Natural Variability of Genomic Sequences of Mal d 1 Allergen in Apples as Revealed by Restriction Profiles and Homolog Polymorphism
Abstract
1. Introduction
2. Materials and Methods
2.1. Biological Material and DNA Extraction
2.2. BBAP
2.3. RFLP
2.4. Data Processing
3. Results
3.1. BBAP Variability
3.2. RFPL Variability
3.3. Comparative Potential of BBAP and RFLP in Mal d 1 Length Variability Analysis in the Apple Germplasm
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Klongová, L.; Kováčik, A.; Urbanová, L.; Kyseľ, M.; Ivanišová, E.; Žiarovská, J. Utilization of specific primers in legume allergens based polymorphism screening. Sci. Technol. Innov. 2021, 13, 12–21. [Google Scholar] [CrossRef]
- Žiarovská, J.; Urbanová, L. Utilization of Bet v 1 homologs based amplified profile (BBAP) variability in allergenic plants fingerprinting. Biologia 2022, 77, 517–523. [Google Scholar] [CrossRef]
- Čerteková, S.; Kováčik, A.; Klongová, L.; Žiarovská, J. Utilization of plant profilins as DNA markers. Acta Fytotech. Zootech. 2023, 26, 324–331. [Google Scholar] [CrossRef]
- Žiarovská, J.; Zeleňáková, L. Application of genomic data for PCR screening of Bet v 1 conserved sequence in clinically relevant plant species. In Systems Biology; IntechOpen: London, UK, 2019; pp. 65–82. [Google Scholar]
- D’Amato, G.; Cecchi, L.; Bonini, S.; Nunes, C.; Annesi-Maesano, I.; Behrendt, H.; Liccardi, G.; Popov, T.; van Cauwenberge, P. Allergenic pollen and pollen allergy in Europe. Allergy 2007, 62, 976–990. [Google Scholar] [CrossRef] [PubMed]
- Eriksson, N.E.; Holmen, A. Skin prick tests with standardized extracts of inhalant allergens in 7099 adult patients with asthma or rhinitis: Cross-sensitizations and relationships to age, sex, month of birth and year of testing. J. Investig. Allergol. Clin. Immunol. 1996, 6, 36–46. [Google Scholar] [PubMed]
- Geroldinger-Simic, M.; Zelniker, T.; Aberer, W.; Ebner, C.; Egger, C.; Greiderer, A.; Prem, N.; Lidholm, J.; Ballmer-Weber, B.K.; Vieths, S.; et al. Birch pollen-related food allergy: Clinical aspects and the role of allergen-specific IgE and IgG4 antibodies. J. Allergy Clin. Immunol. 2011, 127, 616–622. [Google Scholar] [CrossRef]
- Loh, W.; Tang, M.L.K. The Epidemiology of Food Allergy in the Global Context. Int. J. Environ. Res. Public Health 2018, 15, 2043. [Google Scholar] [CrossRef]
- Vieths, S.; Scheurer, S.; Ballmer-Weber, B. Current understanding of crossreactivity of food allergens and pollen. Ann. N. Y. Acad. Sci. 2002, 964, 47–68. [Google Scholar] [CrossRef]
- Janick, J.; Moore, J.N. (Eds.) Fruit Breeding, Tree and Tropical Fruits; John Wiley & Sons: New York, NY, USA, 1996; pp. 1–77. ISBN 978-0-471-31014-3. [Google Scholar]
- Eberhardt, M.V.; Lee, C.Y.; Liu, R.H. Antioxidant activity of fresh apples. Nature 2000, 405, 903–904. [Google Scholar] [CrossRef]
- Wolfe, K.L.; Liu, R.H. Apple peel as a value-added food ingredient. J. Agr. Food Chem. 2003, 51, 1676–1683. [Google Scholar] [CrossRef]
- Can, Z.; Dincer, B.; Sahin, H.; Baltas, N.; Yildiz, O.; Kolayli, S. Polyphenol oxidase activity and antioxidant properties of Yomra apple (Malus communis L.) from Turkey. J. Enzyme. Inhib. Med. Chem. 2014, 29, 829–835. [Google Scholar] [CrossRef] [PubMed]
- Pagliarani, G.; Paris, R.; Iorio, A.R.; Tartarini, S.; Del Duca, S.; Arens, P.; Peters, S.; Van der Weg, E. Genomic organisation of the Mal d 1 gene cluster on linkage group 16 in apple. Mol. Breed. 2012, 29, 759–778. [Google Scholar] [CrossRef]
- Gao, Z.S.; van de Weg, W.E.; Schaart, J.G.; Schouten, H.J.; Tran, D.H.; Kodde, L.P.; van der Meer, I.M.; van der Geest, A.H.M.; Kodde, J.; Breiteneder, H.; et al. Genomic cloning and linkage mapping of the Mal d 1 (PR-10) gene family in apple (Malus domestica). Theor. Appl. Genet. 2005, 111, 171–183. [Google Scholar] [CrossRef]
- Gao, Z.S.; Van de Weg, W.E.; Matos, C.I.; Arens, P.; Bolhaar, S.T.H.P.; Knulst, A.C.; Li, Y.; Hoffmann-Sommergruber, K.; Gilissen, L.J. Assessment of allelic diversity in intron-containing Mal d 1 genes and their association to apple allergenicity. BMC Plant Biol. 2008, 8, 128. [Google Scholar] [CrossRef] [PubMed]
- Son, D.Y.; Scheurer, S.; Hoffman, A.; Haustein, D.; Vieths, S. Pollen-related food allergy: Cloning and immunological analysis of isoforms and mutants of Mal d 1, the major apple allergen, and Bet v 1, the major birch pollen allergen. Eur. J. Nutr. 1999, 38, 201–215. [Google Scholar] [CrossRef]
- Ma, Y.; Gadermaier, G.; Bohle, B.; Bolhaar, S.; Knulst, A.; Markovic-Housley, Z.; Breiteneder, H.; Briza, P.; Hoffmann-Sommergruber, K.; Ferreira, F. Mutational analysis of amino acid positions crucial for IgE binding epitopes of the major apple (Malus domestica) allergen, Mal d 1. Int. Arch. Allergy Immunol. 2006, 139, 53–62. [Google Scholar] [CrossRef]
- Holm, J.; Ferreras, M.; Ipsen, H.; Würtzen, P.A.; Gajhede, M.; Larsen, J.N.; Lund, K.; Spangfort, M.D. Epitope grafting, re-creating a conformational Bet v 1 antibody epitope on the surface of the homologous apple allergen Mal d 1. J. Biol. Chem. 2011, 286, 17569–17578. [Google Scholar] [CrossRef]
- Žiarovská, J.; Bilčíková, J.; Fialková, V.; Zeleňáková, L.; Zamiešková, L. Restriction polymorphism of Mal d 1 allergen promotor in apple varieties. J. Microbiol. Biotechnol. Food Sci. 2019, 8, 1217–1219. [Google Scholar] [CrossRef]
- Fernandes, H.; Michalska, K.; Sikorski, M.; Jaskolski, M. Structural and functional aspects of PR-10 proteins. FEBS J. 2013, 280, 1169–1199. [Google Scholar] [CrossRef]
- Seutter von Loetzen, C.; Hoffmann, T.; Hartl, M.J.; Schweimer, K.; Schwab, W.; Rösch, P.; Hartl-Spiegelhauer, O. Secret of the major birch pollen allergen Bet v 1: Identification of the physiological ligand. Biochem. J. 2012, 457, 379–390. [Google Scholar] [CrossRef]
- Mirza, O.; Henriksen, A.; Ipsen, H.; Larsen, J.N.; Wissenbach, M.; Spangfort, M.D.; Gajhede, M. Dominant epitopes and allergic cross-reactivity: Complex formation between a Fab fragment of a monoclonal murine IgG antibody and the major allergen from birch pollen Bet v 1. J. Immunol. 2000, 165, 331–338. [Google Scholar] [CrossRef]
- Spangfort, M.D.; Mirza, O.; Ipsen, H.; van Neerven, R.J.J.; Gajhede, M.; Larsen, J.N. Dominating IgE-binding epitope of Bet v 1, the major allergen of birch pollen, characterized by X-ray crystallography and site-directed mutagenesis. J. Immunol. 2003, 171, 3084–3090. [Google Scholar] [CrossRef] [PubMed]
- Neudecker, P.; Schweimer, K.; Nerkamp, J.; Scheurer, S.; Vieths, S.; Sticht, H.; Rösch, P. Allergic cross-reactivity made visible. Solution structure of the major cherry allergen Pru av 1. J. Biol. Chem. 2001, 276, 22756–22763. [Google Scholar] [CrossRef] [PubMed]
- Neudecker, P.; Lehmann, K.; Nerkamp, J.; Haase, T.; Wangorsch, A.; Fötisch, K.; Hoffmann, S.; Rösch, P.; Vieths, S.; Scheurer, S. Mutational epitope analysis of Pru av 1 and Api g 1, the major allergens of cherry (Prunus avium) and celery (Apium graveolens): Correlating IgE reactivity with three-dimensional structure. Biochem. J. 2003, 376, 97–107. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 12 June 2024).
- Marconi, G.; Ferradini, N.; Russi, L.; Concezzi, L.; Veronesi, F.; Albertini, E. Genetic Characterization of the Apple Germplasm Collection in Central Italy: The Value of Local Varieties. Front. Plant Sci. 2018, 9, 1460. [Google Scholar] [CrossRef]
- Omasheva, M.Y.; Flachowsky, H.; Ryabushkina, N.A.; Pozharskyi, A.S.; Galiakparov, N.N.; Hanke, M.V. To what extent do wild apples in Kazakhstan retain their genetic integrity? Tree Genet Genom 2017, 13, 52. [Google Scholar] [CrossRef]
- Gross, B.L.; Henk, A.D.; Richards, C.M.; Fazio, G.; Volk, G.M. Genetic Diversity in Malus ×domestica (Rosaceae) through Time in Response to Domestication. Am. J. Bot. 2014, 101, 1770–1779. [Google Scholar] [CrossRef] [PubMed]
- Bilčíková, J.; Farkasová, S.; Žiarovská, J. Genetic variability of commercially important apple varieties (Malus × domestica Borkh.) assessed by CDDP markers. Acta Fytotechn. Zootech. 2021, 24, 21–26. [Google Scholar]
- Kikuchi, T.; Kasajima, I.; Morita, M.; Yoshikawa, N. Practical DNA markers to Estimate Apple (Malus × domestica Borkh.) Skin Color, Ethylene Production and Pathogen Resistance. J. Hortic. 2017, 4, 1000211. [Google Scholar] [CrossRef]
- Breiteneder, H.; Ebner, C. Molecular and biochemical classification of plant-derived food allergens. J. Allergy Clin. Immunol. 2000, 106, 27–36. [Google Scholar] [CrossRef]
- Uehara, M.; Sato, K.; Abe, Y.; Katagiri, M. Sequential IgE epitope analysis of a birch pollen allergen (Bet v1) and an apple allergen (Mal d1). Allergol. Int. 2001, 50, 57–62. [Google Scholar] [CrossRef]
- Urbanová, L.; Žiarovská, J. Variability of DNA based amplicon profiles generated by Bet v 1 homologous among different vegetable species. Acta Fytotechn. Zootech. 2021, 24, 1–6. [Google Scholar]
- Moravčíková, D.; Žiarovská, J. Variability of Genomic Profile of ypr-10 gene in Citrus sinensis L. Osbeck. Biol. Life Sci. Forum 2024, 30, 2. [Google Scholar]
- Freitas, L.B.; Bonatto, S.L.; Salzano, F.M. Evolutionary implications of infra-and interspecific molecular variability of pathogenesis-related proteins. Braz. J. Biol. 2003, 63, 437–448. [Google Scholar] [CrossRef]
- Tignon, M.; Lateur, M.; Kettmann, R.; Watillon, B. Distinction between closely related apple cultivars of the Belle-fleur family using RFLP and AFLP markers. Acta Hortic. 2001, 546, 509–513. [Google Scholar] [CrossRef]
- Speváková, I.; Urbanová, L.; Kyseľ, M.; Bilčíková, J.; Farkasová, S.; Žiarovská, J. BBAP amplification profiles of apple varieties. Sci. Technol. Innov. 2021, 13, 1–6. [Google Scholar] [CrossRef]
- Pühringer, H.M.; Zinoecker, I.; Marzban, G.; Katinger, H.; Laimer, M. MdAP, a novel protein in apple, is associated with the major allergen Mal d 1. Gene 2003, 321, 173–183. [Google Scholar] [CrossRef]
- Bolhaar, S.T.; Van de Weg, W.E.; Van Re, R.; Gonzalez-Mancebo, E.; Zuidmeer, L.; Bruijnzeel-Koomen, C.A.; Fernandez-Rivas, M.; Jansen, J.; Hoffmann-Sommergruber, K.; Knulst, A.C.; et al. In vivo assessment with prick-to-prick testing and double-blind, placebo-controlled food challenge of allergenicity of apple cultivars. J. Allergy Clin. Immunol. 2005, 116, 1080–1086. [Google Scholar] [CrossRef] [PubMed]
- Koostra, H.S.; Vlieg-Boerstra, B.J.; Dubois, A.E.J. Assessment of the reduced properties of the Santana apple. Ann. Allergy Asthma Immunol. 2007, 99, 522–525. [Google Scholar] [CrossRef]
- Gardiner, S.E.; Bassett, H.C.M.; Madie, C.; Noiton, D.A.M. Isozyme, Randomly Amplified Polymorphic DNA (RAPD), and Restriction Fragment-length Polymorphism (RFLP) Markers Used to Deduce a Putative Parent for the ‘Braeburn’ Apple. JASHS 1996, 121, 996–1001. [Google Scholar] [CrossRef]
- Forte, A.V.; Ignatov, A.N.; Ponomarenko, V.V.; Dorokhov, D.B.; Savelyev, N.I. Phylogeny of the Malus (Apple Tree) Species, Inferred from the Morphological Traits and Molecular DNA Analysis. Russ. J. Genet. 2002, 38, 1150–1160. [Google Scholar] [CrossRef]
- Asero, R.; Marzban, G.; Martinelli, A.; Zaccarini, M.; Laimer da Camara Machado, M. Search for low allergenic apple cultivars for birch pollen allergic patients: Is there a correlation between in vitro assays and patient response? Eur. Ann. Allergy Clin. Immunol. 2006, 38, 94–98. [Google Scholar] [PubMed]
- Sancho, A.I.; Foxall, R.; Browne, T.; Dey, R.; Zuidmeer, L.; Marzban, G.; Waldron, K.W.; van Ree, R.; Hoffmann-Sommergruber, K.; Laimer, M.; et al. Effect of postharvest storage on the expression of the apple allergen Mal d 1. J. Agricul. Food Chem. 2006, 54, 5917–5923. [Google Scholar] [CrossRef] [PubMed]







| Sample Number | Apple Variety | Sample Number | Apple Variety | Sample Number | Apple Variety | Sample Number | Apple Variety |
|---|---|---|---|---|---|---|---|
| 1 | Santana | 19 | Tabor | 37 | Rozela | 55 | Hael 616 |
| 2 | Spencer | 20 | Sonet | 38 | Melrose | 56 | Orion |
| 3 | Primadela | 21 | Parkerovo | 39 | Fiesta | 57 | Maj Gold |
| 4 | Ecolette | 22 | Jantár | 40 | HL 782 | 58 | Sirius |
| 5 | Akame | 23 | Rubigold | 41 | Delor | 59 | Paula Red |
| 6 | Karneval | 24 | Topaz | 42 | Spigold | 60 | Dulcit |
| 7 | Waltz | 25 | Ligol | 43 | Rucla | 61 | Harmony |
| 8 | Winesap | 26 | Pocomoke | 44 | Heliodor | 62 | Pinova |
| 9 | Čistecké lahôdkové | 27 | Shalimar | 45 | Stela | 63 | Sentima |
| 10 | Melrose 24628 | 28 | Florina | 46 | RubinStep | 64 | Mutsu |
| 11 | Selena | 29 | Rezistent | 47 | Aneta | 65 | Viktory |
| 12 | Lotos | 30 | Bolero | 48 | Jonagold Decosta | 66 | Lipno |
| 13 | Produkta | 31 | Ligol | 49 | Delbarestivale | 67 | Pikant |
| 14 | Jonalord | 32 | Alkmene | 50 | Goldstar | 68 | Fanny |
| 15 | Angold | 33 | Bohemia | 51 | Blanik | 69 | Admiral |
| 16 | Rezistent Opal | 34 | Dalila | 52 | HL 189 | 70 | Freyberg |
| 17 | Kamzi | 35 | Linda | 53 | Rajka | 71 | Kristian |
| 18 | Meteor | 36 | Alkmene | 54 | Biogolden |
| Amplicon | Primers | Position | Length |
|---|---|---|---|
| Mal d 1–part 1 | F: 5′GCTCGATCACGATAAACTAAGG 3′ R: 5′ATGAGGATGGGGTGTTGAAG 3′ | nt 3–522 | 520 bp |
| Mal d 1–part 2 | F: 5′ACATCCAGTACCGGGGATGA 3′ R: 5′GGGTGCAATCTTGGGGATGA 3′ | nt 833–1470 | 638 bp |
| Mal d 1–part 3 | F: 5′GATGCTTTGACAGACACCATTG 3′ R: 5′TTTCAAACAAATACATAAAGGGCAAC3′ | nt 1801–2190 | 390 bp |
| Restriction Enzyme | Cutting Site | Part of Mal d 1 Sequence |
|---|---|---|
| AseI | AT↓TA↑AT | part 1, 2, 3 |
| NcoI | C↓CATG↑G | part 3 |
| NlaIII | ↑CATG↓ | part 2 |
| SpeI | A↓CTAG↑T | part 1 |
| Group | Variety |
|---|---|
| I. | Santana, Spencer, Primadela, Ecolette, Produkta, Rezistent Opal, Meteor, Sonet, Jantar, Rezistent, Bolero, Fiesta, Rucla, Heliodor, Rajka, Dulcit, Harmony, Sentima, Admiral |
| II. | Akame, Karneval, Waltz, Winesap, Melrose 24628, Selena, Lotos, Tabor, Parkerovo, Rubigold, Topaz, Pocomoke, Shalimar, Florina, Ligol, Alkmene, Bohemia, Dalila, Linda, Rozela, Melrose, HL 782, Delor, Spigold, Stela, Delbarestivale, Orion, Maigold, Sirius, Paula Red, Lipno, Pikant, Fanny, Freyberg, Kristian |
| III. | Čistecké lahôdkové, Kamzi, Rubinstep, Aneta, Jonagold Decosta, Goldstar, Blanik, HL 189, Biogolden, Hael 616, Pinova |
| IV. | Jonalord, Angold, Mutsu, Viktory |
| Group | Variety | Similarity in % |
|---|---|---|
| Group A | Topaz, Stela | ~50 |
| Group B | Dalila, Rozela, Melrose | 60–70 |
| Group C | Akame, Orion, Waltz, Selena, Tabor | 60–80 |
| Group D | Čistecké lahôdkové, Hael 616 | ~60 |
| Group E | Maigold, Sirius, Lipno, Pikant | 50–65 |
| Group F | HL 782, Linda | ~75 |
| Group G | Bohemia, Florina | ~55 |
| Group H | Spencer, Ecolette, Sonet | 50–55 |
| Group I | Rubigold, Pocomoke, Karneval | 50–55 |
| Group J | Harmony, Sentima | ~45 |
| Group K | Jantar, Heliodor | ~30 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Urbanová, L.; Bilčíková, J.; Moravčíková, D.; Žiarovská, J. Natural Variability of Genomic Sequences of Mal d 1 Allergen in Apples as Revealed by Restriction Profiles and Homolog Polymorphism. Agronomy 2024, 14, 2056. https://doi.org/10.3390/agronomy14092056
Urbanová L, Bilčíková J, Moravčíková D, Žiarovská J. Natural Variability of Genomic Sequences of Mal d 1 Allergen in Apples as Revealed by Restriction Profiles and Homolog Polymorphism. Agronomy. 2024; 14(9):2056. https://doi.org/10.3390/agronomy14092056
Chicago/Turabian StyleUrbanová, Lucia, Jana Bilčíková, Dagmar Moravčíková, and Jana Žiarovská. 2024. "Natural Variability of Genomic Sequences of Mal d 1 Allergen in Apples as Revealed by Restriction Profiles and Homolog Polymorphism" Agronomy 14, no. 9: 2056. https://doi.org/10.3390/agronomy14092056
APA StyleUrbanová, L., Bilčíková, J., Moravčíková, D., & Žiarovská, J. (2024). Natural Variability of Genomic Sequences of Mal d 1 Allergen in Apples as Revealed by Restriction Profiles and Homolog Polymorphism. Agronomy, 14(9), 2056. https://doi.org/10.3390/agronomy14092056

