Next Article in Journal
Genetic Characterization of European Plum (Prunus domestica L.) Accessions from Norway Using ECPGR-Selected SSR Markers
Previous Article in Journal
Effects of Bacillus subtilis on Rose Growth Promotion and Rhizosphere Microbial Community Changes under Saline–Alkaline Stress
Previous Article in Special Issue
QTL Mapping by Chromosome Segment Substitution Lines (CSSLs) Reveals Candidate Gene Controlling Leaf Sucrose Content in Soybean (Glycine max (L.) Merr.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 4
10.3390/agronomy14040731
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Overexpression of Chalcone Isomerase-like Genes, GmCHI4A and GmCHI4B, Enhances Salt Tolerance of Cotyledon Hairy Roots and Composite Plant in Soybean (Glycine max (L.) Merr.)

by
Jinhao Zhang
†,
Ying Wang
†,
Jingwen Li
,
Youcheng Zhu
,
Le Wang
,
Zhiqi Li
,
Yajing Liu
,
Fan Yan
and
Qingyu Wang
*
College of Plant Science, Jilin University, Xi’an Road, Changchun 130062, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2024, 14(4), 731; https://doi.org/10.3390/agronomy14040731
Submission received: 5 February 2024 / Revised: 15 March 2024 / Accepted: 27 March 2024 / Published: 1 April 2024
(This article belongs to the Special Issue New Advances in Soybean Molecular Biology)
Browse Figures
Versions Notes

Abstract

:
Chalcone isomerase (CHI) is an important enzyme involved in the biosynthesis of flavonoids, one that is crucial in both plant defense and human health. Although many CHI genes have been previously identified, the function of CHI-like genes in soybean remains unclear. In this study, we cloned the CHI-like genes GmCHI4A and GmCHI4B (GmCHI4s) in soybean. The real-time quantitative polymerase chain reaction showed that GmCHI4s were expressed primarily in soybean root, but were also present in other tissues, including the stem, leaf, and seed with a low expression level. Overexpression of GmCHI4s was able to significantly improve some beneficial traits of the transformed hair roots of cotyledon or composite plants under salt stress conditions. Root length, root wet weight, and the underground biomass was increased, and the elevation of MDA content was inhibited under 100 mmol L−1 or 150 mmol L−1 NaCl treatment. Leaf chlorophyll content was elevated in overexpressed GmCHI4A composite plants under 150 mmol L−1 NaCl treatment. The expression levels of salt-stress-related genes GmSOD1, GmAPX1, GmSOS1, and GmNHX1 were significantly upregulated in overexpressed GmCHI4 hairy roots compared to that in empty-vector-expressed hairy roots. The above results indicated GmCHI4s’ potential action against salt stress. Furthermore, overexpression of GmCHI4A and GmCHI4B increased the total isoflavone content by six times and three times, respectively. Glycitin and glycitein levels were significantly elevated in the overexpressed GmCHI4A hairy roots, while glycitin, genistin, daidzein, and genistein were significantly increased in overexpressed GmCHI4B hairy roots. This study identified a new function of the CHI-like gene, as well as providing a new selected gene for salt tolerance and isoflavone improvement using biotechnological approaches in soybean.

1. Introduction

Soybean (Glycine max) is a significant economic oil crop, being the main source of edible plant oil and protein. Salt stress has a key impact on soybean production and quality [1]. Understanding the genetic and regulatory processes of salt tolerance in soybean, as well as producing appropriate soybean cultivars, is therefore important. Salt stress hinders the normal physiology of plants by the simultaneous induction of multiple stressors [2]. Osmotic stress, secondary stress, and ionic stress are the three routes by which salt induces stress [3]. The dynamic equilibrium of ion distribution and water potential in plant cells can be upset by high salt concentrations, leading to the dehydration of green plants, cell necrosis, and hindering normal plant growth [4]. Reactive oxygen species (ROS) can be overproduced by osmotic stress in plant cells, causing oxidative damage to plants [5]. Flavonoids play an important role in helping plants resist salt stress by scavenging ROS and counteracting oxidative damage [6].
As a secondary metabolite of plants, flavonoids synthesis is mainly divided into two stages [7]. The first stage is the biosynthesis of stilbenoids: Phenylalanine (Phe) serves as the most primitive substrate for synthesizing flavonoids. Under the effect of phenylalanine ammonia lyase (PAL), phenylalanine is deaminated, resulting in the formation of cinnamic acid. Subsequently, cinnamic acid is catalyzed by cinnamate 4-hydroxylase (C4H) to produce p-coumaric acid, which is further converted to p-coumaroyl-CoA through the action of 4-coumarate-CoA ligase (4CL) [8]. The second stage consists of three steps in the biosynthesis of flavonoids: Firstly, p-coumaroyl-CoA is catalyzed by chalcone synthase (CHS) to generate naringenin, which enters the pathway of flavonoid synthesis. Simultaneously, p-coumaroyl-CoA is reduced by chalcone reductase (CHR) to produce liquiritigenin. Then, naringenin or liquiritigenin is converted by chalcone isomerase (CHI) to yield either hesperetin or isoliquiritigenin, respectively. Among them, hesperetin competes with isoliquiritigenin as a substrate for the production of flavonoids. Finally, either hesperetin or isoliquiritigenin undergoes catalysis by isoflavone synthase (IFS) to generate genistein, daidzein, and glycitein. Subsequently, through the catalytic action of uridine diphosphate glycosyltransferases (UGT), acyltransferases (AT), and malonyltransferases (MT), the formation of glucoside, acylglucoside, and malonylglucoside derivatives of flavonoids occurs [9].
CHI is the second rate-limiting enzyme catalyzing the intramolecular and stereospecific cyclization of chalcones to yield flavonoids, including flavonols, flavanonols, flavones, flavanones, chalcones, anthocyanidin, and isoflavones [10]. These substances are crucial to many biological processes that occur in plants during their growth and development. For example, flavonoids are attributed to salt resistance [11,12], UV protection [13,14], plant color formation [15,16,17,18], insect and pathogen resistance [19,20,21,22], pollen development [23,24], male fertility [25], plant hormone transportation [26], and cell cycle regulation [27,28,29]. Notably, stress-induced OsCHI2 gene expression can upregulate the whole flavonoid biosynthesis pathway structural genes, resulting in significant physiological and biochemical alterations that can confer a promising level of tolerance to abiotic stress [30]. In particular, isoflavones are used as signaling molecules in the legume–rhizobia interaction system to convert nitrogen into useful ammonia in plants [31,32,33]. In addition, flavonoids play important roles in disease prevention and therapy [34]. Many of them possess anti-inflammatory [35,36], anti-oxidation [37,38], anti-tumor [39,40], immunity regulation [41], and skin anti-aging [42] properties. Isoflavones, found in leguminous plants, are called phytoestrogens because they have structures and functions similar to human estrogen [43].
CHI family genes are widely identified in different species. More than 3000 CHI nucleotide sequences have been registered and classified in the GenBank [10]. The CHI superfamily is divided into four types, depending on the CHI-fold proteins [44]: types I, II, III, and IV. Type I CHIs, found in all vascular plants, can only isomerise 6′-hydroxychalcone to (2S)-naringenin (5-hydroxyflavanone) [44]. Type II CHIs are found in legumes and convert both 6-deoxychalcone and 6′-hydroxychalcone to (2S)-liquiritigenin (5-hydroxyflavanone) and (2S)-naringenin, respectively [45]. Type III CHIs, called fatty-acid-binding proteins (FAPs) in Arabidopsis, have been shown to influence fatty acid synthesis in plant cells and their storage in growing embryos [46]. Type IV CHIs, called “chalcone isomerase-like”, are found only in land plants [47]. They can increase flavonoid production in some flowering plants as enhancers of flavonoid production in petunia and Arabidopsis [48].
There are 12 GmCHIs in soybean. Among them, GmCHI1A, GmCHI1B1, and GmCHI1B2, belong to type II. GmCHI2 belongs to type I. GmCHI3A1, GmCHI3A2, GmCHI3B1, GmCHI3B2, GmCHI3C1, and GmCHI3C2 belong to type III. GmCHI4A and GmCHI4B (GmCHI4s) belong to type IV [49]. Until now, the functions of GmCHI4s have not been elucidated in soybean.
In this study, GmCHI4s were cloned and overexpressed under the 35S promoter of the cauliflower mosaic virus (CaMV) in cotyledon hairy roots and composite soybean plants. The phenotypes were then analyzed under different salt treatment conditions. The main objective of the study was to identify whether GmCHI4s are associated with salt tolerance and isoflavone production in soybean.

2. Materials and Methods

2.1. Plant Materials

Glycine max ‘Williams 82′ seeds and plants were used for cloning and expression analysis of GmCHI4s. GmCHI4s were transformed into composite plants and cotyledon hairy roots using seeds (Glycine max ‘Jilin35’), and 24 positive composite plants of each GmCHI4 gene were used for the salt tolerance test.

2.2. Isolation and Sequence Analysis of GmCHI4 Genes

The following pairs of primers were designed for amplifying GmCHI4A (630 bp) and GmCHI4B (663 bp) open reading frame (ORF), respectively: F: 5′-CGCGGATCCGTCTCTATCTCAATCT-3′, R: 5′ACGCGTCGACAGATTATTACACCAT-3′ and F: 5′ATCAACTTGCTCTACCTACC-3′, R: 5′-ACTACACAACTTAGCAACACAA-3′. PCR was performed as follows: 95 °C for 5 min; 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 45 s, retaining 32 cycles; followed by a final extension at 72 °C for 10 min. After cloning, the sample was inserted into the pMD-18T cloning vector (TaKaRa, Dalian, China), and the amplified fragments were sequenced to ensure accuracy (Comate Bioscience Co., Ltd., Changchun, China).
Gene sequences were searched for and compared using NCBI (https://www.ncbi.nlm.nih.gov/, accessed on 10 September 2022). We used the GmGDB (http://www.plantgdb.org/GmGDB/, accessed on 10 September 2022) search for the GmCHI4 genome sequence and introns. DNAMAN version 9.0 software was used for sequence consistency. Protparam (http://web.expasy.org/protparam/, accessed on 15 September 2022) was used to predict and analyze physical and chemical properties such as protein amino acid composition, molecular weight, and isoelectric point.

2.3. RNA Extraction and qRT-PCR Performance

Total RNA was extracted from soybean roots, stems, leaves, and seeds using the RNA plant Plus Reagent (Tiangen, Changchun, China) following the manufacturer’s instructions. Three biological replicates were used, each consisting of organs collected from three individual plants or more. The cDNA was synthesized using M-MLV reverse transcriptase (TaKaRa, Dalian, China). The qRT-PCR analysis was performed using SYBR Green I dye (TaKaRa, Dalian, China) and a real-time PCR machine (Applied Biosystems 7500, Foster City, CA, USA). The soybean GmActin gene was used as an internal control. The difference in expression was calculated using the 2−ΔΔCt method. Each experiment was conducted with three biological replicates and three corresponding technical replicates. The primers used for qRT-PCR are listed in Table 1.

2.4. Transformation and Identification of Transformed Hairy Roots and Composite Plants of Soybean

After being digested with BamHI and SalI, the ORF of GmCHI4s was extracted and introduced into the pCHF1301 expression vector. The pCHF1301-GmCHI4s were transformed into the K599 strain (Agrobacterium rhizogenes) for the previously described transformation of soybean (Jilin35) cotyledon hairy roots and composite plants [50].
The transformed GmCHI4s hairy roots and composite plants were identified using histochemical GUS staining as previously described [51] and PCR using the primer sequences for the GUS gene as follows: F: 5′-GTCGCGCAAGACTGTAACCA-3′; R: 5′-CGGCGAAATTCCATACCTG-3′. The transformed empty vector hairy roots were used as controls.

2.5. Salt Treatment and Tolerance Evaluation of Transformed Hairy Roots and Composite Plants

Following culture in the root induction medium for 1 week, cotyledons with rooting signs were picked and placed on solid MS medium containing sodium chloride (NaCl). After 15 days of culture, 5 salt concentration gradients, 0, 50, 100, 150, and 200 mmol/L, were set, with 5 replicates for each treatment. A. rhizogenes strain K599 carried pCHF1301-GmCHI4s-infected curly roots, while the empty vector pCHF1301 functioned as the control. We observed the growth of hairy roots during culture and measured the parameters.
The soybean plants were infected with empty vector and GmCHI4s-containing A. rhizogenes K599. The transformed composite plants were cultivated in pots for 1 week. To improve the salinity adaptation of the transformed plants, the specimens were transferred to a solution consisting of 1/2 Hoagland’s solution with an additional 50 mmol/L NaCl for one day. Subsequently, they were transferred to a solution consisting of 1/2 Hoagland’s solution with an additional 100 mmol/L NaCl for another day. Finally, the transformed plants, including those for the empty vector, GmCHI4s, were transferred to a solution consisting of 1/2 Hoagland’s solution with an additional 150 mmol/L NaCl for a duration of 1 week. The experiment was carried out in triplicate, and the phenotypic and physiological changes of soybean hairy roots after salt stress treatment were recorded.
The chlorophyll content of the leaves was measured using a 6010 spectrophotometer (Agilent, Santa Clara, California, USA) following the procedures outlined in [52]. The TBA method described by Puckette et al. was used to determine malondialdehyde (MDA) [53]. SOD activity was measured by measuring the inhibition of photochemical reduction of nitro blue tetrazolium (NBT) using the method described by Li et al. [54].
The expression of related stress-resistant genes, GmTIP1;1, GmTIP1;3, GmSOD1, GmCAT1, GmPOD, GmAPX1, GmNHX1, GmSOS1, and GmActin, in root tissues was determined in 150 mmol L−1 NaCl-stressed GmCHI4s transgenic soybean hairy roots (control was transformed into pCHF-1301 empty vector soybean hairy root) using qRT-PCR methods, with the primers shown in Table 1.

2.6. Extraction and Determination of Isoflavone of Transformed Hairy Roots

Isoflavone was extracted from the transformed hairy roots of GmCHI4s overexpressing soybean cotyledons (0.5 g) and quantified, as described in a previous report [55]. Identification was carried out via comparison with authentic standards of daidzin, genistin, daidzein, genistein, glycitein, and glycitin (Sigma, St. Louis, MO, USA), and the quantification was accomplished by the use of an external standard, using high-performance liquid chromatography (HPLC). The total isoflavone content was calculated as the sum of the daidzein, genistein, glycitein, daidzin, genistin, and glycitin content. For every experiment, three biological replicates were used from three or more independent transformed roots having their three respective technical replicates.

2.7. Statistical Analysis and Phylogenetic Analysis

SPSS19.0 was used for statistical analysis. Three replicate values were used for calculating mean and standard deviation. Duncan’s multiple-range tests were used to compare means between them. Phylogenetic analysis was performed on the amino acid sequences of 29 proteins, including 12 GmCHIs in soybean. We used BLASTP of 12 GmCHIs protein sequences as the query sequence to retrieve the putative GmCHI homologs from NCBI and select the highest scoring sequence in wild soybean as well as in Arabidopsis. All of the protein sequences were aligned using ClustalW2 according to the default parameters, and the phylogenetic tree was built using MEGA version software using the neighbor-joining method with 1000 bootstrap repetitions.

3. Results

3.1. Characterization and Spatial Expression of the GmCHI4s in Soybean

The phylogenetic tree of GmCHI4A and GmCHI4B homologs from different plant species suggests that GmCHI4A and GmCHI4B genes are highly homologous to the Arabidopsis chalcone-flavanone isomerase-like gene AtCHIL (Figure 1A). GmCHI4A contained a complete ORF of 630 bp encoding 209 amino acids with a calculated molecular mass of 23.50 kDa and a predicted isoelectric point of 4.89. The ORF GmCHI4B contained 630 bp that encoded 209 amino acids, the same as GmCHI4A, with a molecular mass of 25.56 kDa and a predicted isoelectric point of 4.96. GmCHI4A and GmCHI4B both contained three introns and shared 57% amino acid sequence identity. GmCHI4s were expressed primarily in soybean root but were also present in other tissues, including the stem, leaf, and seed. GmCHI4A expression in the roots was at least six times that in the other tissues examined (Figure 1B). Meanwhile, the highest GmCHI4B expression levels were also observed in the roots, with moderate levels in stem and leaf, and the lowest levels in seeds (Figure 1C).

3.2. Expression Level of Hairy Roots That Overexpress GmCHI4s

We used the A. rhizogenes transformation system and transferred the plant expression vector into A. rhizogenes K599 to generate GmCHI4A and GmCHI4B transgenic soybean compound plants (Figure 2A,B). Positive soybean hairy roots were obtained by PCR amplification and GUS staining (Figure 2C,D). The exogenous GmCHI4s were demonstrated to be integrated into the genome of soybean hairy roots. The expression of GmCHI4A and GmCHI4B in the transformed soybean hairy root were increased 4.62 and 2.36 times for GmCHI4A (Figure 2E) and GmCHI4B (Figure 2F) genes, respectively.

3.3. GmCHI4s Alleviated Salt Tolerance in Transformed Soybean Hairy Roots and Composite Plants

Previous research has revealed that isoflavone compounds are engaged in the upkeep of the redox status of the cell and as a reaction to salt stress [11]. In order to study whether or not the overexpression of GmCHI4A and GmCHI4B can improve salt resistance, the transformed soybean hairy root of overexpressing GmCHI4s were cultivated following infection for 1 week to the media with 0, 50, 100, 150, and 200 mmol/L NaCl treatment for 15 d. In compared to non-treated controls, root development was clearly reduced. The degree of hair root growth inhibition was more obvious with the increase in salt concentration. Under 100 mmol L−1 NaCl treatment, the overexpression of GmCHI4s significantly increased root length (Figure 3A) and wet root weight (Figure 3B) compared to the control, which indicated that GmCHI4s could improve the soybean roots’ salt tolerance. To further detect the effects of GmCHI4A and GmCHI4B on salt tolerance, transferred composite plants were cultured in soil. Significant differences were measured in the physiological indexes and growth characteristics between treatment and control under the 150 mmol L−1 NaCl treatment condition. MDA content increased under high salt treatment in cotyledon hair roots and composite plant roots. Overexpression of GmCHI4s was able to inhibit this increase in MDA content; interestingly, the overexpression of GmCHI4A was also able to reduce MDA content under no salt treatment (Figure 3C). SOD value and above-ground biomass did not differ significantly between transformed composite plants and control under salt treatment and no treatment (Figure 3D). Overexpression of GmCHI4A significantly increased underground biomass and leaf chlorophyll content under salt treatment conditions. However, the overexpression of GmCHI4B did not cause the changes in the phenotypes described above (Figure 3E–G).

3.4. Transcription Patterns of Stress-Related Genes in Soybean Hair Root after the Overexpression of GmCHI4s

Since the overexpression of GmCHI4s enhanced the salt tolerance of transgenic soybean hairy roots, it was deemed possible that the overexpression of GmCHI4s could induce the expression of stress-related genes. We determined the expression of GmTIP: 1, GmTIP1: 3, GmSOD1, GmCAT1, GmPOD, GmAPX1, GmNHX1, and GmSOS1. The expression level of stress-related genes was regulated to varying degrees by the overexpression of GmCHI4A or GmCHI4B. The expression of GmTIP1;1, GmSOD1, GmSOS1, GmAPX1, and GmNHX1 was significantly higher than that of the control in the transformed GmCHI4A and GmCHI4B soybean hairy roots under 150 mmol L−1 NaCl treatment, in which the expression level of GmSOD1 and GmSOS1 was upregulated over 10-fold more than in plants without treatment (Figure 4). In contrast, GmTIP1;3 expression decreased significantly, while the expression of GmCAT1 was not affected by the overexpression of GmCHI4s (Figure 4). The expression of GmPOD was downregulated in the transformed hairy roots, and the significant decrease was caused by the overexpression of GmCHI4A; no significant difference was caused by the overexpression of GmCHI4B (Figure 4).

3.5. Overexpression of GmCHI4s Increased Isoflavone Content in Transformed Soybean Hairy Root

We determined the five major components of soybean isoflavones. The results showed that overexpression of GmCHI4A could significantly enhance the content of glycitin (17.3-fold), glycitein (3.5-fold), and isoflavone (3.8-fold), while no significant increases were detected in the levels of genistin and daidzein relative to those in the control. Lower but still significant increases in the glycitin (6.2-fold), genistin (5.8-fold), daidzein (11.8-fold), genistein (2.9-fold), and isoflavone content (2.6-fold) were observed following the overexpression of GmCHI4B-transformed roots relative to levels in the control. Overexpression of GmCHI4A and GmCHI4B increased the total isoflavone content by 5.1-fold and 2.6-fold, respectively (Figure 5).

4. Discussion

Salinity is one of the most important abiotic stress factors that affect crop yield and plant development, especially for root traits [9] such as root biomass, root length, root surface volume, root volume, average root diameter, and so on [1]. Our results show that the root length and wet root weight of transformed hairy roots cultivated on MS medium were significantly increased compared to the control by the overexpression of GmCHI4A and GmCHI4B under NaCl conditions. And the elevation of MDA content was inhibited, with the content of SOD tending to rise (Figure 3). Previous studies have shown that the expression of genes such as GmSOD1, GmPOD, GmCAT1, and GmAPX1 is correlated with the accumulation of MDA and SOD [56,57]. Meanwhile, overexpression of GmSOD1, GmPOD, GmCAT1, and GmAPX1 contributes to the removal of reactive oxygen species and the maintenance of cellular ROS homeostasis to enhance salt tolerance in plants [57,58]. Moreover, the transcription of GmSOS1 and GmNHX1 enhances salt tolerance by regulating the homeostasis of sodium ions in plant cells [57,58]. In the present study, the expression levels of GmSOD1, GmAPX1, GmSOS1, and GmNHX1 were significantly elevated in overexpressing hairy roots under 150 mmol L-1 NaCl conditions (Figure 4). Combined with the phenotype and the expression of the genes, we infer that the overexpression of GmCHI4s, which contributes to the removal of ROX and the change of the content of MDA and SOD, prove that GmCHI4s enhance salt tolerance of soybeans by participating in the ROX pathway. The increased expression levels of GmSOS1 and GmNHX1 may originate from the regulation of GmCHI4s.
Previous studies have shown that isoflavones are associated with salt tolerance in soybean. The overexpression of genes related to flavonoid synthesis can increase the accumulation of flavonoids in soybean and thus improve the salt tolerance of soybean [11,59]. There have also been reports of exogenous daidzin and genistein administration increasing salt tolerance [60,61]. Some salt-tolerant genotypes have also been reported to be suitable for the production of flavonoids via NaCl elicitation [15,62]. Some biotic and abiotic factors, such as disease, pest infestation, and drought, can also increase flavonoid content, thereby improving salt tolerance [63,64,65]. In this study, compared with the control, the contents of daidzin in hairy roots of soybean cotyledon transformed by GmCHI4A was significantly increased. In addition, the root length and wet root weight of the transformed hairy roots cultivated on MS medium were significantly increased by the overexpression of GmCHI4A under NaCl conditions. Therefore, we speculate that the GmCHI4A may achieve salt tolerance through the synthesis of daidzin.

5. Conclusions

Our data indicated that GmCHI4s were expressed primarily in soybean roots. The overexpression of GmCHI4s in hairy roots increased isoflavone content and salt tolerance. These findings provide useful information for the understanding of the underlying mechanism of salt tolerance regulated by GmCHI4s in soybean as well as providing new selected genes for salt tolerance and isoflavone improvement using biotechnological approaches in soybean.

Author Contributions

Conceptualization, Q.W. and F.Y.; methodology, J.Z. and Y.W.; software, Y.W. and J.L.; validation, Y.Z.; formal analysis, J.Z. and Y.W.; investigation, J.L. and L.W.; resources, Y.L.; data curation, Z.L.; writing—original draft preparation, J.Z.; writing—review and editing, Y.W. and Y.L.; visualization, Z.L.; supervision, Q.W.; project administration, Q.W. and F.Y.; funding acquisition, Q.W. and F.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by The National Key Research and Development Program of China (no. 2022YFD1500503) and The National Natural Science Foundation of China (no. 32172068, 32001572).

Data Availability Statement

Data are contained within the article.

Acknowledgments

We are grateful to Zeming He, Yuxue Zhou, Xinyue Wang, Jiaqi Wang and Jingying Wang for their assistance in this study. Moreover, we fully appreciate the editors and all anonymous reviewers for their constructive comments on this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Shuang, M.; Zhou, W.L.; Yang, F. Research progress on the mechanism of plant root response to saline-alkali stress. Zhejiang J. Agric. Sci. 2021, 33, 10. [Google Scholar]
  2. Leung, H.S.; Chan, L.Y.; Law, C.H.; Li, M.W.; Lam, H.M. Twenty years of mining salt tolerance genes in soybean. Mol. Breed. 2023, 43, 6. [Google Scholar] [CrossRef] [PubMed]
  3. Yang, Y.; Guo, Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. New Phytol. 2017, 217, 523–539. [Google Scholar] [CrossRef] [PubMed]
  4. Xie, Z.; Duan, L.; Tian, X.; Wang, B.; Egrinya Eneji, A.; Li, Z. Coronatine alleviates salinity stress in cotton by improving the antioxidative defense system and radical-scavenging activity. J. Plant Physiol. 2008, 165, 375–384. [Google Scholar] [CrossRef] [PubMed]
  5. Hossain, M.S.; Dietz, K.J. Tuning of redox regulatory mechanisms, reactive oxygen species and redox homeostasis under salinity stress. Front. Plant Sci. 2016, 7, 548. [Google Scholar] [CrossRef] [PubMed]
  6. Bian, X.H.; Li, W.; Niu, C.F.; Wei, W.; Hu, Y.; Han, J.Q.; Lu, X.; Tao, J.J.; Jin, M.; Qin, H.; et al. A class B heat shock factor selected for during soybean domestication contributes to salt tolerance by promoting flavonoid biosynthesis. New Phytol. 2019, 225, 268–283. [Google Scholar] [CrossRef]
  7. Goormachtig, S.; Lievens, S.; Herman, S.; Van Montagu, M.; Holsters, M. Chalcone reductase-homologous transcripts accumulate during development of stem-borne nodules on the tropical legume Sesbania rostrata. Planta 1999, 209, 45–52. [Google Scholar] [CrossRef] [PubMed]
  8. Dinkins, R.D.; Hancock, J.; Coe, B.L.; May, J.B.; Goodman, J.P.; Bass, W.T.; Liu, J.; Fan, Y.; Zheng, Q.; Zhu, H. Isoflavone levels, nodulation and gene expression profiles of a CRISPR/Cas9 deletion mutant in the isoflavone synthase gene of red clover. Plant Cell Rep. 2021, 40, 517–528. [Google Scholar] [CrossRef] [PubMed]
  9. Dai, Z.Y.; Jiang, T.; Zhou, C.; Yang, X.F.; Fang, Y.; Zhang, Z.S.; Sun, S.S.; Miao, M.X.; Shi, S.Z. The OsmiR396-OsGRF8-OsF3H flavonoid pathway mediates resistance to the brown planthopper in rice (Oryza sativa). Plant Biotechnol. J. 2019, 17, 1657–1669. [Google Scholar] [CrossRef]
  10. Yin, Y.; Zhang, X.; Gao, Z.; Hu, T.; Liu, Y. The Research Progress of Chalcone Isomerase (CHI) in Plants. Mol. Biotechnol. 2019, 61, 32–52. [Google Scholar] [CrossRef]
  11. Jia, T.; An, J.; Liu, Z.; Yu, B.; Chen, J. Salt stress induced soybean GmIFS1 expression and isoflavone accumulation and salt tolerance in transgenic soybean cotyledon hairy roots and tobacco. Plant Cell Tissue Organ Cult. 2016, 128, 469–477. [Google Scholar] [CrossRef]
  12. Pi, E.; Qu, L.; Hu, J.; Huang, Y.; Qiu, L.; Lu, H.; Jiang, B.; Liu, C.; Peng, T.; Zhao, Y.; et al. Mechanisms of soybean roots’ tolerances to salinity revealed by proteomic and phosphoproteomic comparisons between two cultivars. Mol. Cell. Proteom. 2016, 15, 266–288. [Google Scholar] [CrossRef] [PubMed]
  13. Dias, M.C.; Pinto, D.C.G.A.; Freitas, H.; Santos, C.; Silva, A.M.S. The antioxidant system in Olea europaea to enhanced UV-B radiation also depends on flavonoids and secoiridoids. Phytochemistry 2020, 170, 11299. [Google Scholar] [CrossRef] [PubMed]
  14. Zeng, X.; Yuan, H.; Dong, X.; Peng, M.; Jing, X.; Xu, Q.; Tang, T.; Wang, Y.; Zha, S.; Gao, M.; et al. Genome-wide dissection of co-selected UV-B responsive pathways in the UV-B adaptation of Qingke. Mol. Plant 2020, 13, 112–127. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, Y.; Lv, J.; Liu, Z.; Wang, J.; Yang, B.; Chen, W.; Ou, L.; Dai, X.; Zhang, Z.; Zou, X. Integrative analysis of metabolome and transcriptome reveals the mechanism of color formation in pepper fruit (Capsicum annuum L.). Food Chem. 2020, 141, 290492. [Google Scholar] [CrossRef] [PubMed]
  16. Wang, F.; Huang, Y.; Wu, W.; Zhu, C.; Zhang, R.; Chen, J.; Zeng, J. Metabolomics analysis of the peels of different colored citrus fruits (Citrus reticulata cv. ‘Shatangju’) during the maturation period based on UHPLC-QQQ-MS. Molecules 2020, 25, 396. [Google Scholar] [CrossRef] [PubMed]
  17. Zhang, L.; Sun, X.; Wilson, I.W.; Shao, F.; Qiu, D. Identification of the Genes Involved in anthocyanin biosynthesis and accumulation in Taxus chinensis. Genes 2019, 10, 982. [Google Scholar] [CrossRef] [PubMed]
  18. Alcalde-Eon, C.; Ferreras-Charro, R.; Ferrer-Gallego, R.; Rivero, F.J.; Heredia, F.J.; Escribano-Bailón, M.T. Monitoring the effects and side-effects on wine colour and flavonoid composition of the combined post-fermentative additions of seeds and mannoproteins. Food Res. Int. 2019, 126, 108650. [Google Scholar] [CrossRef] [PubMed]
  19. Hafeez, M.; Qasim, M.; Ali, S.; Yousaf, H.K.; Waqas, M.; Ali, E.; Ahmad, M.A.; Jan, S.; Bashir, M.A.; Noman, A.; et al. Expression and functional analysis of P450 gene induced tolerance/resistance to lambda-cyhalothrin in quercetin fed larvae of beet armyworm Spodoptera exigua (Hübner). Saudi J. Biol. Sci. 2020, 27, 77–87. [Google Scholar] [CrossRef] [PubMed]
  20. Prasifka, J.R.; Wallis, C.M. Concentrations of sunflower phenolics appear insufficient to explain resistance to floret- and seed-feeding caterpillars. Arthropod-Plant Interact. 2019, 13, 915–921. [Google Scholar] [CrossRef]
  21. Shan, T.; Wang, Y.; Wang, S.; Xie, Y.; Cui, Z.; Wu, C.; Sun, J.; Wang, J.; Mao, Z. A new p-terphenyl derivative from the insect-derived fungus Aspergillus candidus Bdf-2 and the synergistic effects of terphenyllin. PeerJ 2020, 8, e8211. [Google Scholar] [CrossRef] [PubMed]
  22. Song, Q.Y.; Li, F.; Nan, Z.B.; Coulter, J.A.; Wei, W.J. Do Epichloë Endophytes and their grass symbiosis only produce toxic alkaloids to insects and livestock? J. Agric. Food Chem. 2020, 68, 1169–1185. [Google Scholar] [CrossRef] [PubMed]
  23. Sharma, B. An analyses of flavonoids present in the inflorescence of sunflower. Braz. J. Bot. 2019, 42, 421–429. [Google Scholar] [CrossRef]
  24. Zhou, X.; Shi, F.; Zhou, L.; Zhou, Y.; Liu, Z.; Ji, R.; Feng, H. iTRAQ-based proteomic analysis of fertile and sterile flower buds from a genetic male sterile line ‘AB01′ in Chinese cabbage (Brassica campestris L. ssp. pekinensis). J. Proteom. 2019, 204, 103395. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, Y.C.; He, R.R.; Lian, J.P.; Zhou, Y.F.; Zhang, F.; Li, Q.F.; Yu, Y.; Feng, Y.Z.; Yang, Y.W.; Lei, M.Q.; et al. OsmiR528 regulates rice-pollen intine formation by targeting an uclacyanin to influence flavonoid metabolism. Proc. Natl. Acad. Sci. USA 2019, 117, 727–732. [Google Scholar] [CrossRef] [PubMed]
  26. Zheng, J.; An, Y.; Wang, L. 24-Epibrassinolide enhances 5-ALA-induced anthocyanin and flavonol accumulation in calli of ‘Fuji’ apple flesh. Plant Cell Tissue Organ Cult. 2018, 134, 319–330. [Google Scholar] [CrossRef]
  27. Boonkerd, S.; Yompakdee, C.; Miyakawa, T.; Chavasiri, W. A flavonoid, 5-hydroxy-3,7-dimethoxyflavone, from Kaempferia parviflora Wall. Ex. Baker as an inhibitor of Ca2+ signal-mediated cell-cycle regulation in yeast. Ann. Microbiol. 2013, 64, 1049–1054. [Google Scholar] [CrossRef]
  28. Md-Mustafa, N.; Khalid, N.; Gao, H.; Peng, Z.; Alimin, M.F.; Bujang, N.; Ming, W.S.; Mohd-Yusuf, Y.; Harikrishna, J.A.; Othman, R.Y. Transcriptome profiling shows gene regulation patterns in a flavonoid pathway in response to exogenous phenylalanine in Boesenbergia rotunda cell culture. BMC Genom. 2014, 15, 984. [Google Scholar] [CrossRef] [PubMed]
  29. Woo, H.H.; Jeong, B.R.; Hawes, M.C. Flavonoids: From cell cycle regulation to biotechnology. Biotechnol. Lett. 2005, 27, 365–374. [Google Scholar] [CrossRef]
  30. Jayaraman, K.; Venkat, R.K.; Sevanthi, A.M.; Gayatri; Viswanathan, C.; Mohapatra, T.; Mandal, P.K. Stress-inducible expression of chalcone isomerase2 gene improves accumulation of flavonoids and imparts enhanced abiotic stress tolerance to rice. Environ. Exp. Bot. 2021, 190, 104582. [Google Scholar] [CrossRef]
  31. Gomaa, N.H.; Hassan, M.O.; Fahmy, G.M.; González, L.; Hammouda, O.; Atteya, A.M. Flavonoid profiling and nodulation of some legumes in response to the allelopathic stress of Sonchus oleraceus L. Acta Bot. Bras. 2015, 29, 553–560. [Google Scholar] [CrossRef]
  32. Ullah, A.; Munir, S.; Badshah, S.L.; Khan, N.; Ghani, L.; Poulson, B.G.; Emwas, A.-H.; Jaremko, M. Important flavonoids and their role as a therapeutic agent. Molecules 2020, 25, 5243. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, Y.C.; Qin, X.M.; Xiao, J.X.; Tang, L.; Wei, C.Z.; Wei, J.J.; Zheng, Y. Intercropping influences component and content change of flavonoids in root exudates and nodulation of Faba bean. J. Plant Interact. 2017, 12, 187–192. [Google Scholar] [CrossRef]
  34. Zhang, J.; Subramanian, S.; Stacey, G.; Yu, O. Flavones and flavonols play distinct critical roles during nodulation of Medicago truncatula by Sinorhizobium meliloti. Plant J. 2008, 57, 171–183. [Google Scholar] [CrossRef]
  35. Abdel-Aleem, E.R.; Attia, E.Z.; Farag, F.F.; Samy, M.N.; Desoukey, S.Y. Total phenolic and flavonoid contents and antioxidant, anti-inflammatory, analgesic, antipyretic and antidiabetic activities of Cordia myxa L. leaves. Clin. Phytosci. 2019, 5, 29. [Google Scholar] [CrossRef]
  36. Jung, Y.J.; Park, J.H.; Cho, J.G.; Seo, K.H.; Lee, D.S.; Kim, Y.C.; Kang, H.C.; Song, M.C.; Baek, N.-I. Lignan and flavonoids from the stems of Zea mays and their anti-inflammatory and neuroprotective activities. Arch. Pharmacal Res. 2014, 38, 178–185. [Google Scholar] [CrossRef] [PubMed]
  37. Kim, J.H.; Quilantang, N.G.; Kim, H.Y.; Lee, S.; Cho, E.J. Attenuation of hydrogen peroxide-induced oxidative stress in SH-SY5Y cells by three flavonoids from Acer okamotoanum. Chem. Pap. 2018, 73, 1135–1144. [Google Scholar] [CrossRef]
  38. Magiera, S.; Zaręba, M. Chromatographic determination of phenolic acids and flavonoids in Lycium barbarum L. and evaluation of antioxidant activity. Food Anal. Methods 2015, 8, 2665–2674. [Google Scholar] [CrossRef]
  39. Chakrabarti, M.; Ray, S.K. Anti-tumor activities of luteolin and silibinin in glioblastoma cells: Overexpression of miR-7-1-3p augmented luteolin and silibinin to inhibit autophagy and induce apoptosis in glioblastoma in vivo. Apoptosis 2015, 21, 312–328. [Google Scholar] [CrossRef]
  40. Huang, M.; Wang, Y.; Xu, L.; You, M. Anti-tumor properties of Prunella vulgaris. Curr. Pharmacol. Rep. 2015, 1, 401–419. [Google Scholar] [CrossRef]
  41. Pavlova, S.I.; Albegova, D.Z.; Vorob’eva, Y.S.; Laptev, O.S.; Kozlov, I.G. Flavonoids as potential immunosuppressants affecting intracellular signaling pathways. Pharm. Chem. J. 2016, 49, 645–652. [Google Scholar] [CrossRef]
  42. Kang, C.H.; Rhie, S.J.; Kim, Y.C. Antioxidant and skin Anti-aging effects of marigold methanol extract. Toxicol. Res. 2018, 34, 31–39. [Google Scholar] [CrossRef] [PubMed]
  43. Cho, L.Y.; Yang, J.J.; Ko, K.-P.; Ma, S.H.; Shin, A.; Choi, B.Y.; Kim, H.J.; Han, D.S.; Song, K.S.; Kim, Y.S.; et al. Gene polymorphisms in the ornithine decarboxylase–polyamine pathway modify gastric cancer risk by interaction with isoflavone concentrations. Gastric Cancer 2014, 18, 495–503. [Google Scholar] [CrossRef] [PubMed]
  44. Ralston, L.; Subramanian, S.; Matsuno, M.; Yu, O. Partial reconstruction of flavonoid and isoflavonoid biosynthesis in yeast using soybean type I and type II chalcone isomerases. Plant Physiol. 2005, 137, 1375–1388. [Google Scholar] [CrossRef] [PubMed]
  45. Shimada, N.; Aoki, T.; Sato, S.; Nakamura, Y.; Tabata, S.; Ayabe, S.-I. A cluster of genes encodes the two types of chalcone isomerase involved in the biosynthesis of general flavonoids and legume-specific 5-Deoxy(iso)flavonoids in Lotus japonicus. Plant Physiol. 2003, 131, 941–951. [Google Scholar] [CrossRef]
  46. Ngaki, M.N.; Louie, G.V.; Philippe, R.N.; Manning, G.; Pojer, F.; Bowman, M.E.; Li, L.; Larsen, E.; Wurtele, E.S.; Noel, J.P. Evolution of the chalcone-isomerase fold from fatty-acid binding to stereospecific catalysis. Nature 2012, 485, 530–533. [Google Scholar] [CrossRef] [PubMed]
  47. Jiang, W.; Yin, Q.; Wu, R.; Zheng, G.; Liu, J.; Dixon, R.A.; Pang, Y. Role of a chalcone isomerase-like protein in flavonoid biosynthesis in Arabidopsis thaliana. J. Exp. Bot. 2015, 66, 7165–7179. [Google Scholar] [CrossRef] [PubMed]
  48. Morita, Y.; Takagi, K.; Fukuchi-Mizutani, M.; Ishiguro, K.; Tanaka, Y.; Nitasaka, E.; Nakayama, M.; Saito, N.; Kagami, T.; Hoshino, A.; et al. A chalcone isomerase-like protein enhances flavonoid production and flower pigmentation. Plant J. 2014, 78, 294–304. [Google Scholar] [CrossRef]
  49. Dastmalchi, M.; Dhaubhadel, S. Soybean chalcone isomerase: Evolution of the fold, and the differential expression and localization of the gene family. Planta 2014, 241, 507–523. [Google Scholar] [CrossRef]
  50. Wei, P.; Wang, L.; Liu, A.; Yu, B.; Lam, H.-M. GmCLC1 confers enhanced salt tolerance through regulating chloride accumulation in soybean. Front. Plant Sci. 2016, 7, 1082. [Google Scholar] [CrossRef]
  51. Zhao, Y.; Shao, S.; Li, X.; Zhai, Y.; Zhang, Q.; Qian, D.; Wang, Q. Isolation and activity analysis of a Seed-Abundant soyAP1 Gene promoter from soybean. Plant Mol. Biol. Rep. 2012, 30, 1400–1407. [Google Scholar] [CrossRef]
  52. Qu, Y.N.; Zhou, Q.; Yu, B.J. Effects of Zn2+ and niflumic acid on photosynthesis in Glycine soja and Glycine max seedlings under NaCl stress. Environ. Exp. Bot. 2009, 65, 304–309. [Google Scholar] [CrossRef]
  53. Puckette, M.C.; Weng, H.; Mahalingam, R. Physiological and biochemical responses to acute ozone-induced oxidative stress in Medicago truncatula. Plant Physiol. Biochem. 2007, 45, 70–79. [Google Scholar] [CrossRef] [PubMed]
  54. Sun, M.; Jia, B.; Cui, N.; Wen, Y.; Duanmu, H.; Yu, Q.; Xiao, J.; Sun, X.; Zhu, Y. Functional characterization of a Glycine soja Ca2+ATPase in salt–alkaline stress responses. Plant Mol. Biol. 2016, 90, 419–434. [Google Scholar] [CrossRef]
  55. Li, X.W.; Li, J.W.; Zhai, Y.; Zhao, Y.; Zhao, X.; Zhang, H.J.; Su, L.-T.; Wang, Y.; Wang, Q.-Y. A R2R3-MYB transcription factor, GmMYB12B2, affects the expression levels of flavonoid biosynthesis genes encoding key enzymes in transgenic Arabidopsis plants. Gene 2013, 532, 72–79. [Google Scholar] [CrossRef] [PubMed]
  56. Sidhu, G.K.; Tuan, P.A.; Renault, S.; Daayf, F.; Ayele, B.T. Polyamine-mediated transcriptional regulation of enzymatic antioxidative response to excesssoil moisture during early seedling growth in soybean. Biology 2020, 9, 185. [Google Scholar] [CrossRef]
  57. An, J.; Hu, Z.; Che, B.; Chen, H.; Yu, B.; Cai, W. Heterologous expression of panax ginseng PgTIP1 confers enhanced salt tolerance of soybean cotyledon hairy roots, composite, and whole plants. Front. Plant Sci. 2017, 8, 1232. [Google Scholar] [CrossRef]
  58. Li, S.F.; Huang, Y.Z.; Xuan, H.D.; Huang, L.; Zhao, J.M.; Wang, H.T.; Guo, N.; Xing, H. Cloning and function analysis of GmTIP1-1 gene in soybean. J. Nanjing Agric. Univ. 2019, 42, 793–801. [Google Scholar]
  59. Yan, J.; Wang, B.; Jiang, Y.; Cheng, L.; Wu, T. GmFNSII-Controlled Soybean flavone metabolism responds to abiotic stresses and regulates plant salt tolerance. Plant Cell Physiol. 2014, 55, 74–86. [Google Scholar] [CrossRef]
  60. Dolatabadian, A.; Modarres Sanavy, S.A.M.; Ghanati, F.; Gresshoff, P.M. Agrobacterium rhizogenes transformed soybean roots differ in their nodulation and nitrogen fixation response to genistein and salt stress. World J. Microbiol. Biotechnol. 2013, 29, 1327–1339. [Google Scholar] [CrossRef]
  61. Wu, Y.M.; Zhou, Q.; Yu, B.J. Physiological effect of soybean isoflavone soaking on soybean seedlings under salt stress. Acta Ecol. Sin. 2011, 31, 6669–6676. [Google Scholar]
  62. Golkar, P.; Taghizadeh, M. In vitro evaluation of phenolic and osmolite compounds, ionic content, and antioxidant activity in safflower (Carthamus tinctorius L.) under salinity stress. Plant Cell Tissue Organ Cult. 2018, 134, 357–368. [Google Scholar] [CrossRef]
  63. Golkar, P.; Taghizadeh, M.; Yousefian, Z. The effects of chitosan and salicylic acid on elicitation of secondary metabolites and antioxidant activity of safflower under in vitro salinity stress. Plant Cell Tissue Organ Cult. 2019, 137, 575–585. [Google Scholar] [CrossRef]
  64. López-Gómez, M.; Hidalgo-Castellanos, J.; Iribarne, C.; Lluch, C. Proline accumulation has prevalence over polyamines in nodules of medicago sativa in symbiosis with Sinorhizobium meliloti during the initial response to salinity. Plant Soil 2013, 374, 149–159. [Google Scholar] [CrossRef]
  65. Qu, L.; Huang, Y.; Zhu, C.; Zeng, H.; Shen, C.; Liu, C.; Zhao, Y.; Pi, E. Rhizobia-inoculation enhances the soybean’s tolerance to salt stress. Plant Soil 2015, 400, 209–222. [Google Scholar] [CrossRef]
Agronomy 14 00731 g001
Figure 1. Phylogenetic evolutionary tree of GmCHI4s and expression determination in different tissues. (A) Phylogenetic tree of GmCHI4A and GmCHI4B homologs from different plant species. A.thaliana (Arabidopsis thaliana), G.max (Glycine max), G.soja (Glycine soja). The unrooted neighbor-joining phylogenetic tree based on GmCHI4A and GmCHI4B homologs was created by MEGA6. (B,C) Relative expression levels of GmCHI4A and GmCHI4B in various tissues, including the seed, root, leaf, and stem of soybean, as determined by qRT-PCR. The relative expression levels are normalized to GmActin. The height of each bar and the error bars show the mean and standard deviation, respectively, from 3 independent measurements. Different small letters represent statistical significance between means for each organ (p < 0.05, Ducan’s multiple range test).
Figure 1. Phylogenetic evolutionary tree of GmCHI4s and expression determination in different tissues. (A) Phylogenetic tree of GmCHI4A and GmCHI4B homologs from different plant species. A.thaliana (Arabidopsis thaliana), G.max (Glycine max), G.soja (Glycine soja). The unrooted neighbor-joining phylogenetic tree based on GmCHI4A and GmCHI4B homologs was created by MEGA6. (B,C) Relative expression levels of GmCHI4A and GmCHI4B in various tissues, including the seed, root, leaf, and stem of soybean, as determined by qRT-PCR. The relative expression levels are normalized to GmActin. The height of each bar and the error bars show the mean and standard deviation, respectively, from 3 independent measurements. Different small letters represent statistical significance between means for each organ (p < 0.05, Ducan’s multiple range test).
Agronomy 14 00731 g001
Agronomy 14 00731 g002
Figure 2. Validation of GmCHI4 gene overexpression in soybean hair roots. (A) Culture of hairy roots of GmCHI4-transformed soybean cotyledons. a: Well germinated soybean seed of “Jilin 35”; b: cotyledons in the bacterial liquid infection; c: cotyledons in the co-culture stage; d: hair-shaped root of transgenic soybean. (B) Soybean compound plants of overexpressed GmCHI4A and GmCHI4B. EV: empty-vector-expressing soybean hairy roots. (C) PCR verification of GUS genes. M: DL2000 DNA Marker; 1: positive plasmids (1093 bp); 2: empty carrier soybean hair root; 3–6: PCR products of the GUS gene from GmCHI4A-transformed plants. 7–10: PCR products of the GUS gene from GmCHI4B-transformed plants. (D) Histochemical analysis of GUS-stained hairy roots. a: Negative control; b,c: GUS staining results of the hair-shaped roots of GmCHI4A-transformed plants. d,e: GUS staining results of the hair-shaped roots of GmCHI4B-transformed plants. (E,F) Relative expression level of hairy roots that overexpress GmCHI4s compared to EV, which represents empty-vector-expressing soybean hairy roots. The * and ** indicate significant differences at the 5% and 1% levels, respectively, by Duncan’s multiple range test.
Figure 2. Validation of GmCHI4 gene overexpression in soybean hair roots. (A) Culture of hairy roots of GmCHI4-transformed soybean cotyledons. a: Well germinated soybean seed of “Jilin 35”; b: cotyledons in the bacterial liquid infection; c: cotyledons in the co-culture stage; d: hair-shaped root of transgenic soybean. (B) Soybean compound plants of overexpressed GmCHI4A and GmCHI4B. EV: empty-vector-expressing soybean hairy roots. (C) PCR verification of GUS genes. M: DL2000 DNA Marker; 1: positive plasmids (1093 bp); 2: empty carrier soybean hair root; 3–6: PCR products of the GUS gene from GmCHI4A-transformed plants. 7–10: PCR products of the GUS gene from GmCHI4B-transformed plants. (D) Histochemical analysis of GUS-stained hairy roots. a: Negative control; b,c: GUS staining results of the hair-shaped roots of GmCHI4A-transformed plants. d,e: GUS staining results of the hair-shaped roots of GmCHI4B-transformed plants. (E,F) Relative expression level of hairy roots that overexpress GmCHI4s compared to EV, which represents empty-vector-expressing soybean hairy roots. The * and ** indicate significant differences at the 5% and 1% levels, respectively, by Duncan’s multiple range test.
Agronomy 14 00731 g002
Agronomy 14 00731 g003
Figure 3. Overexpressed GmCHI4s improved the NaCl tolerance of transgenic hairy roots of cotyledonary nodes and composite plants. (A,B) Root length and wet weight of transgenic hairy roots and transformed empty vector cultivated on MS medium under different salt treatments. EV1: empty vector transgenic soybean hairy roots. (C–G) The MAD content, SOD content, underground biomass, aboveground biomass, and chlorophyll content of transformed composite plants cultivated in pots with no treatment and 150 mmol/L NaCl. EV2: Empty vector transgenic soybean composite plants. The height of each bar and the error bars show the mean and standard deviation. The * and ** indicate significant differences with CK at the 5% and 1% levels, respectively, by Duncan’s multiple range test.
Figure 3. Overexpressed GmCHI4s improved the NaCl tolerance of transgenic hairy roots of cotyledonary nodes and composite plants. (A,B) Root length and wet weight of transgenic hairy roots and transformed empty vector cultivated on MS medium under different salt treatments. EV1: empty vector transgenic soybean hairy roots. (C–G) The MAD content, SOD content, underground biomass, aboveground biomass, and chlorophyll content of transformed composite plants cultivated in pots with no treatment and 150 mmol/L NaCl. EV2: Empty vector transgenic soybean composite plants. The height of each bar and the error bars show the mean and standard deviation. The * and ** indicate significant differences with CK at the 5% and 1% levels, respectively, by Duncan’s multiple range test.
Agronomy 14 00731 g003
Agronomy 14 00731 g004
Figure 4. Expression patterns of salt-stress-related genes in hairy roots of transgenic lines cultivated on MS medium with 150 mmol/L NaCl treatment after 15 d. (A–H) The gene expression levels of GmTIP1;1 and GmTIP1:3, GmSOD1, GmCAT1, GmPOD, GmAPX1, GmNHX1, and GmSOS1 were detected by qRT-PCR, which was performed with at least three independent replicates. The housekeeping gene GmActin was used as an internal control. EV: empty-vector-expressing soybean hairy roots. The * and ** indicate significant differences with EV at the 5% and 1% levels, respectively, by Duncan’s multiple range test.
Figure 4. Expression patterns of salt-stress-related genes in hairy roots of transgenic lines cultivated on MS medium with 150 mmol/L NaCl treatment after 15 d. (A–H) The gene expression levels of GmTIP1;1 and GmTIP1:3, GmSOD1, GmCAT1, GmPOD, GmAPX1, GmNHX1, and GmSOS1 were detected by qRT-PCR, which was performed with at least three independent replicates. The housekeeping gene GmActin was used as an internal control. EV: empty-vector-expressing soybean hairy roots. The * and ** indicate significant differences with EV at the 5% and 1% levels, respectively, by Duncan’s multiple range test.
Agronomy 14 00731 g004
Agronomy 14 00731 g005
Figure 5. Isoflavone content of hairy roots of GmCHI4A- and GmCHI4B-transformed soybean cotyledons. The height of each bar and the error bars show the mean and standard deviation, respectively, from 3 independent measurements. EV: empty-vector-expressing soybean hairy roots. The ** indicate significant differences with WT at the 1% levels, respectively, by Duncan’s multiple range test.
Figure 5. Isoflavone content of hairy roots of GmCHI4A- and GmCHI4B-transformed soybean cotyledons. The height of each bar and the error bars show the mean and standard deviation, respectively, from 3 independent measurements. EV: empty-vector-expressing soybean hairy roots. The ** indicate significant differences with WT at the 1% levels, respectively, by Duncan’s multiple range test.
Agronomy 14 00731 g005
Table 1. Primer sequences for real-time quantitative PCR.
Table 1. Primer sequences for real-time quantitative PCR.
Gene NameForward Primer Sequences (5′-3′)Reverse Primer Sequences (5′-3′)Accession NumberProduct Size
GmCHI4ATTTCAGTGATCACATACCATTTCCCAGCACCAAGGTACCATTTCTTGATGNM_001249853.2138 bp
GmCHI4BATTTATTTGGAGCCTGAAGTAGTTGGAGAGCATTGAAGAACTCATCGTTCNM_001255112.296 bp
GmTIP1;1AACCCTGCAGTCACATTTGGTTCCACCGGTTGCAGACTTGXM_003518610.5129 bp
GmTIP1;3TCTTGGTTGGTGGGGCTTTTATGGCAGCAGTAGCTGAACCXM_003536723.4136 bp
GmSOD1GCTTCAGTATTACCGACAGTCACACAAGCTACTCTGCCACCANM_001248369153 bp
GmCAT1CCAAGTCCCACATCCAGGAGGGTGTTGACACCGAAGCCATNM_001250627143 bp
GmPODCTTCAGCGGCACAGGAAGTCAAGTGTCAGGGGTTGAAGGATCXM_006575142.4128 bp
GmAPX1AACCTTTGACAAGGGCACGAAACAGCGATGTCAAGACCGTNM_001250856100 bp
GmNHX1AAGCAGCATCCGTGCTTTACCCTGCCACCAAAAACAGGACAY972078100 bp
GmSOS1GGTACTCATCATCGGCTGGGACCAGGGCCAGCTAGTAAGANM_001258010177 bp
GmActinAGGTCAACAGAGAAAGTGCCCAAACGAAGGATGGCATGGGV00450.1194 bp
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, J.; Wang, Y.; Li, J.; Zhu, Y.; Wang, L.; Li, Z.; Liu, Y.; Yan, F.; Wang, Q. Overexpression of Chalcone Isomerase-like Genes, GmCHI4A and GmCHI4B, Enhances Salt Tolerance of Cotyledon Hairy Roots and Composite Plant in Soybean (Glycine max (L.) Merr.). Agronomy 2024, 14, 731. https://doi.org/10.3390/agronomy14040731

AMA Style

Zhang J, Wang Y, Li J, Zhu Y, Wang L, Li Z, Liu Y, Yan F, Wang Q. Overexpression of Chalcone Isomerase-like Genes, GmCHI4A and GmCHI4B, Enhances Salt Tolerance of Cotyledon Hairy Roots and Composite Plant in Soybean (Glycine max (L.) Merr.). Agronomy. 2024; 14(4):731. https://doi.org/10.3390/agronomy14040731

Chicago/Turabian Style

Zhang, Jinhao, Ying Wang, Jingwen Li, Youcheng Zhu, Le Wang, Zhiqi Li, Yajing Liu, Fan Yan, and Qingyu Wang. 2024. "Overexpression of Chalcone Isomerase-like Genes, GmCHI4A and GmCHI4B, Enhances Salt Tolerance of Cotyledon Hairy Roots and Composite Plant in Soybean (Glycine max (L.) Merr.)" Agronomy 14, no. 4: 731. https://doi.org/10.3390/agronomy14040731

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop