Phenylalanine Ammonia-Lyase-Mediated Differential Response of Tomato (Solanum lycopersicum L.) Cultivars with Different Stress Tolerance to Treatment with Low-Molecular-Weight Chitosan
Abstract
1. Introduction
2. Materials and Methods
2.1. Chitosan Hydrolysate Preparation
2.2. Plant Cultivation
2.3. Effect of Chitosan Hydrolysate Concentration and Exposition on Tomato Seedlings
2.4. Chitosan Hydrolysate Effect on the Tomato Seedlings Development
2.5. Total Phenolic Content Analysis
2.6. Determination of Phenylalanine Ammonia-Lyase Activity
2.7. PAL Gene Family Analysis
2.8. Data Analysis
3. Results
3.1. Identification of the Chitosan Hydrolysate Stress Effect on Tomato Seedlings
3.2. Effect of Low-Molecular-Weight Chitosan Hydrolysate on the Phenylalanine Ammonia-Lyase Activity in Tomato Roots
3.3. In Silico SlPAL Gene Analysis
3.4. SlPAL Gene Expression Analysis by RT-qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Panno, S.; Davino, S.; Caruso, A.G.; Bertacca, S.; Crnogorac, A.; Mandić, A.; Noris, E.; Matić, S. A Review of the Most Common and Economically Important Diseases That Undermine the Cultivation of Tomato Crop in the Mediterranean Basin. Agronomy 2021, 11, 2188. [Google Scholar] [CrossRef]
- El Hadrami, A.; Adam, L.R.; El Hadrami, I.; Daayf, F. Chitosan in Plant Protection. Mar. Drugs 2010, 8, 968–987. [Google Scholar] [CrossRef] [PubMed]
- Bautista-Baños, S.; Hernández-Lauzardo, A.N.; Velázquez-Del Valle, M.G.; Hernández-López, M.; Ait Barka, E.; Bosquez-Molina, E.; Wilson, C.L. Chitosan as a Potential Natural Compound to Control Pre and Postharvest Diseases of Horticultural Commodities. Crop Prot. 2006, 25, 108–118. [Google Scholar] [CrossRef]
- Sharif, R.; Mujtaba, M.; Rahman, M.U.; Shalmani, A.; Ahmad, H.; Anwar, T.; Tianchan, D.; Wang, X. The Multifunctional Role of Chitosan in Horticultural Crops; a Review. Molecules 2018, 23, 872. [Google Scholar] [CrossRef] [PubMed]
- El Amerany, F.; Meddich, A.; Wahbi, S.; Porzel, A.; Taourirte, M.; Rhazi, M.; Hause, B. Ultrasound-Assisted Catalyst-Free Thiol-Yne Click Reaction in Chitosan Chemistry: Antibacterial and Transfection Activity of Novel Cationic Chitosan Derivatives and Their Based Nanoparticles. Int. J. Biol. Macromol. 2020, 143, 143–152. [Google Scholar]
- Rabea, E.I.; Badawy, M.E.I.; Rogge, T.M.; Stevens, C.V.; Höfte, M.; Steurbaut, W.; Smagghe, G. Insecticidal and Fungicidal Activity of New Synthesized Chitosan Derivatives. Pest. Manag. Sci. 2005, 61, 951–960. [Google Scholar] [CrossRef] [PubMed]
- Timofeeva, T.A.; Zakurin, A.O.; Nezhdanova, A.V.; Shagdarova, B.T.; Davlekamova, A.A.; Gaydukova, S.E.; Yakovleva, I.V.; Kamionskaya, A.M. Low Molecular Weight Chitosan Hydrolyzate Inhibits the Growth of Some Phytopathogenic Ascomycota Fungi. IOP Conf. Ser. Earth Environ. Sci. 2021, 839, 042027. [Google Scholar] [CrossRef]
- Palma-Guerrero, J.; Jansson, H.B.; Salinas, J.; Lopez-Llorca, L.V. Effect of Chitosan on Hyphal Growth and Spore Germination of Plant Pathogenic and Biocontrol Fungi. J. Appl. Microbiol. 2008, 104, 541–553. [Google Scholar] [CrossRef]
- Katiyar, D.; Hemantaranjan, A.; Singh, B. Chitosan as a Promising Natural Compound to Enhance Potential Physiological Responses in Plant: A Review. Indian J. Plant Physiol. 2015, 20, 1–9. [Google Scholar] [CrossRef]
- Pichyangkura, R.; Chadchawan, S. Biostimulant Activity of Chitosan in Horticulture. Sci. Hortic. 2015, 196, 49–65. [Google Scholar] [CrossRef]
- Chandra, S.; Chakraborty, N.; Dasgupta, A.; Sarkar, J.; Panda, K.; Acharya, K. Chitosan Nanoparticles: A Positive Modulator of Innate Immune Responses in Plants. Sci. Rep. 2015, 5, 15195. [Google Scholar] [CrossRef]
- Jogaiah, S.; Satapute, P.; De Britto, S.; Konappa, N.; Udayashankar, A.C. Exogenous Priming of Chitosan Induces Upregulation of Phytohormones and Resistance against Cucumber Powdery Mildew Disease Is Correlated with Localized Biosynthesis of Defense Enzymes. Int. J. Biol. Macromol. 2020, 162, 1825–1838. [Google Scholar] [CrossRef]
- Rahman, M.; Mukta, J.A.; Sabir, A.A.; Gupta, D.R.; Mohi-Ud-Din, M.; Hasanuzzaman, M.; Miah, M.G.; Rahman, M.; Islam, M.T. Chitosan Biopolymer Promotes Yield and Stimulates Accumulation of Antioxidants in Strawberry Fruit. PLoS ONE 2018, 13, e0203769. [Google Scholar] [CrossRef]
- Hadwiger, L.A. Plant Science Review: Multiple Effects of Chitosan on Plant Systems: Solid Science or Hype. Plant Sci. 2013, 208, 42–49. [Google Scholar] [CrossRef] [PubMed]
- Samarah, N.H.; AL-Quraan, N.A.; Massad, R.S.; Welbaum, G.E. Treatment of Bell Pepper (Capsicum annuum L.) Seeds with Chitosan Increases Chitinase and Glucanase Activities and Enhances Emergence in a Standard Cold Test. Sci. Hortic. 2020, 269, 109393. [Google Scholar] [CrossRef]
- Quitadamo, F.; De Simone, V.; Beleggia, R.; Trono, D. Chitosan-Induced Activation of the Antioxidant Defense System Counteracts the Adverse Effects of Salinity in Durum Wheat. Plants 2021, 10, 1365. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Moya, F.; Suarez-Fernandez, M.; Lopez-Llorca, L.V. Molecular Mechanisms of Chitosan Interactions with Fungi and Plants. Int. J. Mol. Sci. 2019, 20, 332. [Google Scholar] [CrossRef] [PubMed]
- Iriti, M.; Varoni, E.M. Chitosan-Induced Antiviral Activity and Innate Immunity in Plants. Environ. Sci. Pollut. Res. 2015, 22, 2935–2944. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.-X.; Jalal Ahammed, G.; Wu, C.; Fan, S.; Zhou, Y.-H. Crosstalk among Jasmonate, Salicylate and Ethylene Signaling Pathways in Plant Disease and Immune Responses. Curent Protein Pept. Sci. 2015, 16, 450–461. [Google Scholar] [CrossRef] [PubMed]
- Ackah, S.; Xue, S.; Osei, R.; Kweku-Amagloh, F.; Zong, Y.; Prusky, D.; Bi, Y. Chitosan Treatment Promotes Wound Healing of Apple by Eliciting Phenylpropanoid Pathway and Enzymatic Browning of Wounds. Front. Microbiol. 2022, 13, 828914. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Ma, J.; Xie, J.; Deng, L.; Yao, S.; Zeng, K. Transcriptomic and Biochemical Analysis of Highlighted Induction of Phenylpropanoid Pathway Metabolism of Citrus Fruit in Response to Salicylic Acid, Pichia Membranaefaciens and Oligochitosan. Postharvest Biol. Technol. 2018, 142, 81–92. [Google Scholar] [CrossRef]
- Suarez-Fernandez, M.; Marhuenda-Egea, F.C.; Lopez-Moya, F.; Arnao, M.B.; Cabrera-Escribano, F.; Nueda, M.J.; Gunsé, B.; Lopez-Llorca, L.V. Chitosan Induces Plant Hormones and Defenses in Tomato Root Exudates. Front. Plant Sci. 2020, 11, 572087. [Google Scholar] [CrossRef] [PubMed]
- El Amerany, F.; Rhazi, M.; Balcke, G.; Wahbi, S.; Meddich, A.; Taourirte, M.; Hause, B. The Effect of Chitosan on Plant Physiology, Wound Response, and Fruit Quality of Tomato. Polymers 2022, 14, 5006. [Google Scholar] [CrossRef]
- Attia, M.S.; Osman, M.S.; Mohamed, A.S.; Mahgoub, H.A.; Garada, M.O.; Abdelmouty, E.S.; Latef, A.A.H.A. Impact of Foliar Application of Chitosan Dissolved in Different Organic Acids on Isozymes, Protein Patterns and Physio-Biochemical Characteristics of Tomato Grown under Salinity Stress. Plants 2021, 10, 388. [Google Scholar] [CrossRef] [PubMed]
- Mukhtar Ahmed, K.B.; Khan, M.M.A.; Siddiqui, H.; Jahan, A. Foliar Application of Chitosan Increases Tomato Growth and Influences Mycorrhization and Expression of Endochitinase-Encoding Genes. Int. J. Mol. Sci. 2020, 21, 535. [Google Scholar]
- Liu, J.; Tian, S.; Meng, X.; Xu, Y. Effects of Chitosan on Control of Postharvest Diseases and Physiological Responses of Tomato Fruit. Postharvest Biol. Technol. 2007, 44, 300–306. [Google Scholar] [CrossRef]
- Zhang, D.; Wang, H.; Hu, Y.; Liu, Y. Chitosan Controls Postharvest Decay on Cherry Tomato Fruit Possibly via the Mitogen-Activated Protein Kinase Signaling Pathway. J. Agric. Food Chem. 2015, 63, 7399–7404. [Google Scholar] [CrossRef] [PubMed]
- Sathiyabama, M.; Akila, G.; Einstein Charles, R. Chitosan-Induced Defence Responses in Tomato Plants against Early Blight Disease Caused by Alternaria solani (Ellis and Martin) Sorauer. Arch. Phytopathol. Plant Prot. 2014, 47, 1777–1787. [Google Scholar] [CrossRef]
- Lopez-Moya, F.; Escudero, N.; Zavala-Gonzalez, E.A.; Esteve-Bruna, D.; Blázquez, M.A.; Alabadí, D.; Lopez-Llorca, L.V. Induction of Auxin Biosynthesis and WOX5 Repression Mediate Changes in Root Development in Arabidopsis Exposed to Chitosan. Sci. Rep. 2017, 7, 16813. [Google Scholar] [CrossRef]
- Mandal, S.; Kar, I.; Mukherjee, A.K.; Acharya, P. Elicitor-Induced Defense Responses in Solanum lycopersicum against Ralstonia solanacearum. Sci. World J. 2013, 2013, 561056. [Google Scholar] [CrossRef]
- Barros, J.; Dixon, R.A. Plant Phenylalanine/Tyrosine Ammonia-Lyases. Trends Plant Sci. 2020, 25, 66–79. [Google Scholar] [CrossRef]
- Shine, M.B.; Yang, J.W.; El-Habbak, M.; Nagyabhyru, P.; Fu, D.Q.; Navarre, D.; Ghabrial, S.; Kachroo, P.; Kachroo, A. Cooperative Functioning between Phenylalanine Ammonia Lyase and Isochorismate Synthase Activities Contributes to Salicylic Acid Biosynthesis in Soybean. New Phytol. 2016, 212, 627–636. [Google Scholar] [CrossRef]
- Chen, Z.; Zheng, Z.; Huang, J.; Lai, Z.; Fan, B. Biosynthesis of Salicylic Acid in Plants. Plant Signal Behav. 2009, 4, 493–496. [Google Scholar] [CrossRef] [PubMed]
- Karlova, R.; Boer, D.; Hayes, S.; Testerink, C. Root Plasticity under Abiotic Stress. Plant Physiol. 2021, 187, 1057–1070. [Google Scholar] [CrossRef] [PubMed]
- Chang, A.; Lim, M.H.; Lee, S.W.; Robb, E.J.; Nazar, R.N. Tomato Phenylalanine Ammonia-Lyase Gene Family, Highly Redundant but Strongly Underutilized. J. Biol. Chem. 2008, 283, 33591–33601. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Wang, M.H. Characterization of the Phenylalanine Ammonia-Lyase Gene (SlPAL5) from Tomato (Solanum lycopersicum L.). Mol. Biol. Rep. 2009, 36, 1579–1585. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.S.; Hwang, B.K. An Important Role of the Pepper Phenylalanine Ammonia-Lyase Gene (PAL1) in Salicylic Acid-Dependent Signalling of the Defence Response to Microbial Pathogens. J. Exp. Bot. 2014, 65, 2295–2306. [Google Scholar] [CrossRef] [PubMed]
- Stasinska-Jakubas, M.; Hawrylak-Nowak, B. Protective, Biostimulating, and Eliciting Effects of Chitosan and Its Derivatives on Crop Plants. Molecules 2022, 27, 2801. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Jiang, Y.; Xiu, L.; Huang, J. Effect of Chitosan Pre-Soaking on the Growth and Quality of Yellow Soybean Sprouts. J. Sci. Food Agric. 2019, 99, 1596–1603. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.; Meng, Q.; Zeng, H.; Wang, W.; Yin, H. Chitosan Oligosaccharide Induces Resistance to Tobacco Mosaic Virus in Arabidopsis via the Salicylic Acid-Mediated Signalling Pathway. Sci. Rep. 2016, 6, 26144. [Google Scholar] [CrossRef]
- Cho, M.H.; No, H.K.; Prinyawiwatkul, W. Chitosan Treatments Affect Growth and Selected Quality of Sunflower Sprouts. J. Food Sci. 2008, 73, 70–77. [Google Scholar] [CrossRef]
- Khan, W.; Prithiviraj, B.; Smith, D.L. Chitosan and Chitin Oligomers Increase Phenylalanine Ammonia-Lyase and Tyrosine Ammonia-Lyase Activities in Soybean Leaves. J. Plant Physiol. 2003, 160, 859–863. [Google Scholar] [CrossRef]
- Ou, L.; Zhang, Q.; Ji, D.; Li, Y.; Zhou, X.; Jin, L. Physiological, Transcriptomic Investigation on the Tea Plant Growth and Yield Motivation by Chitosan Oligosaccharides. Horticulturae 2022, 8, 68. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, Q.; Ou, L.; Ji, D.; Liu, T.; Lan, R.; Li, X.; Jin, L. Response to the Cold Stress Signaling of the Tea Plant (Camellia sinensis) Elicited by Chitosan Oligosaccharide. Agronomy 2020, 10, 915. [Google Scholar] [CrossRef]
- Shagdarova, B.T.; Il’ina, A.V.; Varlamov, V.P. Antibacterial Activity of Alkylated and Acylated Derivatives of Low–Molecular Weight Chitosan. Appl. Biochem. Microbiol. 2016, 52, 222–225. [Google Scholar] [CrossRef]
- Fernandez-Pozo, N.; Menda, N.; Edwards, J.D.; Saha, S.; Tecle, I.Y.; Strickler, S.R.; Bombarely, A.; Fisher-York, T.; Pujar, A.; Foerster, H.; et al. The Sol Genomics Network (SGN)-from Genotype to Phenotype to Breeding. Nucleic Acids Res. 2015, 43, 1036–1041. [Google Scholar] [CrossRef]
- Zouine, M.; Maza, E.; Djari, A.; Lauvernier, M.; Frasse, P.; Smouni, A.; Pirrello, J.; Bouzayen, M. TomExpress, a Unified Tomato RNA-Seq Platform for Visualization of Expression Data, Clustering and Correlation Networks. Plant J. 2017, 92, 727–735. [Google Scholar] [CrossRef]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Løvdal, T.; Lillo, C. Reference Gene Selection for Quantitative Real-Time PCR Normalization in Tomato Subjected to Nitrogen, Cold, and Light Stress. Anal. Biochem. 2009, 387, 238–242. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Puthoff, D.P.; Holzer, F.M.; Perring, T.M.; Walling, L.L. Tomato pathogenesis-related protein genes are expressed in response to Trialeurodes vaporariorum and Bemisia tabaci biotype B feeding. J. Chem. Ecol. 2010, 36, 1271–1285. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Guo, Z.; Lu, S. Genome-Wide Identification and Expression Analysis of the Aux/IAA and Auxin Response Factor Gene Family in Medicago truncatula. Int. J. Mol. Sci. 2021, 22, 10494. [Google Scholar] [CrossRef]
- Zhang, C.; Jiao, C.; Sun, X.; Li, X. A MYB Transcription Factor Atlas Provides Insights into the Evolution of Environmental Adaptations in Plants. Int. J. Mol. Sci. 2023, 24, 2566. [Google Scholar] [CrossRef]
- Zhao, M.M.; Zhang, X.W.; Liu, Y.W.; Li, K.; Tan, Q.; Zhou, S.; Wang, G.; Zhou, C.J. A WRKY transcription factor, TaWRKY42-B, facilitates initiation of leaf senescence by promoting jasmonic acid biosynthesis. BMC Plant Biol. 2020, 20, 444. [Google Scholar] [CrossRef]
- Kojima, T.; Asakura, N.; Hasegawa, S.; Hirasawa, T.; Mizuno, Y.; Takemoto, D.; Katou, S. Transcriptional induction of capsidiol synthesis genes by wounding can promote pathogen signal-induced capsidiol synthesis. BMC Plant Biol. 2019, 19, 576. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Hu, H.; Wang, W.; Wei, Q.; Hu, T.; Bao, C. Genome-Wide Identification and Functional Characterization of the Heat Shock Factor Family in Eggplant (Solanum melongena L.) under Abiotic Stress Conditions. Plants 2020, 9, 915. [Google Scholar] [CrossRef]
- Timofeeva, T.; Shtan’ko, D.; Shagdarova, B.; Zakurin, A.; Kamionskaya, A.; Il’ina, A. The Effect of Chitosan Hydrolysate on Solanum lycopersicum Plant Growth. KnE Life Sci. 2022, 7, 435–442. [Google Scholar] [CrossRef]
- Lyalina, T.; Shagdarova, B.; Zhuikova, Y.; Il’ina, A.; Lunkov, A.; Varlamov, V. Effect of Seed Priming with Chitosan Hydrolysate on Lettuce (Lactuca sativa) Growth Parameters. Molecules 2023, 28, 1915. [Google Scholar] [CrossRef]
- Rabêlo, V.M.; Magalhães, P.C.; Bressanin, L.A.; Carvalho, D.T.; Reis, C.O.D.; Karam, D.; Doriguetto, A.C.; Santos, M.H.D.; Santos Filho, P.R.D.S.; Souza, T.C.D. The Foliar Application of a Mixture of Semisynthetic Chitosan Derivatives Induces Tolerance to Water Deficit in Maize, Improving the Antioxidant System and Increasing Photosynthesis and Grain Yield. Sci. Rep. 2019, 9, 8164. [Google Scholar] [CrossRef] [PubMed]
- Choudhary, R.C.; Kumaraswamy, R.V.; Kumari, S.; Sharma, S.S.; Pal, A.; Raliya, R.; Biswas, P.; Saharan, V. Cu-Chitosan Nanoparticle Boost Defense Responses and Plant Growth in Maize (Zea mays L.). Sci. Rep. 2017, 7, 9754. [Google Scholar] [CrossRef]
- Attaran Dowom, S.; Karimian, Z.; Mostafaei Dehnavi, M.; Samiei, L. Chitosan Nanoparticles Improve Physiological and Biochemical Responses of Salvia abrotanoides (Kar.) under Drought Stress. BMC Plant Biol. 2022, 22, 364. [Google Scholar] [CrossRef] [PubMed]
- Iglesias, M.J.; Colman, S.L.; Terrile, M.C.; París, R.; Martín-Saldaña, S.; Chevalier, A.A.; Álvarez, V.A.; Casalongué, C.A. Enhanced Properties of Chitosan Microparticles over Bulk Chitosan on the Modulation of the Auxin Signaling Pathway with Beneficial Impacts on Root Architecture in Plants. J. Agric. Food Chem. 2019, 67, 6911–6920. [Google Scholar] [CrossRef]
- Suwanchaikasem, P.; Nie, S.; Idnurm, A.; Selby-Pham, J.; Walker, R.; Boughton, B.A. Effects of Chitin and Chitosan on Root Growth, Biochemical Defense Response and Exudate Proteome of Cannabis sativa. Plant-Environ. Interact. 2023, 4, 115–133. [Google Scholar] [CrossRef]
- Olatunji, D.; Geelen, D.; Verstraeten, I. Control of Endogenous Auxin Levels in Plant Root Development. Int. J. Mol. Sci. 2017, 18, 2587. [Google Scholar] [CrossRef]
- Nicolia, A.; Proux-Wéra, E.; Åhman, I.; Onkokesung, N.; Andersson, M.; Andreasson, E.; Zhu, L.H. Targeted Gene Mutation in Tetraploid Potato through Transient TALEN Expression in Protoplasts. J. Biotechnol. 2015, 204, 17–24. [Google Scholar] [CrossRef]
- Pongprayoon, W.; Panya, A.; Jaresitthikunchai, J.; Phaonakrop, N.; Roytrakul, S. Phosphoprotein Profile of Rice (Oryza sativa L.) Seedlings under Osmotic Stress after Pretreatment with Chitosan. Plants 2022, 11, 2729. [Google Scholar] [CrossRef]
- Rogowska, A.; Pączkowski, C.; Szakiel, A. Modifications in Steroid and Triterpenoid Metabolism in Calendula Officinalis Plants and Hairy Root Culture in Response to Chitosan Treatment. BMC Plant Biol. 2023, 23, 263. [Google Scholar] [CrossRef]
- Yoo, S.D.; Cho, Y.H.; Sheen, J. Arabidopsis Mesophyll Protoplasts: A Versatile Cell System for Transient Gene Expression Analysis. Nat. Protoc. 2007, 2, 1565–1572. [Google Scholar] [CrossRef]
- Mo, F.; Li, L.; Zhang, C.; Yang, C.; Chen, G.; Niu, Y.; Si, J.; Liu, T.; Sun, X.; Wang, S.; et al. Genome-Wide Analysis and Expression Profiling of the Phenylalanine Ammonia-Lyase Gene Family in Solanum Tuberosum. Int. J. Mol. Sci. 2022, 23, 6833. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Wang, J.; Li, X.; Zhang, J.; Liu, Y.; Chen, Y.; Yu, Q.; Li, N. Genome-Wide Identification and Expression Analyses of Phenylalanine Ammonia-Lyase Gene Family Members from Tomato (Solanum lycopersicum) Reveal Their Role in Root-Knot Nematode Infection. Front. Plant Sci. 2023, 14, 1204990. [Google Scholar] [CrossRef] [PubMed]
- Rendina, N.; Nuzzaci, M.; Scopa, A.; Cuypers, A.; Sofo, A. Chitosan-elicited defense responses in Cucumber mosaic virus (CMV)-infected tomato plants. J. Plant Phys. 2019, 234, 9–17. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Pair |
---|---|
SlPAL | 5′–GGTGTGACTACTGGATTTGGTGC–3′ |
5′–GAGTAGCCTTGAAGCAAAGTGTTGA–3′ | |
SlEF1β2 | 5′–AAGGTATATGGGGCAATTTTGGAAC–3′ |
5′–GCAGCCTTTTCCTCCTCTGTCGA–3′ |
Gene ID | Uniprot ID | Locus Name | Gene ID | Uniprot ID | Locus Name |
---|---|---|---|---|---|
851 | K4AS30_SOLLC | Solyc00g282510 | 16996 | K4C2U1_SOLLC | Solyc05g056170 |
9277 | K4BFW8_SOLLC | Solyc03g036470 | 24995 | K4CQH8_SOLLC | Solyc09g007890 |
9278 | K4BFW9_SOLLC | Solyc03g036480 | 24996 | K4CQH9_SOLLC | Solyc09g007900 |
9286 | K4BFX7_SOLLC | Solyc03g042560 | 24997 | K4CQI0_SOLLC | Solyc09g007910 |
9879 | K4BHL5_SOLLC | Solyc03g071860 | 24998 | K4CQI1_SOLLC | Solyc09g007920 |
9880 | K4BHL6_SOLLC | Solyc03g071870 | 27806 | K4CYG9_SOLLC | Solyc10g011920 |
9920 | K4BHQ6_SOLLC | Solyc03g078270 | 27807 | K4CYH0_SOLLC | Solyc10g011930 |
9921 | K4BHQ7_SOLLC | Solyc03g078280 | 29798 | K4D451_SOLLC | Solyc10g086180 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Timofeeva, T.A.; Bubnova, A.N.; Shagdarova, B.T.; Varlamov, V.P.; Kamionskaya, A.M. Phenylalanine Ammonia-Lyase-Mediated Differential Response of Tomato (Solanum lycopersicum L.) Cultivars with Different Stress Tolerance to Treatment with Low-Molecular-Weight Chitosan. Agronomy 2024, 14, 386. https://doi.org/10.3390/agronomy14020386
Timofeeva TA, Bubnova AN, Shagdarova BT, Varlamov VP, Kamionskaya AM. Phenylalanine Ammonia-Lyase-Mediated Differential Response of Tomato (Solanum lycopersicum L.) Cultivars with Different Stress Tolerance to Treatment with Low-Molecular-Weight Chitosan. Agronomy. 2024; 14(2):386. https://doi.org/10.3390/agronomy14020386
Chicago/Turabian StyleTimofeeva, Tatiana A., Anastasiya N. Bubnova, Balzhima T. Shagdarova, Valery P. Varlamov, and Anastasiya M. Kamionskaya. 2024. "Phenylalanine Ammonia-Lyase-Mediated Differential Response of Tomato (Solanum lycopersicum L.) Cultivars with Different Stress Tolerance to Treatment with Low-Molecular-Weight Chitosan" Agronomy 14, no. 2: 386. https://doi.org/10.3390/agronomy14020386
APA StyleTimofeeva, T. A., Bubnova, A. N., Shagdarova, B. T., Varlamov, V. P., & Kamionskaya, A. M. (2024). Phenylalanine Ammonia-Lyase-Mediated Differential Response of Tomato (Solanum lycopersicum L.) Cultivars with Different Stress Tolerance to Treatment with Low-Molecular-Weight Chitosan. Agronomy, 14(2), 386. https://doi.org/10.3390/agronomy14020386