrossRef]
- Li, M.; Yu, Q.; Han, H.; Vila-Aiub, M.; Powles, S.B. ALS herbicide resistance mutations in Raphanus raphanistrum: Evaluation of pleiotropic effects on vegetative growth and ALS activity. Pest Manag. Sci. 2013, 69, 689–695. [Google Scholar] [CrossRef]
- Deng, W. The Resistance Mechanisms of Tribenuron-methyl Resistant Fixweed (Desurainia sophia L.) and Effects of Resistance-Endowing Mutations on ALS Functionality. Ph.D. Thesis, China Agricultural University, Beijing, China, 2017. [Google Scholar]
- Yu, Q.; Han, H.; Li, M.; Purba, E.; Walsh, M.J.; Powles, S.B. Resistance evaluation for herbicide resistance–endowing acetolactate synthase (ALS) gene mutations using Raphanus raphanistrum populations homozygous for specific ALS mutations. Weed Res. 2012, 52, 178–186. [Google Scholar] [CrossRef]
- Yang, Q.; Deng, W.; Wang, S.; Liu, H.; Li, X.; Zheng, M. Effects of resistance mutations of Pro197, Asp376 and Trp574 on the characteristics of acetohydroxyacid synthase (AHAS) isozymes. Pest Manag. Sci. 2018, 74, 1870–1879. [Google Scholar] [CrossRef]
- Ashigh, J.; Tardif, F.J. An Ala205Val substitution in acetohydroxyacid synthase of eastern black nightshade (Solanum ptychanthum) reduces sensitivity to herbicides and feedback inhibition. Weed Sci. 2007, 55, 558–565. [Google Scholar] [CrossRef]
- Ashigh, J.; Corbett, C.A.L.; Smith, P.J.; Laplante, J.; Tardif, F.J. Characterization and diagnostic tests of resistance to acetohydroxyacid synthase inhibitors due to an Asp376Glu substitution in Amaranthus powellii. Pestic. Biochem. Physiol. 2009, 95, 38–46. [Google Scholar] [CrossRef]
- Bansal, A.; Karanth, N.M.; Demeler, B.; Schindelin, H.; Sarma, S.P. Crystallographic Structures of IlvN·Val/Ile complexes: Conformational selectivity for feedback inhibition of Aceto Hydroxy Acid Synthases. Biochemistry 2019, 58, 1992–2008. [Google Scholar] [CrossRef] [PubMed]
Name | Collection Locations | Latitude | Longitude | Application Years |
---|---|---|---|---|
S | Shitouhezizhen, Shangzhishi | N44.8559722 | E128.6916972 | 0 |
R1 | Youyinongchang, Shuangyasha | N46.7815583 | E131.8107139 | 15 |
R2 | Meilisi, Qiqihaer | N47.3095000 | E123.7528111 | 18 |
R3 | Zhaoguangnongchang, Heihe | N50.2521000 | E127.5004806 | 17 |
R4 | Dongfanghongshuiku, Hailun | N47.6190306 | E127.1472167 | 20 |
R5 | Yanganxiang, Beian | N48.2414611 | E126.4910806 | 19 |
Primer | Sequence | Amplification Size (bp) | Mutation Sites |
---|---|---|---|
Forward 1 | CAATCATCCATTTACGCTAT | 782 | 122.197.205 |
Reverse 1 | AGACTCACCCACTAACCTTAC | ||
Forward 2 | GAGTCTAAGAGACCTGTGCT | 1111 | 376.377.574.653.654 |
Reverse 2 | GCTTCTCCTCTATAAGGATC |
Herbicides | Chemical Type | Rate (g.a.i.ha−1) | Rate Range of Dose (g.a.i. ha−1) | |
---|---|---|---|---|
S | R | |||
Nicosulfuron | SU | 60 | 0, 0.47, 0.94, 1.88, 3.75, 7.5, 15 | 0, 1.88, 3.75, 7.5, 15, 30, 60 |
Flumetsulam | TP | 30 | 0.94, 1.89, 3.75, 7.5, 15, 30 | 7.5, 15, 30, 60, 120, 240 |
Bispyribac-sodium | PTB | 27 | 1.69, 3.38, 6.75, 13.5, 27, 54 | 1.69, 3.38, 6.75, 13.5, 27, 54 |
Imazethapyr | IMI | 100.5 | 3.14, 6.28, 12.56, 25.13, 50.25, 100.5 | 25.13, 50.25, 100.5, 201, 402, 603 |
Flucarbazone-sodium | SCT | 31.5 | 0.98, 1.97, 3.94, 7.88, 15.75, 31.5 | 7.88, 15.75, 31.5, 63, 126, 252 |
Name | Mutation | GR50 (g.a.i.ha−1) | RI | Total ALS Activity (nmol Acetoin mg−1 Protein min−1) | I50 (μM) | RI |
---|---|---|---|---|---|---|
S | Wild type | 1.28 ± 0.18 c | 48.75 ± 1.47 d | 0.99 ± 0.34 | ||
R1 | Ala-205-Val | 23.18 ± 5.44 b | 18.11 | 52.38 ± 0.65 d | 12.31 ± 5.23 | 12.43 |
R2 | Asp-376-Glu | 21.98 ± 3.72 c | 17.17 | 63.41 ± 1.46 c | 24.70 ± 4.36 | 24.95 |
R3 | Trp-574-Leu | 40.55 ± 8.36 a | 31.70 | 151.29 ± 7.38 a | 42.83 ± 12.69 | 43.26 |
R4 | Ser-653-Thr | 24.96 ± 4.40 b | 19.50 | 110.56 ± 1.64 b | 32.62 ± 11.43 | 32.95 |
R5 | Ser-653-Asn | 22.44 ± 1.04 b | 17.53 | 109.22 ± 1.21 b | 24.35 ± 7.45 | 24.60 |
Name | Mutation | Vmax (nmol Acetoin mg−1 Protein min−1) | R/S | Km ± SE (mM) | R/S |
---|---|---|---|---|---|
R1 | Ala-205-Val | 117.91 ± 1.20 c | 0.20 | 0.0076 ± 0.0025 b | 0.03 |
R2 | Asp-376-Glu | 37.82 ± 1.62 e | 0.06 | 0.0767 ± 0.0174 b | 0.31 |
R3 | Trp-574-Leu | 301.84 ± 16.52 b | 0.52 | 0.1886 ± 0.0317 a | 0.85 |
R4 | Ser-653-Thr | 49.67 ± 5.80 e | 0.09 | 0.1795 ± 0.0534 a | 0.81 |
R5 | Ser-653-Asn | 78.92 ± 7.75 d | 0.14 | 0.203 ± 0.0318 a | 0.92 |
S | Wild type | 582.33 ± 23.26 a | 1.00 | 0.2216 ± 0.0244 a | 1.00 |
Name | Mutation | Binding Free Energy (kcal/mol) | Hydrogen Bonds |
---|---|---|---|
S | wild type | −1.68 | Asn-238, Asn-311 |
R1 | Ala-205-Val | −1.58 | Try-280, Glu-285, Lys-423 |
R2 | Asp-376-Glu | −1.53 | Arg-372, Arg-376 |
R3 | Trp-574-Leu | −0.37 | Gly-240 |
R4 | Ser-653-Thr | −1.38 | Gly-507, Gly-507 |
R5 | Ser-653-Asn | −1.14 | Ser-212, Ser-212 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Z.; Cong, J.; Cao, W.; Yuan, G.; Meng, Z.; Wang, S.; Li, C.; Teng, C. A205V, D376E, W574L, S653T, and S653N Substitutions in Acetohydroxy Acid Synthase from Amaranthus retroflexus L. Show Different Functional Impacts on Herbicide Resistance. Agronomy 2024, 14, 2148. https://doi.org/10.3390/agronomy14092148
Sun Z, Cong J, Cao W, Yuan G, Meng Z, Wang S, Li C, Teng C. A205V, D376E, W574L, S653T, and S653N Substitutions in Acetohydroxy Acid Synthase from Amaranthus retroflexus L. Show Different Functional Impacts on Herbicide Resistance. Agronomy. 2024; 14(9):2148. https://doi.org/10.3390/agronomy14092148
Chicago/Turabian StyleSun, Zhonghua, Jianan Cong, Wenli Cao, Guang Yuan, Zhen Meng, Shen Wang, Chunjie Li, and Chunhong Teng. 2024. "A205V, D376E, W574L, S653T, and S653N Substitutions in Acetohydroxy Acid Synthase from Amaranthus retroflexus L. Show Different Functional Impacts on Herbicide Resistance" Agronomy 14, no. 9: 2148. https://doi.org/10.3390/agronomy14092148
APA StyleSun, Z., Cong, J., Cao, W., Yuan, G., Meng, Z., Wang, S., Li, C., & Teng, C. (2024). A205V, D376E, W574L, S653T, and S653N Substitutions in Acetohydroxy Acid Synthase from Amaranthus retroflexus L. Show Different Functional Impacts on Herbicide Resistance. Agronomy, 14(9), 2148. https://doi.org/10.3390/agronomy14092148