Leaf Spot Disease of Red Clover Caused by Leptosphaeria weimeri (=Longiseptatispora meliloti) in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Field Survey, Diseased Leaf Collection, and Pathogen Isolation
2.2. Morphological and Molecular Characterization
2.3. Biological Characteristics
2.4. Greenhouse Pathogenicity Tests
2.5. Sensitivity Testing of Fungicides
3. Results
3.1. Disease Survey
3.2. Isolation and Identification of the Pathogen
3.3. Biological Characteristics
3.4. Pathogenicity Testing
3.5. Effects of Eight Fungicides and Antibiotics on Mycelia Growth
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- McKenna, P.; Cannon, N.; Conway, J.; Dooley, J. The use of red clover (Trifolium pratense) in soil fertility-building: A Review. Field Crop. Res. 2018, 221, 38–49. [Google Scholar] [CrossRef] [Scilit]
- Coulman, B.E.; Lambert, M. Selection for resistance to root rot caused by Fusarium spp. in red clover (Trifolium pratense L.). Can. J. Plant Sci. 1995, 75, 141–146. [Google Scholar] [CrossRef] [Scilit]
- Jacob, I.; Hartmann, S.; Struck, C. Response of different fodder legume species to Colletotrichum trifolii. Crop. Pasture Sci. 2016, 67, 1110–1115. [Google Scholar] [CrossRef] [Scilit]
- Hartmann, S.; Schubiger, F.X.; Grieder, C.; Wosnitza, A. A decade of variety testing for resistance of red clover to southern anthracnose (Colletotrichum trifolii) at the Bavarian state research center for agriculture. Agriculture 2022, 12, 249. [Google Scholar] [CrossRef] [Scilit]
- Bhardwaj, N.R.; Banyal, D.K.; Roy, A.K. Integrated management of crown rot and powdery mildew diseases affecting red clover (Trifolium pratense L.). Crop. Prot. 2022, 156, 105943. [Google Scholar] [CrossRef] [Scilit]
- Ariyawansa, H.A.; Phukhamsakda, C.; Thambugala, K.M.; Bulgakov, T.S.; Wanasinghe, D.N.; Perera, R.H.; Mapook, A.; Camporesi, E.; Kang, C.J.; Jones, E.B. Revision and phylogeny of Leptosphaeriaceae. Fungal Divers. 2015, 74, 19–51. [Google Scholar] [CrossRef] [Scilit]
- Rouxel, T.; Balesdent, M.H. The stem canker (blackleg) fungus, Leptosphaeria maculans, enters the genomic era. Mol. Plant Pathol. 2005, 6, 225–241. [Google Scholar] [CrossRef] [Scilit]
- Roustaee, A.; Costes, S.; Dechamp-Guillaume, G.; Barrault, G. Phenotypic variability of Leptosphaeria lindquistii (anamorph: Phoma macdonaldii), a fungal pathogen of sunflower. Plant Pathol. 2000, 49, 227–234. [Google Scholar] [CrossRef] [Scilit]
- Sprague, S.J.; Kirkegaard, J.A.; Howlett, B.J.; Graham, J. Effect of root rot and stem canker caused by Leptosphaeria maculans on yield of Brassica napus and measures for control in the field. Crop. Pasture Sci. 2009, 61, 50–58. [Google Scholar] [CrossRef] [Scilit]
- Howlett, B.J.; Idnurm, A.; Pedras, M.S.C. Leptosphaeria maculans, the causal agent of blackleg disease of Brassicas. Fungal Genet. Biol. 2001, 33, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Descorps, C.; Hebrard, C.; Rakotonindraina, T.; Dechamp-Guillaume, G.; Mestries, E.; Aubertot, J.N. Advances in Phoma macdonaldii (Leptosphaeria lindquistii) epidemiology. In Proceedings of the 18 International Conference on Sunflower, Barcarce, Argentina, 27 February–1 March 2012; p. 203. [Google Scholar]
- Claassen, B.J.; Thomas, W.J.; Mallory-Smith, C.; Ocamb, C.M. First report of Rorippa curvisiliqua as a host for Leptosphaeria spp. (black leg) in North America. Plant Dis. 2017, 101, 1328. [Google Scholar] [CrossRef] [Scilit]
- Mendes-Pereira, E.; Balesdent, M.H.; Hortense, B.R.U.N.; Rouxel, T. Molecular phylogeny of the Leptosphaeria maculans–L. biglobosa species complex. Mycol. Res. 2003, 107, 1287–1304. [Google Scholar] [CrossRef] [Scilit]
- Câmara, M.P.S.; Palm, M.E.; van Berkum, P.; O’Neill, N.R. Molecular phylogeny of Leptosphaeria and Phaeosphaeria. Mycologia 2002, 94, 630–640. [Google Scholar] [CrossRef] [Scilit]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Schindel, D. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [Scilit]
- Aveskamp, M.M.; Woudenberg, J.H.; De Gruyter, J.; Turco, E.; Groenewald, J.Z.; Crous, P.W. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): A case study in the Phoma exigua species complex. Mol. Plant Pathol. 2009, 10, 403–414. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Jiang, J.R.; Zhang, G.Z.; Cai, L.; Crous, P.W. Resolving the Phoma enigma. Stud. Mycol. 2015, 82, 137–217. [Google Scholar] [CrossRef] [Scilit]
- Armstrong, K.F.; Ball, S.L. DNA Barcodes for biosecurity: Invasive species identification. Philos. Trans. R. Soc. B 2005, 360, 1813–1823. [Google Scholar] [CrossRef] [Scilit]
- Dilmaghani, A.; Balesdent, M.H.; Didier, J.P.; Wu, C.; Davey, J.; Barbetti, M.J.; Rouxel, T. The Leptosphaeria maculans–Leptosphaeria biglobosa species complex in the American continent. Plant Pathol. 2009, 58, 1044–1058. [Google Scholar] [CrossRef] [Scilit]
- Hou, L.W.; Groenewald, J.Z.; Pfenning, L.H.; Yarden, O.; Crous, P.W.; Cai, L. The phoma-like dilemma. Stud. Mycol. 2020, 96, 309–396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, K.K.; Singh, U.S.; Sharma, P.; Kumar, A.; Sharma, L. Seed treatments for sustainable agriculture—A review. J. Appl. Nat. Sci. 2015, 7, 521–539. [Google Scholar] [CrossRef] [Scilit]
- Lager, J.; Gerhardson, B. Pathogenicity of clover root pathogens to pea, bean and lucerne. J. Plant Dis. Protect. 2002, 2, 142–151. [Google Scholar]
- Gao, P.; Nan, Z.B.; Christensen, M.J.; Barbetti, M.J.; Duan, T.Y.; Liu, Q.T.; Meng, F.J.; Huang, J.F. Factors influencing rust (Melampsora apocyni) intensity on cultivated and wild Apocynum venetum in Altay Prefecture, China. Phytopathology 2019, 109, 593–606. [Google Scholar] [CrossRef] [Scilit]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [Scilit]
- Sung, G.H.; Sung, J.M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef] [Scilit]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [Scilit]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.L.; Zheng, X.R.; Chen, F.M. Dieback and Leaf Spot in Box Elder (Acer negundo) Caused by Exserohilum rostratum. Plant Dis. 2021, 105, 2955–2963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, L.; Zhang, L.; Yang, X.X.; Huang, X.; Zhou, X.; White, J.F.; Liu, Y.; Li, C. Characterization, phylogenetic analyses, and pathogenicity of Colletotrichum species on Morus alba in Sichuan Province, China. Plant Dis. 2019, 103, 2624–2633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.Q.; Song, L.L.; Xu, X.M.; Zou, X.H.; Duan, K.; Gao, Q.H. Characterization and fungicide sensitivity of Colletotrichum species causing strawberry anthracnose in eastern China. Plant Dis. 2020, 104, 1960–1968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, T.; Wu, X.; Dai, Y.; Yin, X.; Zhao, Z.; Zhang, Z.; Li, W.; He, L.; Long, Y. Sensitivity testing of natural antifungal agents on Fusarium fujikuroi to investigate the potential for sustainable control of kiwifruit leaf spot disease. J. Fungi 2022, 8, 239. [Google Scholar] [CrossRef] [Scilit]
- Shoemaker, R.A.; Babcock, C.E.; Irwin, J.A.G. Massarina walkeri n. sp., the teleomorph of Acrocalymma medicaginis from Medicago sativa contrasted with Leptosphaeria pratensis, L. weimeri n. sp., and L. viridella. Can. J. Bot. 2011, 69, 569–573. [Google Scholar] [CrossRef] [Scilit]
- Boerema, G.H.; de Gruyter, J.; Noordeloos, M.E.; Hamers, M.E.C. Phoma Identification Manual Differentiation of Species and Infra-Specific Taxa in Culture; CABI Publishing: Wallingford, UK, 2004; p. 417. [Google Scholar]
- Lucas, M.T.; Webster, J. Conidial states of British species of Leptosphaeria. Trans. Br. Mycol. Soc. 1967, 50, 85–121. [Google Scholar]
- Kövics, G.J.; Irinyi, L.; Rai, M. Overview of Phoma-like fungi on important legumes (Papilionaceous Plants). In Phoma: Diversity, Taxonomy, Bioactivities, and Nanotechnology; Springer: Cham, Switzerland, 2022; pp. 65–89. [Google Scholar]
- Shang, H. Research brief on leaf spot disease in white clover caused by Stagonospora meliloti. Acta Prataculturae Sin. 1994, 3, 81. [Google Scholar]
- Irwin, J.A.G.; Mackie, J.M.; Marney, T.S.; Musial, J.M.; Roberts, S. Incidence of Stagonaspora meliloti and Acracalymma medicaginis in lucerne crowns and roots in eastern Australia, their comparative aggressiveness to lucerne and inheritance of reaction to S. meliloti in lucerne. Australas. Plant Path. 2004, 33, 61–67. [Google Scholar] [CrossRef] [Scilit]
- Musial, J.M.; Mackie, J.M.; Armour, D.J.; Phan, H.T.T.; Ellwood, S.E.; Aitken, K.S.; Irwin, J.A.G. Identification of QTL for resistance and susceptibility to Stagonospora meliloti in autotetraploid lucerne. Theor. Appl. Genet. 2007, 114, 1427–1435. [Google Scholar] [CrossRef] [Scilit]
- Albrecht, H.R. Effect of disease upon survival of white clover, Trifolium repens L., in Alabama. Agron. J. 1942, 34, 725–730. [Google Scholar] [CrossRef] [Scilit]
- Taylor, J.L. A simple, sensitive, and rapid method for detecting seed contaminated with highly virulent Leptosphaeria maculans. Appl. Environ. Microb. 1993, 59, 3681–3685. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; White, R.P.; Demir, E.; Jedryczka, M.; Lange, R.M.; Islam, Z.; Li, J.Q.; Huang, A.M.; Hall, G.; Zhou, Z. Leptosphaeria spp., phoma stem canker and potential spread of L. maculans on oilseed rape crops in China. Plant Pathol. 2014, 63, 598–612. [Google Scholar] [CrossRef] [Scilit]
- Bonde, M.R.; Nester, S.E.; Berner, D.K. Effects of daily temperature highs on development of Phakopsora pachyrhizi on soybean. Phytopathology 2012, 102, 761–768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayorquin, J.S.; Wang, D.H.; Twizeyimana, M.; Eskalen, A. Identification, distribution, and pathogenicity of Diatrypaceae and Botryosphaeriaceae associated with citrus branch canker in the southern California desert. Plant Dis. 2016, 100, 2402–2413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morton, V.; Staub, T. A short history of fungicides. APSnet Features 2008, 308, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Vandenbosch, D.; Braeckmans, K.; Nelis, H.J.; Coenye, T. Fungicidal activity of miconazole against Candida spp. biofilms. J. Antimicrob. Chemoth. 2010, 65, 694–700. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Guan, A.; Xia, X.; Sun, X.; Wei, S.; Yang, J.; Wang, J.; Li, Z.; Lan, J.; Liu, C. Design, synthesis, and structure–activity relationship of new arylpyrazole pyrimidine ether derivatives as fungicides. J. Agric. Food Chem. 2019, 67, 11893–11900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teramoto, A.; Meyer, M.C.; Suassuna, N.D.; Cunha, M.G.D. In vitro sensitivity of Corynespora cassiicola isolated from soybean to fungicides and field chemical control of target spot. Summa Phytopathol. 2017, 43, 281–289. [Google Scholar] [CrossRef] [Scilit]
- Camiletti, B.X.; Lichtemberg, P.S.; Paredes, J.A.; Carraro, T.A.; Velascos, J.; Michailides, T.J. Characterization, pathogenicity, and fungicide sensitivity of Alternaria isolates associated with preharvest fruit drop in California citrus. Fungal Biol. 2022, 126, 277–289. [Google Scholar] [CrossRef] [Scilit]






| Gene | Primer | Sequence (5′-3′) | References |
|---|---|---|---|
| nrSSU | NS1 | GTAGTCATATGCTTGTCTC | [25,26] |
| NS4 | CTTCCGTCAATTCCTTTAAG | ||
| nrLSU | LR0R | GTACCCGCTGAACTTAAGC | [27] |
| LR5 | ATCCTGAGGGAAACTTC | ||
| ITS | ITS4 | TCCTCCGCTTATTGATATGC | [24] |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG |
| Taxon | Culture Strains | LSU | ITS | SSU |
|---|---|---|---|---|
| Didymella exigua | GU237794.1 | EU754155.1 | GU237794.1 | EU754056.1 |
| Leptosphaeria conoidea | JF740201.1 | JF740279.1 | JF740201.1 | JF740099.1 |
| Leptosphaeria doliolum | KT454727.1 | KT454719.1 | KT454727.1 | KT454734.1 |
| Leptosphaeria doliolum | JF740205.1 | GQ387576.1 | JF740205.1 | GU296159.1 |
| Leptosphaeria ebuli | NR_155323.1 | KP744488.1 | NR_155323.1 | KP753954.1 |
| Leptosphaeria regiae | MN244201.1 | MN244171.1 | MN244201.1 | MN244177.1 |
| Leptosphaeria slovacica | JF740247.1 | JF740315.1 | JF740247.1 | JF740101.1 |
| Leptosphaeria sydowii | MT185517.1 | MT183480.1 | MT185517.1 | MT214959.1 |
| Leptosphaeria urticae | OQ401052.1 | OQ411135.1 | OQ401052.1 | OQ411131.1 |
| Leptosphaeria urticae | MK123333.1 | MK123332.1 | MK123333.1 | MK123329.1 |
| Longiseptatispora meliloti | MT223814.1 | MT223909.1 | MT223814.1 | - |
| Neophaeosphaeria filamentosa | JF740259.1 | GQ387577.1 | JF740259.1 | GQ387516.1 |
| Paraleptosphaeria rubi | KT454726.1 | KT454718.1 | KT454726.1 | KT454733.1 |
| Phoma herbarum | FJ427022.1 | KF251715.1 | FJ427022.1 | EU754087.1 |
| Plenodomus chrysanthemi | NR_111622.1 | GU238151.1 | NR_111622.1 | GU238230.1 |
| Plenodomus guttulatus | KT454721.1 | KT454713.1 | KT454721.1 | KT454729.1 |
| Plenodomus salviae | KT454725.1 | KT454717.1 | KT454725.1 | KT454732.1 |
| Plenodomus visci | NR_119957.1 | EU754195.1 | NR_119957.1 | EU754096.1 |
| Growth Condition | Growth Rate (mm/20 d) | Spore Production (×105/mL) | |
|---|---|---|---|
| Culture media | PDA | 9.13 ± 0.64 c | 7.94 a |
| PSA | 11.28 ± 0.94 a | - | |
| WA | 8.05 ± 0.81 d | - | |
| Czapek | 8.14 ± 0.40 d | - | |
| CMA | 7.9 ± 0.57 d | 3.88 b | |
| OMA | 9.67 ± 0.30 b | 0.56 c | |
| pH values | 10 | 26.34 ± 1.86 c | - |
| 8 | 32.19 ± 1.17 b | 0.08 c | |
| 7 | 38.55 ± 1.03 a | 6.70 a | |
| 6 | 8.79 ± 0.73 e | 2.69 b | |
| 4 | 14.53 ± 0.89 d | - | |
| Temperatures (°C) | 5 | 3.00 ± 0.00 e | - |
| 10 | 6.65 ± 0.50 d | - | |
| 15 | 7.95 ± 0.61 c | 4.56 b | |
| 20 | 13.71 ± 0.33 a | 4.44 b | |
| 25 | 8.81 ± 0.74 b | 7.94 a | |
| 30 | 3.00 ± 0.00 e | - | |
| Carbon source | Sucrose | 8.14 ± 0.40 c | - |
| Glucose | 9.50 ± 0.64 a | - | |
| Sorbitol | 8.24 ± 1.01 bc | - | |
| Fructose | 8.60 ± 0.43 bc | - | |
| Lactose | 8.37 ± 0.40 bc | - | |
| Galactose | 6.20 ± 0.48 d | - | |
| Soluble starch | 8.35 ± 0.35 bc | - | |
| Maltose | 8.85 ± 0.47 b | - | |
| Nitrogen source | KNO3 | 8.14 ± 0.40 c | - |
| Peptone | 9.97 ± 0.57 a | - | |
| NH4Cl | 6.87 ± 0.47 d | - | |
| NH4H2PO4 | 7.88 ± 0.57 c | - | |
| Urea | 3.00 ± 0.00 f | - | |
| (NH4)2SO4 | 5.71 ± 0.36 e | - | |
| Glycine | 9.67 ± 0.50 a | - | |
| NaNO3 | 9.17 ± 0.40 b | - |
| Fungicides | Concentration (mg/L) | Colony Diameters (mm) | Inhibition Rate (%) |
|---|---|---|---|
| CK | 0 | 18.18 | - |
| 450 g/L Prochloraz | 0.0064 | 17.68 ± 0.40 a | 2.75 ± 2.25 e |
| 0.032 | 14.63 ± 0.55 b | 19.53 ± 3.15 d | |
| 0.16 | 9.29 ± 0.88 c | 48.91 ± 4.98 c | |
| 0.8 | 8.24 ± 0.23 d | 54.69 ± 1.03 b | |
| 4 | 7.32 ± 0.31 e | 59.73 ± 1.86 a | |
| 10% Difenoconazole | 0.0064 | 17.17 ± 0.39 a | 5.59 ± 2.55 e |
| 0.032 | 13.98 ± 0.27 b | 23.10 ± 1.41 d | |
| 0.16 | 11.72 ± 0.53 c | 35.53 ± 3.14 c | |
| 0.8 | 8.23 ± 0.35 d | 54.74 ± 1.94 b | |
| 4 | 7.58 ± 0.25 e | 58.33 ± 1.47 a | |
| 50% Carbendazim | 0.032 | 17.04 ± 0.17 a | 6.28 ± 0.08 e |
| 0.16 | 15.05 ± 0.89 b | 17.22 ± 0.50 d | |
| 0.8 | 12.86 ± 0.14 c | 29.29 ± 0.80 c | |
| 4 | 10.60 ± 0.36 d | 41.69 ± 2.13 b | |
| 20 | 6.88 ± 0.21 e | 62.18 ± 1.17 a | |
| 70% Thiophanate-methyl | 0.16 | 18.05 ± 0.16 a | 0.72 ± 0.01 e |
| 0.8 | 16.55 ± 0.42 b | 8.99 ± 2.40 d | |
| 4 | 15.56 ± 0.54 c | 14.45 ± 2.81 c | |
| 20 | 11.57 ± 0.71 d | 36.37 ± 4.10 b | |
| 100 | 7.08 ± 0.28 e | 61.08 ± 1.47 a | |
| 250 g/L Azoxystrobin | 0.16 | 12.44 ± 0.40 a | 31.57 ± 2.01 e |
| 0.8 | 10.44 ± 0.40 b | 42.57 ± 2.01 d | |
| 4 | 9.71 ± 0.22 c | 46.61 ± 1.03 c | |
| 20 | 8.63 ± 0.43 d | 52.53 ± 2.34 b | |
| 100 | 6.92 ± 0.34 e | 61.94 ± 2.23 a | |
| 6% Kasugamycin | 0.08 | 15.58 ± 0.48 a | 14.32 ± 2.71 e |
| 0.4 | 14.72 ± 0.30 b | 19.04 ± 1.41 d | |
| 2 | 13.63 ± 0.25 c | 25.02 ± 1.41 c | |
| 10 | 12.21 ± 0.36 d | 32.83 ± 2.14 b | |
| 50 | 10.23 ± 0.47 e | 43.74 ± 2.73 a | |
| 80% Ethylicin | 0.08 | 17.03 ± 0.21 a | 6.33 ± 1.03 e |
| 0.4 | 15.61 ± 0.51 b | 14.15 ± 2.73 d | |
| 2 | 13.35 ± 0.41 c | 26.56 ± 2.43 c | |
| 10 | 11.19 ± 0.57 d | 38.48 ± 3.01 b | |
| 50 | 8.18 ± 0.28 e | 55.04 ± 1.79 a | |
| 0.3% Tetramycin | 0.08 | 16.76 ± 0.62 a | 7.84 ± 3.40 d |
| 0.4 | 14.73 ± 0.32 ab | 18.98 ± 1.60 cd | |
| 2 | 13.14 ± 0.38 bc | 27.72 ± 2.16 bc | |
| 10 | 11.89 ± 3.81 c | 34.63 ± 20.99 b | |
| 50 | 6.75 ± 0.29 d | 62.89 ± 1.67 a |
| Fungicides | Regression Equation | r | EC50(mg/L) | 95% Confidence Intervals |
|---|---|---|---|---|
| 450 g/L Prochloraz | y = 0.2133x + 0.5410 | 0.9527 | 0.6424 | 0.4421–0.9970 |
| 10% Difenoconazole | y = 0.1962x + 0.5107 | 0.9845 | 0.8821 | 0.7781–0.9990 |
| 50% Carbendazim | y = 0.1949x + 0.3322 | 0.9913 | 7.2611 | 0.8690–0.9995 |
| 70% Thiophanate-methyl | y = 0.2119x + 0.1157 | 0.9588 | 65.1029 | 0.4965–0.9974 |
| 250 g/L Azoxystrobin | y = 0.1012x + 0.4096 | 0.9884 | 7.8217 | 0.8298–0.9993 |
| 6% Kasugamycin | y = 0.1039x + 0.2386 | 0.9863 | 328.0198 | 0.8008–0.9991 |
| 80% Ethylicin | y = 0.1742x + 0.2287 | 09926 | 36.0911 | 0.8883–0.9995 |
| 0.3% Tetramycin | y = 0.1799x + 0.2500 | 0.9588 | 24.5301 | 0.4970–0.9974 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, R.; Nan, Z.; Duan, T. Leaf Spot Disease of Red Clover Caused by Leptosphaeria weimeri (=Longiseptatispora meliloti) in China. Agronomy 2024, 14, 1055. https://doi.org/10.3390/agronomy14051055
Zheng R, Nan Z, Duan T. Leaf Spot Disease of Red Clover Caused by Leptosphaeria weimeri (=Longiseptatispora meliloti) in China. Agronomy. 2024; 14(5):1055. https://doi.org/10.3390/agronomy14051055
Chicago/Turabian StyleZheng, Rongchun, Zhibiao Nan, and Tingyu Duan. 2024. "Leaf Spot Disease of Red Clover Caused by Leptosphaeria weimeri (=Longiseptatispora meliloti) in China" Agronomy 14, no. 5: 1055. https://doi.org/10.3390/agronomy14051055
APA StyleZheng, R., Nan, Z., & Duan, T. (2024). Leaf Spot Disease of Red Clover Caused by Leptosphaeria weimeri (=Longiseptatispora meliloti) in China. Agronomy, 14(5), 1055. https://doi.org/10.3390/agronomy14051055

