Next Article in Journal
Precision Turfgrass Irrigation: Capturing Spatial Soil Moisture Patterns with ECa and Drone Data
Previous Article in Journal
Climate Change and Agriculture—Sustainable Plant Production
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses

College of Horticulture, Gansu Agricultural University, Lanzhou 730070, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(6), 1237; https://doi.org/10.3390/agronomy14061237
Submission received: 25 April 2024 / Revised: 27 May 2024 / Accepted: 5 June 2024 / Published: 7 June 2024
(This article belongs to the Section Horticultural and Floricultural Crops)

Abstract

Sucrose phosphate synthase (SPS) is an important link in the process of sugar metabolism. In addition, it is also involved in abiotic stresses in plants. In order to study the SPS gene family and its role in abiotic stress, we identified the MdSPS gene family members by bioinformatics methods such as correlation analysis, the HMM method, and the Clustering method, and analyzed the transient expression of MdSPS genes by quantitative real-time fluorescence analysis (qRT-PCR). The MdSPS gene family consists of a total of 19 members divided into three subfamilies distributed on 14 chromosomes in apples. The MdSPS gene family has 12 collinearity gene pairs, indicating significant duplication. Most members of this family contain a large number of plant hormone response elements, light-inducible elements, and abiotic stress response elements 2kb upstream of the promoter. Codon bias analysis shows that there are 28 high-frequency codons and no codons with strong preference in this family. Gene chip results showed that only MdSPS2, MdSPS3, MdSPS11, and MdSPS17 were up-regulated in roots, and they were all members of subfamily C. The qRT-PCR analysis showed that all members of this family responded significantly to drought stress, salt stress, and low temperature stress. Interestingly, the relative expression of MdSPS12 was significantly down-regulated under salt stress and low temperature stress. In addition, the expression of MdSPS3, MdSPS8, MdSPS11, and MdSPS17 was more than 20 fold higher than that of the control under drought stress, salt stress, and low temperature stress. These four genes could be candidates for molecular breeding in the MdSPS family.

1. Introduction

The apple (Malus domestica) is one of the most widely cultivated fruits in the world. It is a woody perennial, a representative fruit tree of the Rosaceae family, and one of the four major fruits in the world. It is rich in minerals, vitamins, and phenolic compounds, making it a fruit with high nutritional value [1].
The main sugars in apple fruit are starch, sucrose and fructose [2]. Sucrose, as a soluble sugar, originates from the carbohydrate products of apples. It promotes the division of fruit cells, increases the sweetness of the fruit, and enhances the flavor of the fruit during the ripening stage [3]. Sucrose alters the developmental stages of fruit trees through interactions with various phytohormones. It is also an important carbohydrate for the plant [4]. Unlike other plants, 60–70% of the photoassimilates in apple leaves are sorbitol, and only about 20% are sucrose [5,6,7]. Although sucrose is low in the fruit, which is an important component of fruit sugar metabolism. In apple fruit, sorbitol and sucrose are unloaded from each sieve tube-companion cell complex into the cell interstitial space [8]. Fruit cells utilize the sucrose cycle and sorbitol dehydrogenation as major sources of metabolic energy.
Sucrose synthesis includes sucrose phosphate synthase (SPS), sucrose synthase (SuSy), and sorbitol dehydrogenase (SDH) in higher plants [9]. Among them, SPS is a soluble rate-limiting enzyme for plant sucrose synthesis, and fructose 6-phosphate (F6P) and UDP-glucose (UDPG) are catalyzed by sucrose phosphate synthase to synthesize sucrose 6-phosphate (S6P), the activity of which is related to sucrose accumulation and directly reflects the ability of sucrose synthesis in plants [10]. In addition, sucrose phosphate synthetase and sucrose phosphorylase exist as a complex in plants, which means that the process of sucrose synthesis is an irreversible reaction in plants [11].
Cardini et al. first discovered SPS in wheat germ in 1955 [12] and subsequently cloned members of the SPS gene family in maize [13], rice [14], Arabidopsis [15], sugarcane [16], and other species. In addition, several studies have shown that the SPS family has a certain regulatory effect on abiotic stress: the expression of sucrose phosphate synthase (OsSPS) in rice plants subjected to waterlogging stress showed a decreasing trend in grain and leaves [17], and the activity of sucrose phosphate synthase was significantly increased in leaves under drought stress [18] and in the roots of rice seedlings under saline stress [19]. The low temperature of 12–14 °C increased the content of SPS in cold-sensitive maize series [20], and the activity of sucrose phosphate synthetase increased in maize treated with the sulfonylurea herbicide nicosulfuron compared with the control [21]. Low temperature stress significantly increased the activity of wheat SPS [18], and this increase increased with decreasing temperature [22]. SlSPS1 was positively regulated by dehydration under water stress [23] and showed higher activity in tomato SPS under heat stress [24]. Exogenous high-temperature spray treatment of spermidine promotes up-regulated SPS expression in lettuce [25]. Sugar beet sucrose phosphate synthetase activity was inhibited at low night temperatures [26]. Storage inhibits cold damage and maintains high sucrose phosphate synthase activity in zucchini fruits at high relative humidity [27]. Trehalose treatment increased sucrose phosphate synthase activity in apples [28] and peaches [29].
At present, the SPS gene family has been preliminary analyzed in apples. The published apple SPS gene family focuses on the role of SPS genes in sugar metabolism [30]. Recent studies have shown that water stress treatment of apple fruit during the developmental period reduces SPS activity within the fruit. This led to a decrease in fruit sucrose content and affected fruit quality [31]. Therefore, the activity of SPS due to non-stress affects the expression of SPS, which in turn affects the sucrose level. In other words, the SPS gene family is of high research value in abiotic stress. In this context, we used bioinformatics methods such as correlation analysis, the HMM method, and the Clustering method to identify the apple SPS gene family and to investigate the expression profiles and functions of apple SPS genes under abiotic stress. It provides a theoretical basis for the genetic improvement of apple stress resistance genes and fruit quality research.

2. Materials and Methods

2.1. Materials and Treatments

The experimental material was Gala-3 (GL-3) apple in a test tube plantlet, and the medium was MS + 30 g·L−1 sucrose + 0.3 mg·L−1 6-BA + 0.2 mg·L−1 IAA. Each triangular flask was inoculated with a single stem segment from a single apple bud. The apple seedlings were grown using the paper bridge method. The incubation conditions of the artificial climate chamber were as follows: light at 28 °C for 16 h, dark at 25 °C for 8 h, light intensity of 200 μmol·m−2·s−1. After 32 days of succession, apple seedlings with stable growth and no contamination were selected as experimental materials. Experimental treatments were performed in MS liquid medium containing 10% polyethylene glycol 6000 (PEG 6000), 200 mmol·L−1 sodium chloride (NaCl), and a low temperature (4 °C). Controls were untreated. The incubation conditions were 28 °C/25 °C (light/dark) (4 °C for low-temperature treatment) for 16 h/8 h (light/dark). The apple seedlings treated at 4 °C were incubated in a low-temperature plant incubator (Percival LT36VL, Perry, IA, USA). The length of treatment was 24 h. Each group treated a total of 30 bottles of apple seedlings, and every 10 bottles of apple seedlings was 1 biological replicate. The treated apple seedling leaves were collected, weighed, and wrapped in aluminum foil. The leaves were rapidly frozen in liquid nitrogen and stored at −80 °C.

2.2. Identification of SPS Gene Family Members in Apple

Arabidopsis Thaliana SPS gene IDs were obtained using known literature, and the gene length, CDS sequence, amino acid number, and cDNA length of each gene were obtained from NCBI. Apple SPS gene family members were screened by homologous gene comparison using phytozome13 (https://phytozome-next.jgi.doe.gov/, accessed on 16 November 2022) and the corresponding protein, CDS sequence, and full-length gene sequence under known gene landing sequences were retained. The SPS [Sucrose-synth (PF00862) and Glycos-transf-1 (PF00534)] candidate genes that did not contain the characterized structural domains were again filtered by the functional structural domain filtering of the HMMER (https://www.ebi.ac.uk/Tools/hmmer/, accessed on 17 November 2022) online software [32], and the screening resulted in 19 apple SPS gene family members. Based on the filtered SPS amino acid sequences, their basic information, such as amino acid number, molecular weight, isoelectric point, hydrophilicity, etc., were analyzed using Expasy ProtParam (https://web.expasy.org/protparam/, accessed on 17 November 2022) online software tool [33].

2.3. Chromosome Mapping, Subcellular Mapping and Secondary Structure Analysis of Apple SPS Gene Family

The genomic data were analyzed using TBtools software v2.096 [34] and visualized and mapped using the MG2C (http://mg2c.iask.in/mg2c_v2.1/, accessed on 25 November 2022) website. Subcellular localization prediction of the SPS gene family was performed using WoLFPSORT (https://www.genscript.com/wolf-psort.html, accessed on 25 November 2022). Secondary structure analysis of the SPS gene family proteins using PRABI (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html, accessed on 26 November 2022).

2.4. Phylogenetic Tree Construction and Collinearity Analysis of SPS Family

The SPS family members of Arabidopsis thaliana, grape (Vitis vinifera), rice (Oryza sativa), peach (Prunus persica), wheat (Triticum aestivum), and maize (Zea mays) were screened by phytozome13, and the amino acid sequences of the SPS genes of the known species were converted to fasta format using Clustalx.exe v1.83 [35], and the phylogenetic tree was constructed using MEGA 7.0 software [36]. The default value of Neighbor-Joining was 1000. The results were analyzed by MCScanX tool in TBtools. Using TBtools, the annotation information of the apple genome was analyzed with the MCScanX tool, and the results were visualized with Advanced Circos. The genome annotation information of Arabidopsis thaliana, maize, rice, and apple was imported into TBtools software for comparative analysis among species, and then the results were visualized using Multipul Synteny plot.

2.5. Motif, Gene Structure, and Cis-Acting Element Analysis of Apple SPS Gene Family

Multiple comparisons were performed using DANMAN software v6.0.40 to avoid duplicate sequences, and conserved motifs were analyzed using MEME online software (https://meme-suite.org/meme/tools/meme, accessed on 10 January 2023). The apple genome GFF3 file was analyzed using TBtools software to extract and analyze the gene structure of the SPS family. The 2000 bp promoter sequence of the apple SPS gene family was extracted using TBtools software. The cis-functional elements were screened on the PlantCARE website (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 12 January 2023) and the results were visually analyzed [37]. The phylogenetic tree, motif sequences, gene structures, and cis-functional elements of the apple SPS gene family were visualized and analyzed using TBtools software.

2.6. Codon Bias Analysis of MdSPS Family

The CodonW application (http://codonw.sourceforge.net, accessed on 15 January 2023) was used for codon bias analysis of the MdSPS gene, and Excel 2010 was used to organize the analyzed data. The results were entered into Origin 2021 software for correlation analysis and into RStudio software (https://www.rstudio.com/products/rstudio/download/, accessed on 15 January 2023)for relative synonymous codon usage analysis.

2.7. Analysis and Prediction of Interaction Network of Apple SPS Gene Family Proteins

The MdSPS family protein sequences were constructed using the Protein-Protein Interaction String Database on the Internet (https://cn.string-db.org/cgi/input?sessionId=bQ-2lYDwXJ23e&input_page_show_search=on, accessed on 18 January 2023).

2.8. Expression Analysis of Apple SPS Family Gene Chip

The expression of apple was downloaded from GEO data (GSE42873) in NCBI database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42873, accessed on 25 February 2023), and the transcriptome data of apple roots, stems, leaves, flowers, fruits, seeds, and seedlings were selected, and the genes were extracted using GDR (https://www.rosaceae.org/, accessed on 26 February 2023) gene, after that, it will be compared between the Excel used to organize the data and TBtools used to draw the gene expression heatmap.

2.9. qRT-PCR Analysis of Apple SPS Family

RNA was extracted from leaves using the plant extraction kit RNAplant-RTR2303 (Zhongkeritai Biotechnology Co., LTD., Beijing, China) according to the instruction manual. The cDNA was synthesized using the Prime Script RT reagent kit (Perfect Real Time) reverse transcription kit (TaKaRa Biotechnology, Lanzhou, China), and the LightCycler® 96 qRT-PCR system (Roche, Basel, Switzerland) was used. The primers were amplified by PCR under different treatments, and the reference gene was GAPDH (GenBank accession no. CB973647). The amplification reaction system was 20 μL: cDNA 1 μL, upstream and downstream primers 1 μL, SYBR 10 μL, ddH2O 7 μL. 19 primers for apple SPS genes were designed (Table 1) and synthesized online by Sangon Biotech (Shanghai, China). The relative expression levels were calculated using the 2−ΔΔCt method [38]. Three biological and technical replicates were established for this experiment.

2.10. Statistical Analysis

Excel 2010 was used to sort the experimental data, and Origin 2021 software was used for graphing. SPSS 26 was used for the analysis of variance and multiple comparisons of experimental data. Duncan’s method was used to analyze the significance difference, and the significance level was p < 0.05.

3. Results

3.1. Chromosome Mapping and Physicochemical Property Analysis of Apple SPS Gene Family

19 apple SPS genes were identified by homologous comparison of the HMMER model, which were named MdSPS1~MdSPS19. Location of the apple SPS family on the chromosome (Figure 1). They are located on each of the 14 chromosomes of the apple. There are three genes on chromosomes 2 and 15, two genes on chromosome 13, and one gene on each of the remaining 11 chromosomes. MdSPS2 and MdSPS3 are located on chromosome 2 and closely spaced, while MdSPS12 and MdSPS13 are located on chromosome 13 in the same condition.
Table 2 shows that the amino acid length of the MdSPS family ranges from 305 to 1065 aa, among which the protein sequence of MdSPS12 is the shortest and that of MdSPS5 is the longest. The relative molecular weight of the protein ranges from 34,488.82 to 119,183.48 Da. The isoelectric point is 5.67~7.21. The instability index of MdSPS3 is the lowest (31.51) and that of MdSPS15 is the highest (49.04). The value of the grand average of hydropathicity ranges from −0.092 to −0.492.

3.2. Subcellular Localization Prediction and Secondary Structure Analysis of the Apple SPS Family

The subcellular localization prediction of apple SPS proteins is shown in Table 3. The expression of MdSPS proteins is mainly concentrated in the cytoplasm, chloroplast, nucleus, and plasma membrane. And a small amount of expression in mitochondria and peroxisome. All members were expressed in the cytoplasm; MdSPS9 and MdSPS12 were the highest. Except for MdSPS2 and MdSPS3, other members of the gene family were also highly expressed in chloroplasts. Only MdSPS10 and MdSPS14 were expressed in peroxisomes.
The secondary structure analysis of the apple SPS gene family proteins is shown in Table 4. The results showed that the apple SPS gene family proteins all contain an alpha helix, a beta turn, a random coil, and an extended strand. The alpha helix and random coil are the main components of the secondary structure of the proteins in this gene family. Alpha helix accounted for 34.50–64.71%, random coil accounted for 17.32–39.55%, followed by extended strand, and beta turn accounted for the smallest proportion.

3.3. Construction of Phylogenetic Tree of Apple SPS Gene Family

According to related studies, the SPS gene family was divided into four subgroups based on phylogenetic analysis in higher plants [39]. To further understand the evolutionary relationship between MdSPS and other species, we performed phylogenetic analysis of 97 protein sequences from seven species, including Arabidopsis thaliana, grape (Vitis vinifera), rice (Oryza sativa), peach (Prunus persica), wheat (Triticum aestivum), maize (Zea mays), and apple (Malus domestica). Sucr_P_syn_N (TIGR02472) was found in subgroups A, B, and D, and sucr_synth (cl30294) was found in subgroup C. All members of subgroup D were monocotyledons. OsSPS6, TaSPS7, TaSPS19, TaSPS27, and ZmSPS6 all have the DUF1752 superfamily domain (cl07240) (Figure 2).
The apple SPS gene family is divided into three subfamilies. Subfamily A contains MdSPS1, MdSPS8, MdSPS15, and MdSPS16; subfamily B contains only MdSPS5, MdSPS6, and MdSPS10; and subfamily C contains most of the genes of the apple SPS family, namely MdSPS2, MdSPS3, MdSPS4, MdSPS7, MdSPS9, MdSPS11, MdSPS12, MdSPS13, MdSPS14, MdSPS17, MdSPS18, and MdSPS19 were 12 genes. Subgroup D contains no members of the apple SPS family.

3.4. Synteny Analysis of SPS Genes Family

The analysis of the synteny between the SPS gene families of apple, maize, Arabidopsis thaliana and grape is shown in Figure 3. There was abundant replication between apple and all species, and gene pairs existed in all genes (excepting MdSPS6, MdSPS8, MdSPS12, MdSPS13, and MdSPS19). There were more collinear gene pairs with Arabidopsis and grape, but fewer collinear gene pairs with maize. This is probably because apples are very distant from maize.
As shown in Figure 4, the replication phenomenon of 19 MdSPS genes was obvious, and there were 12 pairs of collinearity genes. MdSPS3, MdSPS5, and MdSPS13 have no collinearity information. MdSPS15 and MdSPS16 are on the same chromosome and close to each other. This indicates that there may be a genetic linkage between the two genes. All other collinear relationships between genes occur between two chromosomes.

3.5. Motif Analysis of Apple SPS Gene Family and Prediction of Promoter Cis-Acting Elements

A total of 25 motifs were obtained by motif analysis of the apple SPS family proteins (Figure 5a). All proteins contained motif 7, indicating that they have similar functions. Motif 4, motif 11, motif 12, motif 14, motif 18, and motif 21 were found only in subgroup C. Motif 1, motif 7, motif 9, and motif 19 were found in subgroups A and B. Except for MdSPS4 and MdSPS12, all of the other genes contained seven or more motifs.
To determine the function of cis-acting elements in the MdSPS family, cis-acting element analysis was performed on the 2000 bp promoter sequence upstream of the family (Figure 5b). Cis-acting elements of the apple SPS gene family promoter include hormone response, light response, and stress response.
Structure analysis of 19 genes in the apple SPS family showed the following results (Figure 5c): The number of exons in this gene family ranges from 6 to 15, with MdSPS4 and MdSP12 having no upstream and downstream gene sequences, MdSPS13 and MdSPS18 having no upstream gene sequences, and MdSPS3 and MdSPS14 having no downstream gene sequences, while all of the other genes contain upstream and downstream. The number of exons in subgroup C is quite different, which may be related to their function. The number of exons in MdSPS11, MdSPS18, and MdSPS19 is up to 15, while the number of exons in MdSPS4 is the lowest, with only 7. Except for MdSPS8, the other three genes in subgroup A all contain 13 exons. However, there were differences in the distribution, length, and number of coding regions in the same subpopulation.
All 19 SPS genes in apples contain hormone-responsive and light-responsive elements (Figure 5c and Figure 6). Anaerobic induction elements were found in 15 genes, and defense and stress-responsive elements were found in five genes. Ten genes, including MdSPS3, MdSPS4, MdSPS5, MdSPS9, MdSPS10, MdSPS13, MdSPS14, MdSPS15, MdSPS18, and MdSPS19, contain low temperature responsive elements. Drought-inducible elements were found in nine MdSPS genes: MdSPS3, MdSPS4, MdSPS6, MdSPS7, MdSPS8, MdSPS9, MdSPS10, MdSPS14, and MdSPS15. The wound response element is present in only one gene, MdSPS13. MdSPS2, MdSPS11, MdSPS16, and MdSPS17 all contain hormone-responsive, light-responsive, anaerobic-induction, defense, and stress-responsive elements. Six elements of hormone responsive, light responsive, anaerobic induction, low temperature responsive, drought inducible, defense and stress responsive elements appeared in MdSPS3 and MdSPS10.

3.6. Codon Bias Analysis of Apple SPS Family

In Table 5, the RSCU values of 19 CDS sequences in the apple SPS family are calculated. The codon of apple SPS mainly prefers to end in G and U. There are 28 high-frequency codons (RSCU > 1) in the CDS sequence of apple sucrose phosphate synthetase. Thirteen of them end in U, nine in A, five in G, and one in C. However, the RSCU values of these high-frequency codons are all less than 2.0, indicating that there is no codon with strong preference in apple SPS genes. Interestingly, the AGA codon, which translates arginine, was used most frequently (1.947). The frequency of the ACG codon translating threonine was the lowest, 0.419.
Correlation analysis of the apple SPS family shows that T3s is negatively correlated with C3s, A3s, G3s, and GC3s. C3s was positively correlated with G3s, CAI (codon adaptation index), CBI (codon preference index), Fop (optimal codon usage frequency), and GC3s (Figure 7).

3.7. Interaction Analysis of Apple SPS Gene Family Proteins

Interactions between 19 MdSPS proteins were predicted (Figure 8). 12 kinds of MdSPS proteins, including MdSPS2, MdSPS5, MdSPS6, MdSPS7, MdSP10, MdSPS11, MdSPS14, MdSPS15, MdSPS16, MdSPS17, MdSPS18, and MdSPS19, interact with each other to form a protein interaction network. MdSPS5, MdSPS6, MdSPS10, MdSPS15, and MdSPS16 had different interactions with seven proteins.
By predictive analysis of interactions with other proteins, MdSPS were associated with sucrose phosphatase, UTP-glucose-1-phosphate uridylyltransferase and beta-fructofuranosidase. They are involved in the glycogen storage mechanism.

3.8. Analysis of Expression Patterns in the Apple SPS Gene Family

A total of nine MdSPS genes were comparatively analyzed in the GEO database. The corresponding gene numbers of GDR loci were MDP0000288876, MDP0000160578, MDP0000872262, MDP0000783676, MDP0000256965, MDP0000126946, MDP0000212593, MDP0000174537, and MDP0000250070. As can be seen from Figure 9, there were significant differences in the phenological quantities of the different organs. Except for MdSPS14, the other four genes had high expression in different organs, while MdSPS14 was almost not expressed in different tissues. In subgroup a, both MdSPS1 and MdSPS15 were highly expressed in seeds, and MdSPS1 was also highly expressed in flowers and fruits. In subgroup b, MdSPS5 had higher expression in fruit and seeds, and the expression in seeds was the highest among the nine genes. In contrast, MdSPS6 was only highly expressed in seedlings.

3.9. Quantitative Fluorescence Analysis of Apple SPS Gene Family

The SPS family members were induced in the leaves of apple seedlings under different abiotic stress conditions, and the expression pattern analysis by qRT-PCR is shown in Figure 10. Significant differences in the relative expression levels of 19 MdSPS family members were observed under PEG, NaCl stress, and low-temperature stress. The highest relative expression of MdSPS4 was observed after 24 h of PEG treatment, which was 288.7-fold higher than that of the control. In addition, the expression of all MdSPS members was up-regulated, indicating that the SPS gene family played an active role in regulating drought stress in apples. The relative expression of MdSPS17 was the highest after NaCl treatment for 24 h, which was 158.7-fold higher than that of the control. The relative expression of MdSPS3 was the highest in the 4 °C -treated apple leaves for 24 h, which was 27.1-fold higher than that of the control. The relative expression of MdSPS4 was also the highest after PEG treatment, which was 288.7-fold higher than that of the control. Interestingly, the relative expression of MdSPS12 was down-regulated under NaCl, and its relative expression was also suppressed at 4 °C, whereas the expression of other SPS genes was up-regulated. It is hypothesized that SPS genes (except MdSPS12) play an important positive regulatory role in salt stress and low temperature stress. On the contrary, MdSPS12 may play a negative regulatory role in plant salt stress and low temperature stress.

4. Discussion

The identification and cloning of SPS gene families have been reported in many plants, including lychee (Litchi chinensis Sonn) [40], peach (Prunus persica (L.) Batsch) [41], cassava (Manihot esculenta Crantz) [42], rice (Oryza sativa L. cv. Nipponbare) [43], and sugarcane (Saccharum officinarum and Saccharum spontaneum) [44]. In this study, bioinformatics methods were used to identify and screen the apple genome database. Finally, 19 members of apple SPS gene family were obtained and named MdSPS1-MdSPS19. Previous studies have shown that subfamily D exists only in ligneous monocotyledonous plants. A, B, and C are widespread not only in monocots but also in dicotyledon plants [39]. The same phenomenon occurs in the apple SPS gene family, where phylogenetic analyses have classified 19 genes into three subfamilies. Subfamilies A, B, and C contain 4, 3, and 12 genes, respectively.
The distribution of the SPS gene was different in different species. In tomatoes, SlSPS were distributed in the plasma membrane [45]. In Actinidia chinensis and A. eriantha, SPS genes are distributed in the cytoplasm and nucleus [46]. The nucleus, cytoplasm, mitochondria, and chloroplasts are the main distribution regions of SPS proteins in sugarcane [47]. GmSPS proteins are predicted to be localized and distributed in the nucleus and cytoplasm [48]. We found that the results of subcellular localization prediction analysis were similar to the results of sugarcane studies. Apple SPS proteins were mainly distributed in the cytoplasm, chloroplasts, mitochondria and nucleus. However, MdSPS10 and MdSPS14 proteins were predicted to be localized in peroxisomes, which may be related to their functions.
Previous studies have shown that the number of exons in the wheat SPS family ranges from 12 to 14 [39]. In cassava, the numbers of exons and introns were 11–14 and 10–13, respectively [42]. The numbers of exons and introns were 12–14 and 11–13, in lychee, respectively [40]. The members of subfamily A had similar results in apple SPS gene structure. However, some members of subgroup B and subgroup C have large differences, which may be due to the addition or deletion of exons and introns in the genes during the evolutionary process. The same phenomenon occurred in soybean (Solanum lycopersicum) [48] and sugarcane (Solanum lycopersicum) [47]. For motif analysis we found that genes with similar evolutionary relationships in the MdSPS family have similar gene structures. For example, MdSPS2, MdSPS3, and MdSPS17 have the same motif and the same number of exons.
Apparently, the same situation occurred in our study. We analyzed the cis-acting elements of the apple SPS promoter and found a large number of light-responsive, hormone-responsive, and stress-related elements in its 2000 bp promoter. Similar results were found in potato, Actinidia chinensis, and A. eriantha. All SPS members were rich in hormone-responsive elements, stress-responsive elements, and light-responsive elements in potato [49]. In Actinidia chinensis and A. eriantha, 2000 bp upstream of the SPS gene promoter had a large number of elements related to light response, hormone response and stress [46].
Plants have different response mechanisms to different stresses, and the SPS gene family has been suggested to play an important role in regulating plant stress [50,51]. With the prolongation of the stress time, the soluble sugar content increases slowly until it decreases, which may be due to the fact that the arrangement of the lipid bilayer on the protoplasmic membrane is damaged by the prolongation of the stress time and the permeability of the plasma membrane is changed [52]. Water stress affects not only the distribution of carbohydrates but also the size of the sucrose pool [53,54]. Dehydration of protoplasts and cell walls leads to cell collapse, which is associated with mechanical damage and metabolic disorders [55]. Previous studies have shown that SPS activity tends to change significantly with the onset of stress. The relative expression of GmSPS1 in soybean leaves increased significantly under water deficit conditions [56], and SPS activity in Phaseolus vulgaris L. cv Linden leaves decreased by about 50% due to water deficit [57]. Keller’s study on carbohydrate metabolism in the leaves of pigeonpea (Cajanus cajan) under early drought stress indicated that after 27 days of drought stress, the activity of decomposing enzymes such as amylase and SPS synthesis of sucrose in the leaves of the plant increased significantly [58]. The activity of SPS in cucumber (Cucumis sativus L.) increased under short-term drought stress [59]. We found that MdSPS has similarities with soybean SPS genes under drought condition stress [56]. The relative expression levels of all SPS genes were significantly up-regulated and all were significantly different from CK compared with 10% PEG treatment in apples. However, contrary to some of the previous findings [57], this result may be due to the short-term drought caused by the short treatment time in this experiment. This suggests that MdSPS is more sensitive to short-term drought stress, and it is hypothesized that the SPS gene plays an active role in the response to short-term drought stress in apples.
In jujube fruits, the activity of SPS increased significantly with the increase in salinity stress [60]. In tomato (Solanum lycopersicum) salt stress, the relative expression of SISPS4 increased with time, but the expression of SISPS1 and SISPS2 was opposite [45]. SPS activity in cotton (Gossypium hirsutum L.) leaves increased in a short period of time under medium to high salt stress [61]. In our study, the relative expression levels of the remaining MdSPS genes, except for MdSPS12, increased to different degrees under salt stress for 24 h and were significantly higher than those of the control group under this treatment. The phenomenon of the decrease in the relative expression of MdSPS12 under salt stress was similar to that of tomato SlSPS1 and SlSPS2, which might have similar conserved motifs [45].
When plants were subjected to osmotic water loss under environmental stress, the activity of SPS increased rapidly, and a large amount of sucrose was synthesized or starch was hydrolyzed and resynthesized into sugars [62]. The increase in these soluble sugars can increase the concentration of cell fluid and buffer the excessive dehydration of the cytoplasm. In addition, at low temperatures, the high concentration of cell fluid can also protect the cytoplasmic colloid from freezing and reduce mechanical damage to the membrane [63]. SPS activity in the leaf tissue of spinach (Spinacia oleracea) increased significantly under cold stress at 5 °C [64]. Fruits of peach (P. persica) showed a significant increase in SPS activity over a two week period when stored at 5 °C or 10 °C [65]. The relative expression level of SPS in chickpea GPF2 (cold-sensitive) increased at 4 °C for 72 h [66].The relative expression of most of the apple MdSPS genes was significantly higher than that of CK after 24 h of treatment at 4 °C, but there was no significant difference in MdSPS4, although it was higher than that of CK. It might be caused by the insensitivity of MdSPS4 to low temperature stress. Moreover, the relative expression of MdSPS12 was significantly decreased at low temperatures.

5. Conclusions

Nineteen SPS genes were identified in apples, which can be categorized into three subfamilies. All of MdSPSs contain light-responsive elements and hormone-responsive elements. Second, the expression levels of MdSPS proteins varied in different tissues. MdSPS5 and MdSPS15 had the highest expression in seeds; MdSPS1 had the highest expression in fruits; and MdSPS17 had a lower expression in seeds. The results of qRT-qPCR showed that most of the SPS genes were significantly different from CK, except for MdSPS4, which was found in apples. Finally, qRT-qPCR results showed that most of the SPS genes were significant compared with CK except for MdSPS4, but MdSPS12 was significantly lower than that of CK under salt stress and low temperature stress. In addition, the expression of MdSPS3, MdSPS8, MdSPS11, and MdSPS17 was more than 20 fold higher than that of the control under drought stress, salt stress, and low temperature stress. These four genes could be candidates for molecular breeding in the MdSPS family. Overall, the three stresses analyzed in this experiment are only one aspect of abiotic stresses, and the response mechanisms of apple SPS genes to more adversity stresses need to be further investigated.

Author Contributions

Conceptualization, Z.M. and S.Y.; Methodology, Z.M.; Software, S.Y.; Validation, S.Y., X.C. and Y.F.; Formal Analysis, S.Y. and Y.F.; Investigation, W.L.; Resources, S.Y.; Data Curation, Y.F. and S.Y.; Writing—Original Draft Preparation, S.Y.; Writing—Review and Editing, S.Y., J.Y. and H.H.; Visualization, W.L.; Supervision: Y.H.; Project Administration, Z.M.; Funding Acquisition, Z.M. and Y.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by Gansu Agricultural University student research training program (202112010; S202210733043), Gansu Youth Science and Technology Fund project (22JR5RA884), Education science and technology innovation project of Gansu Province (GSSYLXM-02), and National Natural Science Foundation of China (32160685).

Data Availability Statement

The data that support the finding of this study are available from the corresponding author upon reasonable request.

Acknowledgments

The experiment was conducted in the Open Laboratory of Fruit Physiology and Biotechnology, College of Horticulture, Gansu Agricultural University from September 2022 to July 2023.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Boyer, J.; Liu, R.H. Apple phytochemicals and their health benefits. Nutr. J. 2004, 3, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Yingmin, L.; Dapeng, Z.; Haiyan, A.Y. Sugar unloading mechanisms in the developing apple fruit. Acta Hortic. Sin. 1999, 26, 141–146. [Google Scholar]
  3. Koprivica, G.; Mišljenović, N.; Lević, L.; Petkova, M.; Pribiš, V. Osmotic dehydration of apple in sucrose and sugar beet molasses: Change of nutritive properties of final product. PTEP 2008, 12, 215–218. [Google Scholar]
  4. Lenz, F. Fruit effects on the dry matter and carbohydrate distribution in apple trees. Acta Hortic. 2009, 835, 21–38. [Google Scholar] [CrossRef] [Scilit]
  5. Harborne, B.J. Hormonal Regulation of Development I; Encyclopedia of Plant Physiology New Series; Springer: Berlin/Heidelberg, Germany, 1982; Volume 9, p. 681. [Google Scholar]
  6. Cheng, L.; Zhou, R.; Reidel, E.J.; Sharkey, T.D.; Dandekar, A.M. Antisense inhibition of sorbitol synthesis leads to up-regulation of starch synthesis without altering CO2 assimilation in apple leaves. Planta 2004, 220, 767–776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Loescher, W.H. Physiology and metabolism of sugar alcohols in higher plants. Physiol. Plant. 1987, 70, 553–557. [Google Scholar] [CrossRef] [Scilit]
  8. Zhang, L.Y.; Peng, Y.B.; Sandrine, P.T.; Fan, Y.; Lu, Y.F.; Lu, Y.M.; Gao, X.P.; Shen, Y.Y.; Delrot, S.; Zhang, D.P. Evidence for apoplasmic phloem unloading in developing apple fruit. Plant Physiol. 2004, 135, 574–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Winter, H.; Huber, S.C. Regulation of sucrose metabolism in higher plants: Localization and regulation of activity of key enzymes. Crit. Rev. Biochem. Mol. Biol. 2000, 35, 253–289. [Google Scholar] [CrossRef] [Scilit]
  10. Stuart, H.; Christine, F.; David, W. The purification and properties of sucrose-phosphate synthetase from spinach leaves: The involvement of this enzyme and fructose bisphosphatase in the regulation of sucrose biosynthesis. Arch. Biochem. Biophys. 1981, 212, 237–246. [Google Scholar]
  11. Huber, S.C.; Huber, J.L. Role and regulation of sucrose-phosphate synthase in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 431–444. [Google Scholar] [CrossRef] [Scilit]
  12. Leloir, L.F.; Cardini, C.E. The biosynthesis of sucrose phosphate. J. Biol. Chem. 1955, 214, 65–157. [Google Scholar] [CrossRef] [Scilit]
  13. Lutfiyya, L.L.; Xu, N.F.; D’Ordine, R.L.; Morrell, J.A.; Miller, P.W.; Duff, S.G. Phylogenetic and expression analysis of sucrose phosphate synthase isozymes in plants. J. Plant Physiol. 2007, 164, 923–933. [Google Scholar] [CrossRef] [Scilit]
  14. Juan, J.V.; Marcelo, F.; Graciela, S.; Beatriz, J.M.; Luis, H.E. Characterization of a rice sucrose-phosphate synthase-encoding gene. Gene 1996, 170, 217–222. [Google Scholar]
  15. Langenkämper, G.; Fung, R.M.; Newcomb, R.D.; Atkinson, R.G.; Gardner, R.C.; MacRae, E.A. Sucrose phosphate synthase genes in plants belong to three different families. J. Mol. Evol. 2002, 54, 322–332. [Google Scholar] [CrossRef] [Scilit]
  16. Huang, D.L.; Qin, C.X.; Gui, Y.Y.; Zhao, L.H.; Chen, Z.L.; Wang, M.; Sun, Y.; Liao, Q.; Li, Y.R.; Lakshmanan, P. Role of the SPS gene families in the regulation of sucrose accumulation in sugarcane. Sugar Tech 2017, 19, 117–124. [Google Scholar] [CrossRef] [Scilit]
  17. Lee, H.K.; Hwang, W.H.; Jeong, J.H.; Ahn, S.H.; Baek, J.S.; Jeong, H.Y.; Park, H.K.; Ku, B.I.; Yun, J.T.; Lee, G.H.; et al. Analysis of the distribution of assimilation products and the characteristics of transcriptomes in rice by submergence during the ripening stage. BMC Genom. 2019, 20, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Xu, W.; Cui, K.; Xu, A.; Nie, L.; Huang, J.; Peng, S. Drought stress condition increases root to shoot ratio via alteration of carbohydrate partitioning and enzymatic activity in rice seedlings. Acta Physiol. Plant. 2015, 37, 9–36. [Google Scholar] [CrossRef] [Scilit]
  19. Shao, X.W.; Gai, D.S.; Gao, D.P.; Geng, Y.Q.; Guo, L.Y. Effects of salt-alkaline stress on carbohydrate metabolism in rice seedlings. Phyton-Int. J. Exp. Bot. 2022, 91, 745–759. [Google Scholar] [CrossRef] [Scilit]
  20. Anna, B.K.; Jennifer, M.; Szymon, S.; Justyna, M.; Piotr, O.; Jacek, Z. Sucrose phosphate synthase (SPS), sucrose synthase (SUS) and their products in the leaves of Miscanthus × giganteus and Zea mays at low temperature. Planta 2020, 252, 23. [Google Scholar]
  21. Xu, N.; Wu, Z.; Li, X.; Yang, M.; Han, J.; Lu, B.; Lu, B.S.; Wang, J. Effects of nicosulfuron on plant growth and sugar metabolism in sweet maize (Zea mays L.). PLoS ONE 2022, 17, e0276606. [Google Scholar] [CrossRef] [Scilit]
  22. Zhang, W.J.; Wang, J.Q.; Huang, Z.L.; Mi, L.; Xu, K.F.; Wu, J.J.; Fan, Y.H.; Ma, S.Y.; Jiang, D.G. Effects of low temperature at booting stage on sucrose metabolism and endogenous hormone contents in winter wheat spikelet. Front. Plant Sci. 2019, 10, 498–517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Barbosa, A.O.; Rocha, D.S., Jr.; Silva, G.B.; Santos, M.G.M.; Camillo, L.R.; de Oliveira, P.H.G.A.; Cavalari, A.A.; Costa, M.G.C. Dynamics of the sucrose metabolism and related gene expression in tomato fruits under water deficit. Physiol. Mol. Biol. Plants 2023, 29, 159–172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Zhang, Y.; Zeng, D.; Liu, Y.; Zhu, W. SlSPS, a sucrose phosphate synthase gene, mediates plant growth and thermotolerance in tomato. Horticulturae 2022, 8, 491–504. [Google Scholar] [CrossRef] [Scilit]
  25. Yu, Q.; Sun, W.; Han, Y.; Hao, J.; Qin, X.; Liu, C.; Fan, S. Exogenous spermidine improves the sucrose metabolism of lettuce to resist high-temperature stress. Plant Growth Regul. 2022, 96, 497–509. [Google Scholar] [CrossRef] [Scilit]
  26. Wang, L.; Zhai, Y.; Wu, J.; Stevanato, P.; Sha, S.; Geng, G.; Xu, Y.; Yu, L.; Wang, Y. Low night temperature-induced feedback inhibition of photosynthesis through sucrose accumulation in sugar beet (Beta vulgaris L.) leaves. Environ. Exp. Bot. 2022, 204, 105083. [Google Scholar] [CrossRef] [Scilit]
  27. Zuo, X.; Cao, S.; Ji, N.; Li, Y.; Zhang, J.; Jin, P.; Zheng, Y. High relative humidity enhances chilling tolerance of zucchini fruit by regulating sugar and ethanol metabolisms during cold storage. Postharvest Biol. Technol. 2022, 189, 111932. [Google Scholar] [CrossRef] [Scilit]
  28. Li, C.; Sun, L.; Zhu, J.; Cheng, Y.; Huang, R.; Fan, Y.; Guo, M.; Ge, Y. Trehalose maintains the quality of Malus domestica by mediating sucrose and respiratory metabolism. Sci. Hortic. 2022, 295, 110857. [Google Scholar] [CrossRef] [Scilit]
  29. Wang, X.; Wei, Y.; Chen, Y.; Jiang, S.; Xu, F.; Wang, H.; Shao, X. NMR revealed that trehalose enhances sucrose accumulation and alleviates chilling injury in peach fruit. Sci. Hortic. 2022, 303, 111190. [Google Scholar] [CrossRef] [Scilit]
  30. Jiang, S.Y.; Chi, Y.H.; Wang, J.Z.; Zhou, J.X.; Cheng, Y.S.; Zhang, B.L.; Ma, A.; Vanitha, J.; Ramachandran, S. Sucrose metabolism gene families and their biological functions. Sci. Rep. 2015, 5, 17583–17607. [Google Scholar] [CrossRef] [Scilit]
  31. Hongxia, T.; Hanqing, S.; Yufei, W.; Xin, W.; Yanping, G. Effects of water stress on quality and sugar metabolism in ‘Gala’ apple fruit. Hortic. Plant J. 2023, 9, 60–72. [Google Scholar]
  32. Finn, R.D.; Clements, J.; Eddy, S. RHMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, 29–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Hochstrasser, D.F. Protein identification and analysis tools in the ExPASy server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar] [PubMed]
  34. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Mcwilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
  37. Lescot, M. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef] [Scilit]
  39. Castleden, C.K.; Aoki, N.; Gillespie, V.J.; MacRae, E.A.; Quick, W.P.; Buchner, P.; Foyer, C.H.; Furbank, R.T.; Lunn, J.E. Evolution and function of the sucrose-phosphate synthase gene families in wheat and other grasses. Plant Physiol. 2004, 135, 1753–1764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Wang, D.; Zhao, J.T.; Hu, B.; Li, J.Q.; Qin, Y.Q.; Chen, L.H.; Qin, Y.H.; Hu, G.B. Identification and expression profile analysis of the sucrose phosphate synthase gene family in Litchi chinensis Sonn. PeerJ 2018, 6, 4379–4391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Vimolmangkang, S.; Zheng, H.Y.; Peng, Q.; Jiang, Q.; Wang, H.L.; Fang, T.; Liao, L.; Wang, L.; He, H.P.; Han, Y.P. Assessment of sugar components and genes involved in the regulation of sucrose accumulation in peach fruit. J. Agric. Food Chem. 2016, 64, 6723–6729. [Google Scholar] [CrossRef] [Scilit]
  42. Huang, T.W.; Luo, X.L.; Wei, M.G.; Shan, Z.Y.; Zhu, Y.M.; Yang, Y.N.; Fan, Z.P. Molecular cloning and expression analysis of sucrose phosphate synthase genes in cassava (Manihot esculenta Crantz). Sci. Rep. 2020, 10, 20707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Masaki, O.; Naohiro, A.; Tatsuro, H.; Madoka, Y.; Chikara, O.; Ryu, O. Tissue specificity and diurnal change in gene expression of the sucrose phosphate synthase gene family in rice. Plant Sci. 2011, 181, 159–166. [Google Scholar]
  44. Ma, P.P.; Zhang, X.T.; Chen, L.P.; Zhao, Q.; Zhang, Q.; Hua, X.T.; Wang, Z.C.; Tang, H.B.; Yu, Q.Y.; Zhang, M.Q.; et al. Comparative analysis of sucrose phosphate synthase (SPS) gene family between Saccharum officinarum and Saccharum spontaneum. BMC Plant Biol. 2020, 20, 422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Duan, Y.K.; Yang, L.; Zhu, H.J.; Zhou, J.; Sun, H.; Gong, H.J. Structure and expression analysis of sucrose phosphate synthase, sucrose synthase and invertase gene families in Solanum lycopersicum. Int. J. Mol. Sci. 2021, 22, 4698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Liao, G.; Li, Y.; Wang, H.; Liu, Q.; Zhong, M.; Jia, D.; Huang, C.; Xu, X. Genome-wide identification and expression profiling analysis of sucrose synthase (SUS) and sucrose phosphate synthase (SPS) genes family in Actinidia chinensis and A. eriantha. BMC Plant Biol. 2022, 22, 215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Robi, N.; Gulnaz, P.; Muhammad, N.; Naila, H.; Amtul, S.; Irfan, U. Comparative expression analysis of sucrose phosphate synthase gene family in a low and high sucrose Pakistani sugarcane cultivars. PeerJ 2023, 11, e15832. [Google Scholar]
  48. Jiafang, S.; Yiran, X.; Songli, Y.; Fuxiao, J.; Yi, H.; Haifeng, C.; Chanjuan, Z. Genome-wide identification of GmSPS gene family in soybean and expression analysis in response to cold stress. Int. J. Mol. Sci. 2023, 24, 12878. [Google Scholar]
  49. Hu, J.; Duan, Y.; Hu, J.; Zhang, S.; Li, G. Phylogenetic and expression analysis of the sucrose synthase and sucrose phosphatesynthase gene family in potatoes. Metabolites 2024, 14, 70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Wu, B.; Cang, J.; Zhang, D.; Zhang, D.; Lu, Q.W.; Liu, H.L. Effects of SA treatment on winter wheat (Triticum aestivum L.) sucrose metabolism in low temperature. Plant Physiol. J. 2015, 51, 537–545. [Google Scholar]
  51. Zhao, F.C.; Jing, L.Q.; Yan, F.B.; Lu, D.L.; Lu, W.P. Effects of heat stress during grain filling on sugar accumulation and enzyme activity associated with sucrose metabolism in sweet corn. Acta Agron. Sin. 2013, 39, 1644. [Google Scholar] [CrossRef] [Scilit]
  52. Alscher, R.G.; Cumming, J.R.; Krikorian, A.D. Stress responses in plants: Adaptation and acclimation mechanisms. Q. Rev. Biol. 1990, 66, 3. [Google Scholar]
  53. Ana, B.G.; Janice, D.A.; Suresh, L.; Tom, G.; Marc, V.M.; Allan, B.C. Effects of osmoprotectants upon NaCl stress in rice. Plant Physiol. 1997, 115, 159–169. [Google Scholar]
  54. Quick, W.P.; Chaves, M.M.; Wendler, R.; David, M.; Rodrigues, M.L.; Passaharinho, J.A.; Pereira, J.S.; Adcock, M.D.; Leegood, R.C.; Stitt, M. The effect of water stress on photosynthetic carbon metabolism in four species grown under field conditions. Plant. Cell Environ. 1992, 15, 25–35. [Google Scholar] [CrossRef] [Scilit]
  55. Carpita, N.; Sabularse, D.; Montezinos, D.; Delmer, D.P. Determination of the pore size of cell walls of living plant cells. Science 1979, 205, 1144–1147. [Google Scholar] [CrossRef] [Scilit]
  56. Du, Y.L.; Zhao, Q.; Chen, L.R.; Yao, X.D.; Zhang, H.J.; Wu, J.J.; Xie, F.T. Effect of drought stress during soybean R2–R6 growth stages on sucrose metabolism in leaf and seed. Int. J. Mol. Sci. 2020, 21, 618–637. [Google Scholar] [CrossRef] [Scilit]
  57. Vassey, T.L.; Sharkey, T.D. Mild water stress of Phaseolus vulgaris plants leads to reduced starch synthesis and extractable sucrose phosphate synthase activity. Plant Physiol. 1989, 89, 1066–1070. [Google Scholar] [CrossRef] [Scilit]
  58. Keller, F.; Ludlow, M.M. Carbohydrate metabolism in drought-stressed leaves of pigeonpea (Cajanus cajan). J. Exp. Bot. 1993, 44, 1351–1359. [Google Scholar] [CrossRef] [Scilit]
  59. Chen, L.; Zheng, F.; Feng, Z.; Li, Y.; Ma, M.; Wang, G.; Zhao, H. A vacuolar invertase CsVI2 regulates sucrose metabolism and increases drought tolerance in Cucumis sativus L. Int. J. Mol. Sci. 2021, 23, 176–190. [Google Scholar] [CrossRef] [Scilit]
  60. Wang, Y.; Feng, Y.F.; Yan, M.; Yu, J.; Zhou, X.F.; Bao, J.K.; Zhang, Q.Q.; Wu, C.Y. Effect of saline–alkali stress on sugar metabolism of jujube fruit. Horticulturae 2022, 8, 474. [Google Scholar] [CrossRef] [Scilit]
  61. Jun, P.; Liu, J.A.; Zhang, L.; Luo, J.Y.; Dong, H.L.; Ma, Y.; Zhao, X.H.; Chen, B.L.; Sui, N.; Zhao, Z.G.; et al. Effects of soil salinity on sucrose metabolism in cotton leaves. PLoS ONE 2016, 11, e0156241. [Google Scholar]
  62. Geigenberger, P.; Reimholz, R.; Deiting, U.; Sonnewald, U.; Stitt, M. Decreased expression of sucrose phosphate synthase strongly inhibits the water stress-induced synthesis of sucrose in growing potato tubers. Plant J. 1999, 19, 119–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Kawamura, Y.; Uemura, M. Plant Low-Temperature Tolerance and Its Cellular Mechanisms; John Wiley Sons Inc.: Hoboken, NJ, USA, 2014. [Google Scholar]
  64. Guy, C.L.; Huber, J.L.; Huber, S.C. Sucrose phosphate synthase and sucrose accumulation at low temperature. Plant Physiol. 1992, 100, 502–508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Yu, F.; Xu, F.; Wang, H.; Liu, H.; Yu, L.; Shao, X.; Ni, Z. Differences in sucrose metabolism in peach fruit stored at chilling stress versus nonchilling stress temperatures. HortScience 2015, 50, 1542–1548. [Google Scholar] [CrossRef] [Scilit]
  66. Kamal, D.S.; Gaurav, P.; Asha, K. Characterization and differential expression of sucrose and starch metabolism genes in contrasting chickpea (Cicer arietinum L.) genotypes under low temperature. J. Genet. 2021, 100, 71–85. [Google Scholar]
Figure 1. The distribution of SPS gene family members of chromosomes in apple. The left scale indicates the chromosome length (Mb).
Figure 1. The distribution of SPS gene family members of chromosomes in apple. The left scale indicates the chromosome length (Mb).
Agronomy 14 01237 g001
Figure 2. Phylogenetic tree analysis of SPS genes in rice (Os), wheat (Ta), maize (Zm), Arabidopsis thaliana (At), grape (Vv), peach (Ppe), and apple (Md). White triangles represent rice, white circles represent wheat, white stars represent maize, black triangles represent Arabidopsis, black circles represent grapes, black stars represent peaches, and red stars represent apples.
Figure 2. Phylogenetic tree analysis of SPS genes in rice (Os), wheat (Ta), maize (Zm), Arabidopsis thaliana (At), grape (Vv), peach (Ppe), and apple (Md). White triangles represent rice, white circles represent wheat, white stars represent maize, black triangles represent Arabidopsis, black circles represent grapes, black stars represent peaches, and red stars represent apples.
Agronomy 14 01237 g002
Figure 3. Synteny analysis of SPS genes in apple, maize, Arabidopsis thaliana and grape. The gray lines in the background represent collinear blocks in the genomes of apple, maize, Arabidopsis and grape, while the blue lines highlight genetic pairs of the apple SPS genes.
Figure 3. Synteny analysis of SPS genes in apple, maize, Arabidopsis thaliana and grape. The gray lines in the background represent collinear blocks in the genomes of apple, maize, Arabidopsis and grape, while the blue lines highlight genetic pairs of the apple SPS genes.
Agronomy 14 01237 g003
Figure 4. Collinearity analysis of apple SPS gene family. The red lines represent duplicate pairs of MdSPS genes.
Figure 4. Collinearity analysis of apple SPS gene family. The red lines represent duplicate pairs of MdSPS genes.
Agronomy 14 01237 g004
Figure 5. Motif analysis and promoter cis-acting element analysis of apple SPS gene family. (a) Motif analysis of MdSPS proteins. (b) Upstream cis-acting element analysis of 2000bp MdSPS genes. (c) Intron-exon structure of MdSPS genes.
Figure 5. Motif analysis and promoter cis-acting element analysis of apple SPS gene family. (a) Motif analysis of MdSPS proteins. (b) Upstream cis-acting element analysis of 2000bp MdSPS genes. (c) Intron-exon structure of MdSPS genes.
Agronomy 14 01237 g005
Figure 6. Cis-acting element analysis of apple SPS genes. The left abscissa represents the number of MdSPS that the cis-acting element responds to. The right ordinate represents the number of MdSPS in which homeopathic components are grouped. The dot plot at the bottom right represents a collection of cis-acting elements.
Figure 6. Cis-acting element analysis of apple SPS genes. The left abscissa represents the number of MdSPS that the cis-acting element responds to. The right ordinate represents the number of MdSPS in which homeopathic components are grouped. The dot plot at the bottom right represents a collection of cis-acting elements.
Agronomy 14 01237 g006
Figure 7. Correlation analysis of MdSPS genes. T3s represents the amount of the third T of the codon in the amino acid containing the synonymous codon ending in T. C3s represents the amount of the third C of the codon in the amino acid containing the synonymous codon ending in C. A3s represents the amount of the third A of the codon in the amino acid containing the synonymous codon ending in A. G3s represents the amount of the third G of the codon in the amino acid containing the synonymous codon ending in G. CAI stands for codon adaption index. CBI stands for codon bias index. Fop stands for frequency of optimal codon. Nc stands for effective number of codon. GC3s represents the frequency of occurrence of G or C in the third base of the codon. GC represents the amount of G and C in a gene. L_sym stands for number of synonymous codon. L_aa represents total number of amino acids. Gravy stands for grand average of hydrpphilicity. Aromo represents aromaticity of proteins. The darker the circle, the larger the correlation, and vice versa. Blue represents positive correlation, red represents negative correlation, and white represents no correlation.
Figure 7. Correlation analysis of MdSPS genes. T3s represents the amount of the third T of the codon in the amino acid containing the synonymous codon ending in T. C3s represents the amount of the third C of the codon in the amino acid containing the synonymous codon ending in C. A3s represents the amount of the third A of the codon in the amino acid containing the synonymous codon ending in A. G3s represents the amount of the third G of the codon in the amino acid containing the synonymous codon ending in G. CAI stands for codon adaption index. CBI stands for codon bias index. Fop stands for frequency of optimal codon. Nc stands for effective number of codon. GC3s represents the frequency of occurrence of G or C in the third base of the codon. GC represents the amount of G and C in a gene. L_sym stands for number of synonymous codon. L_aa represents total number of amino acids. Gravy stands for grand average of hydrpphilicity. Aromo represents aromaticity of proteins. The darker the circle, the larger the correlation, and vice versa. Blue represents positive correlation, red represents negative correlation, and white represents no correlation.
Agronomy 14 01237 g007
Figure 8. Protein interaction analysis of apple SPS proteins. Nodes represent proteins, and lines between nodes represent interactions between proteins, with different colors corresponding to different types of interactions.
Figure 8. Protein interaction analysis of apple SPS proteins. Nodes represent proteins, and lines between nodes represent interactions between proteins, with different colors corresponding to different types of interactions.
Agronomy 14 01237 g008
Figure 9. Tissue expression analysis of apple SPS genes. Heat map experiments were performed using Gene Chip microarrays from apple tissue expression database (GEO: GSE42873). Red represents high gene expression, and blue represents low gene expression. Flower data were M67, fruit data were M20, leaf data were M14, root data were GD, stem data were X8877, seed data were 4442 × 2596, and seedling data were X4102.
Figure 9. Tissue expression analysis of apple SPS genes. Heat map experiments were performed using Gene Chip microarrays from apple tissue expression database (GEO: GSE42873). Red represents high gene expression, and blue represents low gene expression. Flower data were M67, fruit data were M20, leaf data were M14, root data were GD, stem data were X8877, seed data were 4442 × 2596, and seedling data were X4102.
Agronomy 14 01237 g009
Figure 10. Quantitative expression analysis of SPS gene family in apple. Apple seedlings growing for 40 days were treated with 10% PEG, 200 mmol·L−1 NaCl and 4 °C. The test-tube seedlings treated with distilled water in the growth chamber were used as the control. Three replicates were set for each treatment. The internal reference gene was GAPDH (GenBank accession no.CB973647). Different lowercase letters indicate a significant difference at the 0.05 level, and the same lowercase letter indicates no statistical difference.
Figure 10. Quantitative expression analysis of SPS gene family in apple. Apple seedlings growing for 40 days were treated with 10% PEG, 200 mmol·L−1 NaCl and 4 °C. The test-tube seedlings treated with distilled water in the growth chamber were used as the control. Three replicates were set for each treatment. The internal reference gene was GAPDH (GenBank accession no.CB973647). Different lowercase letters indicate a significant difference at the 0.05 level, and the same lowercase letter indicates no statistical difference.
Agronomy 14 01237 g010
Table 1. Apple SPS family of real-time fluorescent quantitative primers.
Table 1. Apple SPS family of real-time fluorescent quantitative primers.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
GADPHTTCTCGTTGAGGGCTATTCCACCACAGACTTCATCGGTGACA
MdSPS1GGACACGGACTACGAAGGATTGCAGTGCCAGGACATCGGATAGAGG
MdSPS2TTGACCCACTTCCACCCTGAAATTGTCCAGCCTTGCCATTGTGAAGATG
MdSPS3TTGACCCACTTCCACCCTGAAATTGTCCAGCCTTGCCATTGTGAAGATG
MdSPS4TGACTGGATTGGTTGAGTGCTATGCAATGTAACCAGCGACTACGACAAGG
MdSPS5CCTCCTGGCATGGACTTCAGTAATGAACCGCATCACTTCTGACCATATCG
MdSPS6AACTTGCTCGTGCTCTGGCTAATACTGGGTTCACCGTAGCTGGAGTC
MdSPS7TGACACCAAGGGAGAGGGATGAAGCAAGGATGACGCAGCAGCAATTC
MdSPS8ATGGAGATGGGGATGGTGAAGGAGCTGGCAAGGGCAAGTATCATAGGC
MdSPS9CCCTACGCAGAGAAGCAGAAACGATGTCCAGCCTTGCCATTGAGAAG
MdSPS10GTGTGAAGCCAGGAGCCAAGACAGTGTAGACAAGGTTGCATCGGAAG
MdSPS11AACTAATCGAGTGAGCAACGGTGAGCCGCAAGTCATAGCCTCCACAAC
MdSPS12GGGAATCACACAGAGGGCTCAAACCCAATATGCTCGTCGTTCTGCTCAG
MdSPS13CTTCAGGCTCCAGATCCCTCTACCCTCCAGTGTCAGGCAAACCCAAG
MdSPS14ACCAACCTCAGCAGTCCCTCAGTGACGCAGCAGCAATTCCATAGG
MdSPS15GCCGTTTCAGTCCGACTCGTTACATCCGCCAGCACATATTCTCCAAC
MdSPS16GGTGGTTGTCGCTGGAGAATGCAGTTTCGGTTCGTGTGGAGTTGAC
MdSPS17GCCGAGGATGCGATCAAGGAACACCCAATTTGAGTGCCATCAGTGAG
MdSPS18TTCTTGCTCCTTTCGTGGCTCTTGGCACTCTCCGTCAATAAGCTCTTCC
MdSPS19CAGGCGGGCAGGTAGTTTACATTCCCTTGCTTCGGGTATGAGTCTTGTC
Table 2. Physicochemical properties of SPS gene family in apple.
Table 2. Physicochemical properties of SPS gene family in apple.
Gene NameGene AccessionGDRAmino Acid/aaMolecular Weight/DapIInstability IndexAliphatic IndexGrand Average of Hydropathicity
MdSPS1MD02G1022300MDP00002888761055118,220.196.0847.8689.10−0.420
MdSPS2MD02G1100500MDP000016057880692,581.306.0032.6894.08−0.269
MdSPS3MD02G1100600MDP000087226280792,569.296.0531.5194.46−0.269
MdSPS4MD03G1291300-30634,951.076.0232.5783.92−0.158
MdSPS5MD04G1013500MDP00007836761065119,183.486.1542.6083.77−0.481
MdSPS6MD05G1006400MDP00002569651024115,199.996.7646.6288.32−0.444
MdSPS7MD06G1237200-899101,283.996.7937.7785.52−0.270
MdSPS8MD08G1157000-66374,815.076.1746.5085.78−0.492
MdSPS9MD09G1280200-83394,483.076.3734.3687.94−0.300
MdSPS10MD10G1002300-51657,616.616.6943.7095.35−0.296
MdSPS11MD11G1307000MDP000012694681292,891.095.7738.9389.37−0.290
MdSPS12MD13G1164000-30534,488.825.6743.93106.10−0.092
MdSPS13MD13G1164200-63972,997.506.0334.6889.72−0.254
MdSPS14MD14G1244000MDP0000212593898101,084.666.8139.4583.44−0.276
MdSPS15MD15G1127900MDP00001745371057118,011.506.0449.0484.71−0.465
MdSPS16MD15G1164900-1055118,134.126.0947.4089.00−0.412
MdSPS17MD15G1223500MDP000025007080792,371.035.8732.2695.18−0.266
MdSPS18MD16G1164000-85097,377.405.9935.3389.46−0.229
MdSPS19MD17G1287000-84395,854.587.2139.4586.65−0.323
Table 3. Prediction of apple SPS protein subcellular localization.
Table 3. Prediction of apple SPS protein subcellular localization.
ProteinCytoplasmChloroplastNucleusPlasma MembraneMitochondriaPeroxisome
MdSPS13361--
MdSPS27-222-
MdSPS311-2---
MdSPS424-3--
MdSPS54171--
MdSPS64.523.51--
MdSPS72.533.54--
MdSPS8832---
MdSPS9121----
MdSPS1063-111
MdSPS1153-23-
MdSPS12121----
MdSPS1382-22-
MdSPS144232-2
MdSPS156241--
MdSPS163361--
MdSPS176-3-4-
MdSPS1876----
MdSPS19112----
“-“ indicates that the protein is not predicted to be expressed at this site.
Table 4. The secondary structure of SPS protein sequence in apple.
Table 4. The secondary structure of SPS protein sequence in apple.
ProteinAlpha Helix/%Extended Strand/%Beta Turn/%Random Coil/%
MdSPS141.9013.366.4538.29
MdSPS254.4712.416.4526.67
MdSPS354.5212.896.8225.77
MdSPS464.7110.467.5217.32
MdSPS540.6613.246.5739.53
MdSPS641.2114.166.7437.89
MdSPS748.5012.246.4532.81
MdSPS845.5510.866.7936.80
MdSPS952.7012.856.6027.85
MdSPS1034.5019.197.9538.37
MdSPS1152.7113.426.7727.09
MdSPS1244.5915.415.5734.43
MdSPS1352.5813.157.2027.07
MdSPS1449.7812.036.6831.51
MdSPS1540.0213.816.6239.55
MdSPS1642.1813.276.6437.91
MdSPS1754.5212.646.2026.64
MdSPS1852.3513.886.9426.82
MdSPS1952.7911.866.0529.30
Table 5. Apple SPS genes codon RSCU value.
Table 5. Apple SPS genes codon RSCU value.
Amino AcidCondonRSCUAmino AcidCondonRSCU
PheUUU1.053AlaGCU1.388
UUC0.947 GCC0.864
LeuUUA0.762 GCA1.237
UUG1.385 GCG0.508
CUU1.342TyrUAU1.091
CUC0.912 UAC0.909
CUA0.543HisCAU1.237
CUG1.055 CAC0.763
IleAUU1.324GlnCAA1.108
AUC0.867 CAG0.892
AUA0.809AsnAAU1.116
MetAUG1 AAC0.884
ValGUU1.469LysAAA0.902
GUC0.821 AAG1.098
GUA0.561AspGAU1.292
GUG1.149 GAC0.709
SerUCU1.302GluGAA1.018
UCC0.796 GAG0.982
UCA1.306CysUGU0.993
UCG0.554 UGC1.007
AGU1.061TrpUGG1
AGC0.982ArgCGU0.704
ProCCU1.242 CGC0.485
CCC0.811 CGA0.801
CCA1.327 CGG0.545
CCG0.618 AGA1.947
ThrACU1.263 AGG1.519
ACC0.918GlyGGU0.944
ACA1.401 GGC0.889
ACG0.419 GGA1.375
GGG0.79
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, S.; Feng, Y.; Cao, X.; Hu, H.; Yang, J.; Li, W.; Hou, Y.; Ma, Z. Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses. Agronomy 2024, 14, 1237. https://doi.org/10.3390/agronomy14061237

AMA Style

Yang S, Feng Y, Cao X, Hu H, Yang J, Li W, Hou Y, Ma Z. Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses. Agronomy. 2024; 14(6):1237. https://doi.org/10.3390/agronomy14061237

Chicago/Turabian Style

Yang, Shangwen, Yongqing Feng, Xuejing Cao, Huanhuan Hu, Jinghua Yang, Wenfang Li, Yingjun Hou, and Zonghuan Ma. 2024. "Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses" Agronomy 14, no. 6: 1237. https://doi.org/10.3390/agronomy14061237

APA Style

Yang, S., Feng, Y., Cao, X., Hu, H., Yang, J., Li, W., Hou, Y., & Ma, Z. (2024). Functional Analysis of the Apple SPS Gene Family in Response to Abiotic Stresses. Agronomy, 14(6), 1237. https://doi.org/10.3390/agronomy14061237

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop