Transcriptome Analysis and Validation of Anthracnose Resistance Genes in Walnut Varieties
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Methodology
2.2.1. RNA Extraction and cDNA Synthesis
2.2.2. Library Construction and Sequencing
2.2.3. Identification and Functional Annotation of DEGs
2.2.4. qRT-PCR Analysis
2.3. Data Processing and Statistical Analysis
3. Results
3.1. Quality Assessment of Transcriptome Data
3.2. Expression and Functional Annotation of DEGs Involved in Anthracnose Resistance
3.2.1. Differential Gene Expression Analysis
3.2.2. Functional Annotations
3.3. Screening of DEGs Associated with Anthracnose Resistance
3.4. Validation of DEGs Involved in Anthracnose Resistance
3.4.1. Validation of Differential Gene Expression Using Fluorescence Quantitative PCR
3.4.2. Analysis of Differential Gene Expression in the Fruits of Five Walnut Varieties
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Rogério, F.; Van Oosterhout, C.; Ciampi-Guillardi, M.; Correr, F.H.; Hosaka, G.K.; Cros-Arteil, S.; Rodrigues Alves Margarido, G.; Massola Júnior, N.S.; Gladieux, P. Means, motive and opportunity for biological invasions: Genetic introgression in a fungal pathogen. Mol. Ecol. 2023, 32, 2428–2442. [Google Scholar] [CrossRef] [PubMed]
- Fang, H.; Liu, X.; Dong, Y.; Feng, S.; Zhou, R.; Wang, C.; Ma, X.; Liu, J.; Yang, K.Q. Transcriptome and proteome analysis of walnut (Juglans regia L.) fruit in response to infection by Colletotrichum gloeosporioides. BMC Plant Biol. 2021, 21, 249. [Google Scholar] [CrossRef]
- Choub, V.; Ajuna, H.B.; Won, S.-J.; Moon, J.-H.; Choi, S.-I.; Maung, C.E.; Kim, C.-W.; Ahn, Y.S. Antifungal Activity of Bacillus velezensis CE 100 against Anthracnose Disease (Colletotrichum gloeosporioides) and Growth Promotion of Walnut (Juglans regia L.) Trees. Int. J. Mol. Sci. 2021, 22, 10438. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhu, T. Strong Opponent of Walnut Anthracnose–Bacillus velezensis and Its Transcriptome Analysis. Microorganisms 2023, 11, 1885. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Cao, G.; Jiang, S.; Han, S.; Yang, C.; Wan, X.; Zhang, F.; Chen, L.; Xiao, J.; Zhu, P.; et al. Identification of the anthracnose fungus of walnut (Juglans spp.) and resistance evaluation through physiological responses of resistant vs. susceptible hosts. Plant Pathol. 2021, 70, 1219–1229. [Google Scholar] [CrossRef]
- Khelghatibana, F.; Javan-Nikkhah, M.; Safaie, N.; Sobhani, A.; Shams, S.; Sari, E. A reference transcriptome for walnut anthracnose pathogen, Ophiognomonia leptostyla, guides the discovery of candidate virulence genes. Fungal Genet. Biol. 2023, 169, 103828. [Google Scholar] [CrossRef] [PubMed]
- Ma, T.; Yang, C.; Cai, F.; Chen, Z. Morpho-cultural, physiological and molecular characterisation of Colletotrichum nymphaeae causing anthracnose disease of walnut in China. Microb. Pathogen. 2022, 166, 105537. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Yin, Y.Q.; Zhao, L.L.; Xie, Y.Q.; Han, J.; Zhang, Y. Two new species of Colletotrichum (Glomerellaceae, Glomerellales) causing walnut anthracnose in Beijing. MycoKeys 2023, 99, 131–152. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.-H.; Fan, K.; Li, D.-W.; Han, C.-M.; Qu, Y.-Y.; Qi, Y.-K.; Wu, X.-Q. Identification, Virulence and Fungicide Sensitivity of Colletotrichum gloeosporioides s.s. Responsible for Walnut Anthracnose Disease in China. Plant Dis. 2019, 104, 1358–1368. [Google Scholar] [CrossRef]
- Chen, X.; Chen, X.; Tan, Q.; Mo, X.; Liu, J.; Zhou, G. Recent progress on harm, pathogen classification, control and pathogenic molecular mechanism of anthracnose of oil-tea. Front. Microbiol. 2022, 13, 918339. [Google Scholar] [CrossRef]
- Medic, A.; Solar, A.; Hudina, M.; Veberic, R. Phenolic Response to Walnut Anthracnose (Ophiognomonia leptostyla) Infection in Different Parts of Juglans regia Husks, Using HPLC-MS/MS. Agriculture 2021, 11, 659. [Google Scholar] [CrossRef]
- Jeyaraj, A.; Elango, T.; Chen, X.; Zhuang, J.; Wang, Y.; Li, X. Advances in understanding the mechanism of resistance to anthracnose and induced defence response in tea plants. Mol. Plant Pathol. 2023, 24, 1330–1346. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Tan, F.; Zhang, S.; Zhang, T. Combining single-cell RNA sequencing data and transcriptomic data to unravel potential mechanisms and signature genes of the progression of idiopathic pulmonary fibrosis to lung adenocarcinoma and predict therapeutic agents. Funct. Integr. Genom. 2023, 23, 346. [Google Scholar] [CrossRef]
- Jurado, M.; Campa, A.; Ferreira, J.J. Differentially expressed genes against Colletotrichum lindemuthiamum in a bean genotype carrying the Co-2 gene revealed by RNA-sequencing analysis. Front. Plant Sci. 2022, 13, 981517. [Google Scholar] [CrossRef]
- Li, C.; Sun, W.; Cao, S.; Hou, R.; Li, X.; Ming, L.; Kan, J.; Zhao, Y.; Liu, F. The CfMK1 Gene Regulates Reproduction, Appressorium Formation, and Pathogenesis in a Pear Anthracnose-Causing Fungus. J. Fungi 2022, 8, 77. [Google Scholar] [CrossRef] [PubMed]
- Bengtsson-Palme, J.; Hartmann, M.; Eriksson, K.M.; Pal, C.; Thorell, K.; Larsson, D.G.J.; Nilsson, R.H. Metaxa2: Improved identification and taxonomic classification of small and large subunit rRNA in metagenomic data. Mol. Ecol. Resour. 2015, 15, 1403–1414. [Google Scholar] [CrossRef] [PubMed]
- Hadziavdic, K.; Lekang, K.; Lanzen, A.; Jonassen, I.; Thompson, E.M.; Troedsson, C. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers. PLoS ONE 2014, 9, e87624. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Pan, X.-J.; Zhang, W.-E.; Zhang, R.; Chen, J. Stability evaluation of reference genes for quantitative real-time PCR analysis in walnut (Juglans spp.). Plant Physiol. J. 2017, 53, 1795–1802. [Google Scholar]
- Sun, J.; Zhang, J.; Fang, H.; Peng, L.; Wei, S.; Li, C.; Zheng, S.; Lu, J. Comparative transcriptome analysis reveals resistance-related genes and pathways in Musa acuminata banana ‘Guijiao 9’ in response to Fusarium wilt. Plant Physiol. Biochem. 2019, 141, 83–94. [Google Scholar] [CrossRef]
- Shi, Y.; Sheng, Y.; Cai, Z.; Yang, R.; Li, Q.; Li, X.; Li, D.; Guo, X.; Lu, J.; Ye, J.; et al. Involvement of Salicylic Acid in Anthracnose Infection in Tea Plants Revealed by Transcriptome Profiling. Int. J. Mol. Sci. 2019, 20, 2439. [Google Scholar] [CrossRef] [PubMed]
- Pei, T.; Ge, S.; Wang, Z.; Wang, Y.; Liu, C.; Zhang, H.; Xu, X.; Li, D.; Zhao, T. Transcription factor network analysis of the Cf-19-mediated resistance response in tomato infected by Cladosporium fulvum. Sci. Hortic. 2024, 325, 112681. [Google Scholar] [CrossRef]
- Steele, J.F.C.; Hughes, R.K.; Banfield, M.J. Structural and biochemical studies of an NB-ARC domain from a plant NLR immune receptor. PLoS ONE 2019, 14, e0221226. [Google Scholar] [CrossRef] [PubMed]
- Mohanta, T.K.; Yadav, D.; Khan, A.L.; Hashem, A.; Abd_Allah, E.F.; Al-Harrasi, A. Molecular Players of EF-hand Containing Calcium Signaling Event in Plants. Int. J. Mol. Sci. 2019, 20, 1476. [Google Scholar] [CrossRef] [PubMed]
- Xiao, X.; Wang, R.; Khaskhali, S.; Gao, Z.; Guo, W.; Wang, H.; Niu, X.; He, C.; Yu, X.; Chen, Y. A Novel Glycerol Kinase Gene OsNHO1 Regulates Resistance to Bacterial Blight and Blast Diseases in Rice. Front. Plant Sci. 2022, 12, 800625. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Wang, M.; Liu, L.; Hui, X.; Wang, B.; Ma, K.; Yang, X. Improvement of the catalytic performance of glycerol kinase from Bacillus subtilis by chromosomal site-directed mutagenesis. Biotechnol. Lett. 2022, 44, 1051–1061. [Google Scholar] [CrossRef]
- Makino, M.; Shimizu, K.; Kadota, K. Enhanced clustering-based differential expression analysis method for RNA-seq data. MethodsX 2024, 12, 102518. [Google Scholar] [CrossRef]
Reagents | 25 μL System |
---|---|
2 × Taq MasterMIX (Dye) | 12.5 μL |
Forward Primer, 10 μM | 1 μL |
Reverse Primer, 10 μM | 1 μL |
Template DNA | 1 μL |
ddH2O | 9.5 μL |
Steps | Temperature (°C) | Time | |
---|---|---|---|
Preprocessing | 94 | 2 min | |
Denature | 94 | 30 s | 35 cycles |
Anneal | 58 | 30 s | |
Extend | 72 | 45 s | |
Eventually, extend | 72 | 5 min |
Gene ID | Direction of Primers | Primer Sequences (5′-3′) |
---|---|---|
gene13760 | F | TCAAGGGTATTGCGGAAGAC |
R | CATAGTGCTGCCAGTTTTCG | |
gene32437 | F | CTGCAAGTTCCTTTTGAGGC |
R | CGCCATGCTTTTGATCCTTC | |
gene39328 | F | CTACAAAAGACAAGCGCAGG |
R | TTGCTCAATACGACAGTGCT | |
gene40819 | F | AGAGGCTCAGGCGGTAATCG |
R | AATCATGGCTTCGCACTCATCC | |
gene8772 | F | GGCGGGGTTTATTTTGTTCC |
R | CTTCTCCCCAGCATCTTTGT | |
18S rRNA | F | GGTCAATCTTCTCGTTCCCTT |
R | TCGCATTTCGCTACGTTCTT |
Samples | RIN | 28S/18S | OD260/280 | Clean Reads | Clean Bases | GC Content (%) | Q30 (%) |
---|---|---|---|---|---|---|---|
Q1hf-1 | 7.60 | 1.70 | 2.10 | 20,886,798 | 6,247,138,404 | 46.35 | 92.98 |
Q1hf-2 | 7.60 | 1.70 | 2.10 | 21,294,448 | 6,375,348,894 | 46.38 | 92.45 |
Q1hf-3 | 7.80 | 1.80 | 2.20 | 19,402,301 | 5,808,731,446 | 46.29 | 92.11 |
Q1if-1 | 8.30 | 1.60 | 2.20 | 20,968,560 | 6,279,371,888 | 46.52 | 92.72 |
Q1if-2 | 8.50 | 1.70 | 2.20 | 21,485,354 | 6,432,094,444 | 46.92 | 92.69 |
Q1if-3 | 8.70 | 1.80 | 2.10 | 22,697,081 | 6,799,859,402 | 46.31 | 92.81 |
Q2if-1 | 8.80 | 1.80 | 2.10 | 22,136,593 | 6,623,364,056 | 46.73 | 92.92 |
Q2if-2 | 8.80 | 2.00 | 2.10 | 20,575,448 | 6,156,640,896 | 46.38 | 92.51 |
Q2if-3 | 8.40 | 1.70 | 2.10 | 20,114,874 | 6,019,352,870 | 46.29 | 92.94 |
Gene ID | Q1hf vs. Q1if DESeq_log2FC | Q1hf vs. Q2hf DESeq_log2FC | Pfam_Annotation | Swiss-Prot_Annotation | NR_Annotation |
---|---|---|---|---|---|
gene13760 | 1.48 | 1.58 | NB-ARC domain; Leucine-rich repeat | Disease-resistance protein RPM1 | PREDICTED: disease-resistance protein RPM1-like [Juglans regia] |
gene32437 | 2.54 | 1.50 | EF-hand; EF-hand domain; EF-hand; EF-hand domain pair | Probable calcium-binding protein CML48 | PREDICTED: probable calcium-binding protein CML48 [Juglans regia] |
gene39328 | 3.65 | 1.10 | NB-ARC domain | Disease-resistance protein RPM1 | PREDICTED: disease-resistance protein RPP13-like, partial [Juglans regia] |
gene40819 | 2.90 | −1.46 | EF-hand domain pair; EF-hand domain pair; EF-hand; EF-hand domain; EF-hand | Probable calcium-binding protein CML41 | PREDICTED: probable calcium-binding protein CML41 [Juglans regia] |
gene8772 | 1.157188 | −5.14712 | FGGY family of carbohydrate kinases; C-terminal domain | Glycerol kinase | PREDICTED: glycerol kinase-like, partial [Juglans regia] |
Gene ID | Description | Scientific Name | Max Score | Total Score | Query Cover | E Value | Per. Ident | Acc. Len | Accession |
---|---|---|---|---|---|---|---|---|---|
gene13760 | PREDICTED: Juglans microcarpa × Juglans regia disease-resistance protein RPM1-like (LOC121249925), transcript variant X2, mRNA | Juglans microcarpa × Juglans regia | 5282 | 5282 | 99% | 0 | 98.75% | 3032 | XM_041148789.1 |
PREDICTED: Juglans microcarpa × Juglans regia disease-resistance protein RPM1-like (LOC121249925), transcript variant X1, mRNA | Juglans microcarpa × Juglans regia | 5236 | 5236 | 99% | 0 | 98.42% | 3009 | XM_041148788.1 | |
PREDICTED: Carya illinoinensis disease-resistance protein RPM1-like (LOC122305500), mRNA | Carya illinoinensis | 4763 | 4890 | 100% | 0 | 96.53% | 3064 | XM_043118075.1 | |
gene32437 | PREDICTED: Juglans regia probable calcium-binding protein CML48 (LOC108988263), transcript variant X1, mRNA | Juglans regia | 2091 | 2091 | 99% | 0 | 100.00% | 1170 | XM_018961478.2 |
PREDICTED: Juglans regia probable calcium-binding protein CML48 (LOC108988263), transcript variant X2, misc_RNA | Juglans regia | 1749 | 2015 | 95% | 0 | 99.89% | 1127 | XR_001995647.2 | |
PREDICTED: Carya illinoinensis probable calcium-binding protein CML48 (LOC122291228), mRNA | Carya illinoinensis | 1661 | 1661 | 97% | 0 | 93.80% | 1165 | XM_043098874.1 | |
gene39328 | PREDICTED: Juglans regia disease-resistance protein RPP13-like (LOC108995877), partial mRNA | Juglans regia | 3166 | 3166 | 96% | 0 | 99.94% | 1717 | XM_018971520.2 |
PREDICTED: Juglans microcarpa × Juglans regia disease-resistance protein RPM1-like (LOC121246097), mRNA | Juglans microcarpa × Juglans regia | 2662 | 2662 | 95% | 0 | 94.79% | 3280 | XM_041144096.1 | |
PREDICTED: Carya illinoinensis disease-resistance protein RPM1-like (LOC122300288), mRNA | Carya illinoinensis | 2303 | 2303 | 95% | 0 | 91.10% | 3472 | XM_043110813.1 | |
gene40819 | PREDICTED: Juglans regia probable calcium-binding protein CML41 (LOC108997497), mRNA | Juglans regia | 1748 | 1748 | 98% | 0 | 100.00% | 946 | XM_018973814.2 |
PREDICTED: Juglans microcarpa × Juglans regia probable calcium-binding protein CML41 (LOC121247812), mRNA | Juglans microcarpa × Juglans regia | 1557 | 1557 | 97% | 0 | 96.81% | 947 | XM_041146263.1 | |
PREDICTED: Carya illinoinensis probable calcium-binding protein CML41 (LOC122296804), mRNA | Carya illinoinensis | 1459 | 1459 | 97% | 0 | 95.08% | 1130 | XM_043106602.1 | |
gene8772 | PREDICTED: Juglans regia glycerol kinase (LOC108980358), mRNA | Juglans regia | 1411 | 1411 | 99% | 0 | 98.99% | 1939 | XM_018951254.2 |
PREDICTED: Juglans microcarpa × Juglans regia glycerol kinase (LOC121259222), mRNA | Juglans microcarpa × Juglans regia | 1310 | 1310 | 94% | 0 | 98.39% | 1890 | XM_041160735.1 | |
PREDICTED: Carya illinoinensis glycerol kinase (LOC122284433), transcript variant X1, mRNA | Carya illinoinensis | 1264 | 1264 | 95% | 0 | 95.65% | 1902 | XM_043095291.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Wang, Y.; Zhao, L.; Ding, W.; Chen, S.; Li, X.; Li, P. Transcriptome Analysis and Validation of Anthracnose Resistance Genes in Walnut Varieties. Agronomy 2024, 14, 911. https://doi.org/10.3390/agronomy14050911
Li X, Wang Y, Zhao L, Ding W, Chen S, Li X, Li P. Transcriptome Analysis and Validation of Anthracnose Resistance Genes in Walnut Varieties. Agronomy. 2024; 14(5):911. https://doi.org/10.3390/agronomy14050911
Chicago/Turabian StyleLi, Xiuzhen, Yuman Wang, Long Zhao, Wenxuan Ding, Sudan Chen, Xueqiang Li, and Peijie Li. 2024. "Transcriptome Analysis and Validation of Anthracnose Resistance Genes in Walnut Varieties" Agronomy 14, no. 5: 911. https://doi.org/10.3390/agronomy14050911
APA StyleLi, X., Wang, Y., Zhao, L., Ding, W., Chen, S., Li, X., & Li, P. (2024). Transcriptome Analysis and Validation of Anthracnose Resistance Genes in Walnut Varieties. Agronomy, 14(5), 911. https://doi.org/10.3390/agronomy14050911