Effect of Three Novel Thiazolidiones on the Development, Reproduction, and Trehalase Activity of Spodoptera frugiperda (Lepidoptera: Noctuidae)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Insect Sources and Feeding Methods
2.2. Microinjection of Larvae and Female Pupae
2.3. Determination of Trehalase and Chitinase Activity
2.4. Developmental and Morphological Analysis of S. frugiperda and Data Analysis
2.5. Gene Expression Detection
2.6. Evaluation of Reproductive Capacity of S. frugiperda
3. Results
3.1. Survival, Deformity, and Morphological Abnormalities after New Compound Injections
3.2. Changes in Trehalase Activity and Related Gene Expression Levels in Samples Treated with Thiothiazolidone Compounds
3.3. Changes in Chitinase Activity and Chitin Content in Samples Treated with the New Compounds
3.4. Changes in the Trehalase Activity and Sugar Content of Pupae
3.5. Effect of Injection of Novel Compounds on Adult Female Emergence
3.6. Effects of Injecting New Compounds on the Lifespan, Pre-Oviposition, and Oviposition Periods of Female Adults
3.7. Effect of Injection of Novel Compounds on Egg Laying and Egg Hatching
3.8. Effects of Injection of Novel Compounds on Ovarian Development and SfVg and SfVgR Gene Expression in Female Adults
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sparks, A.N. A review of the biology of the fall armyworm. Fla. Entomol. 1979, 62, 82. [Google Scholar] [CrossRef]
- Kenis, M.; Benelli, G.; Biondi, A.; Calatayud, P.-A.; Day, R.; Desneux, N.; Harrison, R.D.; Kriticos, D.; Rwomushana, I.; van den Berg, J.; et al. Invasiveness, biology, ecology, and management of the fall armyworm, Spodoptera frugiperda. Entomol. Gen. 2023, 43, 187–241. [Google Scholar] [CrossRef]
- Tay, W.T.; Meagher, R.L.; Czepak, C.; Groot, A.T. Spodoptera frugiperda: Ecology, evolution, and management options of an invasive species. Annu. Rev. Entomol. 2023, 68, 299–317. [Google Scholar] [CrossRef]
- Guo, J.F.; He, K.L.; Wang, Z.Y. Biological characteristics, trend of fall armyworm Spodoptera frugiperda, and the strategy for management of the pest. Chin. J. Appl. Entomol. 2019, 56, 361–369. [Google Scholar]
- Wang, P.; He, P.C.; Hu, L.; Chi, X.L.; Keller, M.A.; Chu, D. Host selection and adaptation of the invasive pest Spodoptera frugiperda to indica and japonica rice cultivars. Entomol. Gen. 2022, 42, 403–411. [Google Scholar] [CrossRef]
- Hou, Y.Y.; Ma, Y.; Xu, W.; Desneux, N.; Nkunika, P.O.Y.; Bao, H.P.; Zang, L.S. Spodoptera frugiperda egg mass scale thickness modulates Trichogramma parasitoid performance. Entomol. Gen. 2022, 42, 589–596. [Google Scholar] [CrossRef]
- Liu, B.; Lu, Y.Y.; Wan, F.H.; Gershenzon, J.; Cheng, D.F. Biological invasion of insects:the roles of microbes. Entomol. Gen. 2022, 42, 851–861. [Google Scholar] [CrossRef]
- Li, T.H.; Wang, S.; Ramirez-Romero, R.; Zang, L.S. Protective scale variation on Spodoptera egg masses can potentially support the cost-effective use of Trichogramma parasitoids. Entomol. Gen. 2023, 43, 939–944. [Google Scholar] [CrossRef]
- Jia, Z.Q.; Zhan, E.L.; Zhang, S.G.; Wang, Y.; Song, P.P.; Jones, A.K.; Han, Z.J.; Zhao, C.Q. Broflanilide prolongs the development of fall armyworm Spodoptera frugiperda by regulating biosynthesis of juvenile hormone. Entomol. Gen. 2022, 42, 761–769. [Google Scholar] [CrossRef]
- Wang, H.H.; Zhao, R.; Zhang, S.; Gao, J.; Xiao, X.; Tian, X.Y.; Liang, P.; Gu, S.H. Monitoring broflanilide resistance and its synergism with metaflumizone and tetraniliprole against fall armyworm, Spodoptera frugiperda. Entomol. Gen. 2023, 43, 535–543. [Google Scholar] [CrossRef]
- Wang, L.; Chen, K.W.; Zhong, G.H.; Xian, J.D.; He, X.F.; Lu, Y.Y. Progress for occurrence and management and strategy of the fall armyworm Spodoptera frugiperda (Smith.). J. Environ. Entomol. 2019, 41, 479–487. [Google Scholar]
- Wu, K.M. Management strategies of fall armyworm (Spodoptera frugiperda) in China. J. Plant Protcet 2020, 46, 1–5. [Google Scholar] [CrossRef]
- Paredes-Sánchez, F.A.; Rivera, G.; Bocanegra-García, V.; Martínez-Padrón, H.Y.; Berrones-Morales, M.; Niño-García, N.; Herrera-Mayorga, V. Advances in control strategies against Spodoptera frugiperda. Rev. Mol. 2021, 26, 5587. [Google Scholar] [CrossRef] [PubMed]
- Pavela, R.; Guedes, R.N.C.; Maggi, F.; Desneux, N.; Benelli, G. Essential oil antifeedants against armyworms: Promises and challenges. Entomol. Gen. 2023, 43, 689–704. [Google Scholar] [CrossRef]
- Li, Y.P.; Zhang, S.; Wang, X.J.; Xie, X.P.; Liang, P.; Zhang, L.; Gu, S.H.; Gao, X.W. Current status of insecticide resistance in Spodoptera frugiperda and strategies for its chemical control. J. Plant Prot. 2019, 45, 14–19. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Cheng, W.; Chang, W.C.; Chen, X. Current status of registration and application of pesticides for controlling Spodoptera frugipterda in the United States(I): Conventional pesticides. J. World Pestic. 2021, 43, 18–24+37. [Google Scholar] [CrossRef]
- Xu, G.L.; Wang, Z.Y.; Wang, K.; Shu, C.l.; Geng, L.L.; Liao, M.; Zhang, J. Advances in research and application of Bacillus thuritngiensis for controlling Spodoptera frugiperda. Chin. J. Biol. Control, 2023; Published online ahead. [Google Scholar] [CrossRef]
- Desneux, N.; Decourtye, A.; Delpuech, J.M. The sublethal effects of pesticides on beneficial arthropods. Annu. Rev. Entomol. 2007, 52, 81–106. [Google Scholar] [CrossRef] [PubMed]
- Haddi, K.; Nauen, R.; Benelli, G.; Guedes, R.N.C. Global perspectives on insecticide resistance in agriculture and public health. Entomol. Gen. 2023, 43, 495–500. [Google Scholar] [CrossRef]
- Li, J.J.; Xu, H.M.; Zhao, H.Z.; Pan, M.Z.; Smagghe, G.; Li, Z.Y.; Liu, T.X.; Shi, Y. Regulating role of neuropeptide PTTH releaved in Spodoptera frugiperda using RNAi- and CRISPR/Cas9-based functional genomic tools. Entomol. Gen. 2023, 43, 451–459. [Google Scholar] [CrossRef]
- Yan, S.; Yin, M.Z.; Shen, J. Nanoparticle-based nontransformative RNA insecticides for sustainable pest control: Mechanisms, current status and challenges. Entomol. Gen. 2023, 43, 21–30. [Google Scholar] [CrossRef]
- Chao, Z.J.; Ma, Z.Z.; Zhang, Y.H.; Yan, S.; Shen, J. Establishment of star polycation-based RNA interference system in all developmental stages of fall armyworm Spodoptera frugiperda. Entomol. Gen. 2023, 43, 127–137. [Google Scholar] [CrossRef]
- Elbein, A.D.; Pan, Y.T.; Pastuszak, I.; Carroll, D. New insights on trehalose: A multifunctional molecule. J. Glycobiol. 2003, 13, 17R–27R. [Google Scholar] [CrossRef]
- Arguelles, J.C. Why can’t vertebrates synthesize trehalose? J. Mol. Evol. 2014, 79, 111–116. [Google Scholar] [CrossRef]
- Tang, B.; Zhang, L.; Xiong, X.P.; Wang, H.J.; Wang, S.G. Advances in trehalose metabolism and its regulation of insect chitin synthesis. J. Sci. Agricul. Sin. 2018, 51, 697–707. [Google Scholar] [CrossRef]
- Luo, Y.J.; Chen, Y.; Wang, X.J.; Wang, S.T.; Yang, Y.Y.; Xu, H.X.; Qu, C.; Wu, Y.; Li, C.; Wang, S.G.; et al. Validamycin affects the development and chitin metabolism in Spodoptera frugiperda by inhibiting trehalase activity. Entomol. Gen. 2022, 42, 931–939. [Google Scholar] [CrossRef]
- Matassini, C.; Parmeggiani, C.; Cardona, F. New frontiers on human safe insecticides and fungicides: An opinion on trehalase inhibitors. J. Mol. 2020, 25, 3013. [Google Scholar] [CrossRef]
- Anholt, R.R.H.; O‘Grady, P.; Wolfner, M.F.; Harbison, S.T. Evolution of reproductive behavior. J. Genet. 2020, 214, 49–73. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.T.; Chen, Y.; Luo, Y.J.; Yang, Y.Y.; Jiang, Z.Y.; Jiang, X.Y.; Zhong, F.; Chen, H.; Xu, H.X.; Wu, Y.; et al. Effect of three novel compounds on trehalose and chitir metabolism and development of Spodoptera frugiperda. J. Sci. Agricul. Sin. 2022, 55, 1568–1578. [Google Scholar] [CrossRef]
- Zhong, F.; Yu, L.H.; Jiang, X.Y.; Chen, Y.; Wang, S.; Chao, L.; Jiang, Z.Y.; He, B.E.; Xu, C.; Wang, S.G.; et al. Potential inhibitory effects of compounds ZK-PI-5 and ZK-PI-9 on trehalose and chitin metabolism in Spodoptera frugiperda (J. E. Smith). Front. Physiol. 2023, 14, 1178996. [Google Scholar] [CrossRef]
- Jiang, X.Y.; Zhong, F.; Chen, Y.; Shi, D.M.; Chao, L.; Yu, L.H.; He, B.E.; Xu, C.D.; Wu, Y.; Tang, B.; et al. Novel compounds ZK-PI-5 and ZK-PI-9 regulate the reproduction of Spodoptera frugiperda (Lepidoptera: Noctuidae), with insecticide potential. J. Econ. Entomol. 2023, 116, 1850–1861. [Google Scholar] [CrossRef]
- Asano, N.; Kato, A.; Kizu, H.; Matsui, K.; Watson, A.A.; Nash, R.J. Calystegine B4, a novel trehalase inhibitor from Scopolia japonica. J. Carbohydr. Res. 1996, 293, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Forcella, M.; Cardona, F.; Goti, A.; Parmeggiani, C.; Cipolla, L.; Gregori, M.; Schirone, R.; Fusi, P.; Parenti, P. A membrane-bound trehalase from Chironomus riparius larvae: Purification and sensivity to inhibition. J. Glycobiol. 2010, 20, 1186–1195. [Google Scholar] [CrossRef]
- Li, Y.X.; Wang, J.Z.; Kato, A.; Shimadate, Y.; Kise, M.; Jia, Y.M.; Fleet, G.W.J.; Yu, C.Y. Stereocomplementary synthesis of casuarine and its 6-epi-, 7-epi-, and 6,7-diepi-stereoisomers. Org. Biomol. Chem. 2021, 19, 9410–9420. [Google Scholar] [CrossRef] [PubMed]
- Chavarria, D.; Silva, T.; Magalhães e Silva, D.; Remião, F.; Borges, F. Lessons from black pepper: Piperine and derivatives thereof. J. Expert. Opin. Ther. Pat. 2016, 26, 245–264. [Google Scholar] [CrossRef] [PubMed]
- Han, Q.; Wu, N.; Li, H.L.; Zhang, J.Y.; Li, X.; Deng, M.F.; Zhu, K.; Wang, J.E.; Duan, H.X.; Yang, Q. A piperine-based scaffold as a novel starting point to develop inhibitors against the potent molecular target OfChtI. J. Agric. Food Chem. 2021, 69, 7534–7544. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.Y.; Shi, D.M.; Li, H.L.; He, D.C.; Zhu, K.; Li, J.Y.; Zi, Y.J.; Xu, Z.J.; Huang, J.X.; Duan, H.X.; et al. Rational design and identification of novel piperine derivatives as multichitinase inhibitors. J. Agric. Food Chem. 2022, 70, 10326–10336. [Google Scholar] [CrossRef]
- Inamori, Y.; Okamoto, Y.; Takegawa, Y.; Tsujibo, H.; Sakagami, Y.; Kumeda, Y.; Shibata, M.; Numata, A. Insecticidal and antifungal activities of aminorhodanine derivatives. J. Biosci. Biotechnol. Biochem. 1998, 62, 1025–1027. [Google Scholar] [CrossRef]
- Pareek, D.; Chaudhary, M.; Pareek, P.K.; Kant, R.; Ojha, K.G.; Pareek, R.; Iraqia, S.M.U.; Pareek, A. Synthesis of some bioactive 4-thiazolidinone derivatives incorporating benzothiazole moiety. Der Chem. Sin. 2010, 1, 22–35. [Google Scholar]
- Yang, H.B.; Liu, T.; Qi, H.T.; Huang, Z.S.; Hao, Z.S.; Ying, J.W.; Yang, Q.; Jian, X.H. Design and synthesis of thiazolylhydrazone derivatives as inhibitors of chitinolytic N-acetyl-βd-hexosaminidase. J. Bioorg. Med. Chem. 2018, 26, 5420–5426. [Google Scholar] [CrossRef]
- Yang, H.; Qi, H.; Hao, Z.; Shao, X.; Liu, T.; Yang, Q.; Qian, X. Thiazolylhydrazone dervatives as inhibitors for insect N-acetyl-β-d-hexosaminidase and chitinase. J. Chin. Chem. Lett. 2020, 31, 1271–1275. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.Y.; Yang, X.M.; He, W.; Zhang, H.W.; Jiang, Y.Y.; Wu, K.M. Ovarian development gradation and reproduction potential prediction in Spodoptera frugiperda. Plant Prot. 2019, 45, 28–34. [Google Scholar] [CrossRef]
- Zheng, X.; Yuan, J.; Qian, K.; Tang, Y.; Wang, J.; Zhang, Y.; Feng, J.; Cao, H.; Xu, B.; Zhang, Y.; et al. Identification and RNAi-based function analysis of trehalase family genes in Frankliniella occidentalis (Pergande). Pest. Manag. Sci. 2024, 80, 2839–2850. [Google Scholar] [CrossRef] [PubMed]
- Moussian, B. Chitin: Structure, chemistry and biology. J. Adv. Exp. Med. Biol. 2019, 1142, 5–18. [Google Scholar] [CrossRef]
- Bouchebti, S.; Cohen, T.M.; Bodner, L.; Levin, E. Chitin digestion in a eusocial insect: The digestive role of larvae in hornet colonies. Entomol. Gen. 2023, 43, 491–494. [Google Scholar] [CrossRef]
- Tellis, M.B.; Mohite, S.D.; Nair, V.S.; Chaudhari, B.Y.; Ahmed, S.; Kotkar, H.M.; Joshi, R.S. Inhibition of trehalose synthesis in lepidoptera reduces larval fitness. Adv. Biol. 2023, 8, e2300404. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Gu, F.; Zhou, W.; Li, P.; Wu, F.; Sheng, S. Parasitoid wasps can manipulate host trehalase to the benefit of their offspring. Insects 2022, 13, 833. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.; Shu, Y.; Zhou, J.; Zhang, X.; Zhang, X.; Chen, M.; Yao, Q.; Zhou, Q.; Zhang, W. Molecular characterization and RNA interference analysis of vitellogenin receptor from Nilaparvata lugens (Stal). J. Insect Physiol. 2015, 73, 20–29. [Google Scholar] [CrossRef] [PubMed]
- Barbole, R.S.; Sharma, S.; Patil, Y.; Giri, A.P.; Joshi, R.S. Chitinase inhibition induces transcriptional dysregulation altering ecdysteroid-mediated control of Spodoptera frugiperda development. iScience 2024, 27, 109280. [Google Scholar] [CrossRef]
- Yang, Y.J.; Guo, J.W.; Qian, J.N.; Xu, H.X.; Lv, Z.X. Comparison of the morphological characteristics of Spodcoptera frugiperda pupae with those of five other lepidopteran pest species. Chin. J. Appl. Entomol. 2022, 59, 559–567. [Google Scholar] [CrossRef]
- Han, S.; Wang, D.; Song, P.; Zhang, S.; He, Y. Molecular characterization of vitellogenin and its receptor in Spodoptera frugiperda (J. E. Smith, 1797), and their function in reproduction of female. Int. J. Mol. Sci 2022, 23, 11972. [Google Scholar] [CrossRef] [PubMed]
- Li, J.P.; Deng, H.; Tan, Y.M.; Zheng, T.Y.; Ouyang, X.H. Research progress of insect vitellogenin. J. Biotechnol. 2022, 32, 114–119. [Google Scholar] [CrossRef]
- Yan, X.; Yang, H.; Song, J.H.; Li, R.G.; Zhang, Y.B.; Yang, W.J. Function of vitellogenin receptor gene TaVgR in the regulation of reproductive development in Tuta absoluta (Lepidoptera: Ge lechiidae). J. Acta Entomol. Sin. 2022, 65, 675–683. [Google Scholar] [CrossRef]
- Huang, J.H.; Lee, H.J. RNA interference unveils functions of the hypertrehalosemic horm one on cyclic fluctuation of hemolymph trehalose and oviposition in the virgin female Blattella germanica. J. Insect Physiol. 2011, 57, 858–864. [Google Scholar] [CrossRef] [PubMed]
- Cong, L.; Yang, W.J.; Jiang, X.Z.; Niu, J.Z.; Shen, G.M.; Ran, C.; Wang, J.J. The essential role of vitellogenin receptor in ovary development and vitellogenin uptake in Bactrocera dorsalis (Hendel). Int. J. Mol. Sci. 2015, 16, 18368–18383. [Google Scholar] [CrossRef]
- Yu, H.Z.; Zhang, Q.; Lu, Z.J.; Deng, M.J. Validamycin treatment significantly inhibits the glycometabolism and chitin synthesis in the common cutworm, Spodoptera litura. J. Insect Sci. 2022, 29, 840–854. [Google Scholar] [CrossRef]
- Adrangi, S.; Faramarzi, M.A. From bacteria to human: A journey into the world of chitinases. Biotechnol. 2013, 31, 1786–1795. [Google Scholar] [CrossRef]
- Qu, M.B.; Sun, S.P.; Liu, Y.S.; Deng, X.R.; Yang, J.; Yang, Q. Insect group II chitinase Of ChtII promotes chitin degradation during larva-pupa molting. Insect Sci. 2021, 28, 692–704. [Google Scholar] [CrossRef]
- Zeng, Q.H.; Gong, M.F.; Yang, H.; Chen, N.N.; Lei, Q.; Jin, D.C. Effect of four chitinase genes on the female fecundity in Sogatella furcifera (Horváth). Pest. Manag. Sci. 2024, 80, 1912–1923. [Google Scholar] [CrossRef]
- Wang, Z.; Long, G.Y.; Jin, D.C.; Yang, H.; Zhou, C.; Yang, X.B. Knockdown of two trehalase genes by RNA interference is lethal to the White-Backed Planthopper Sogatella furcifera (Horváth) (Hemiptera: Delphacidae). Biomolecules 2022, 12, 1699. [Google Scholar] [CrossRef] [PubMed]
- Shen, G.M.; Ma, T.; Chen, X.R.; Chen, L.; Liu, G.M.; Luo, Y.J.; Adang, M.; He, L. Retinoid X receptor 1 is a specific lethal RNAi target disturbing chitin metabolism during hatching of Tetranychus cinnabarinus. Int. J. Biol. Macromol. 2023, 245, 125458. [Google Scholar] [CrossRef] [PubMed]
- Katagiri, N.; Ando, O.; Yamashita, O. Reduction of glycogen in eggs of the silkworm, Bombyx mori, by use of a trehalase inhibitor, trehazolin, and diapause induction in glycogen-reduced eggs. J. Insect Physiol. 1998, 44, 1205–1212. [Google Scholar] [CrossRef]
- Pan, X.; Lu, K.; Qi, S.; Zhou, Q.; Zhou, Q. The content of amino acids in artificial diet influences the development and reproduction of brown planthopper, Nilaparvata lugens (STÅL). Arch. Insect Biochem. Physiol. 2014, 86, 75–84. [Google Scholar] [CrossRef] [PubMed]
No. | Code | Amount/mg | Purity | Solvent | MW | Molecular Formula |
---|---|---|---|---|---|---|
1 | 6d | 10 | 98% | DMSO | 359.3849 | C17H10FNO3S2 |
2 | 6e | 10 | 98% | DMSO | 375.8410 | C17H10ClNO3S2 |
3 | 6f | 10 | 98% | DMSO | 420.2950 | C17H10BrNO3S2 |
Primer Name | Forward Primers (5′–3′) | Reverse Primers (5′–3′) |
---|---|---|
qRT-RPL10 | GACTTGGGTAAGAAGAAG | GATGACATGGAATGGATG |
SfTRE1 | TCAGATGAAGGTGAACTCGAAGA | GGAATGATGAATCCGTGGGTA |
SfTRE2 | CTGCTGCTGTCGGAGATGA | TAGGAGGGGAGGCTGTGAT |
SfCHS2 | GAGTTCACAGTGCGGTTGC | GCCAAAATAGCCCACATCC |
SfCht | AAGCGGACAGCAAAGCG | CCAACTCAGGGTCAATAATAAGAAC |
SfVg | CGAAGAACCTCAAATACGAAACTGT | TGGTGCTGGAGTGGGTAGATAA |
SfVgR | CGACGAGTGCACTGAAGATG | GAGGCGTCAGTATCGGTGTA |
Treatment | Number of Larvae | Number of Pupae | Emergence Rate (%) | Chi-Squared Test |
---|---|---|---|---|
2% DMSO | 89 | 52 | 71 | |
6d | 92 | 34 | 53 | df = 1, p > 0.05, c2 = 2.958 |
6e | 98 | 41 | 76 | df = 1, p > 0.05, c2 = 0.232 |
6f | 102 | 26 | 85 | df = 1, p > 0.05, c2 = 1.705 |
Pre-Oviposition Period (d) | Oviposition Period (d) | Longevity (d) | |
---|---|---|---|
2% DMSO | 1.9 ± 0.3 b | 5.2 ± 1.6 a | 8.0 ± 0.8 b |
6d | 2.7 ± 0.9 a | 5.8 ± 1.9 a | 10.5 ± 2.4 a |
6e | 2.5 ± 1.0 ab | 5.8 ± 2.0 a | 10.8 ± 2.1 a |
6f | 2.3 ± 0.6 b | 5.9 ± 2.2 a | 11.2 ± 1.9 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, L.; Zhong, F.; Jiang, X.; He, B.; Fu, H.; Liu, X.; Mao, Q.; Zhao, Y.; Wang, S.; Wu, Y.; et al. Effect of Three Novel Thiazolidiones on the Development, Reproduction, and Trehalase Activity of Spodoptera frugiperda (Lepidoptera: Noctuidae). Agronomy 2024, 14, 1315. https://doi.org/10.3390/agronomy14061315
Yu L, Zhong F, Jiang X, He B, Fu H, Liu X, Mao Q, Zhao Y, Wang S, Wu Y, et al. Effect of Three Novel Thiazolidiones on the Development, Reproduction, and Trehalase Activity of Spodoptera frugiperda (Lepidoptera: Noctuidae). Agronomy. 2024; 14(6):1315. https://doi.org/10.3390/agronomy14061315
Chicago/Turabian StyleYu, Liuhe, Fan Zhong, Xinyi Jiang, Biner He, Haoyu Fu, Xiangyu Liu, Qixuan Mao, Ying Zhao, Shigui Wang, Yan Wu, and et al. 2024. "Effect of Three Novel Thiazolidiones on the Development, Reproduction, and Trehalase Activity of Spodoptera frugiperda (Lepidoptera: Noctuidae)" Agronomy 14, no. 6: 1315. https://doi.org/10.3390/agronomy14061315
APA StyleYu, L., Zhong, F., Jiang, X., He, B., Fu, H., Liu, X., Mao, Q., Zhao, Y., Wang, S., Wu, Y., Duan, H., & Tang, B. (2024). Effect of Three Novel Thiazolidiones on the Development, Reproduction, and Trehalase Activity of Spodoptera frugiperda (Lepidoptera: Noctuidae). Agronomy, 14(6), 1315. https://doi.org/10.3390/agronomy14061315