Next Article in Journal
Rice Shoot 13C Abundance at Maximum Tillering Stage Is Well Suited to Distinguish Differences in Water Use Efficiency for Water-Saving Rice Technologies
Next Article in Special Issue
Crop–Mushroom Rotation: A Comprehensive Review of Its Multifaceted Impacts on Soil Quality, Agricultural Sustainability, and Ecosystem Health
Previous Article in Journal
Protective Role of Triacontanol (Myricyl Alcohol) Towards the Nutrients Uptake and Growth in Brassica rapa L. Under Cadmium Stress
Previous Article in Special Issue
Leguminous Plants and Microbial Inoculation: An Approach for Biocatalytic Phytoremediation of Tebuthiuron in Agricultural Soil
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Impact of Organic Fertilizer Substitution and Chemical Nitrogen Fertilizer Reduction on Soil Enzyme Activity and Microbial Communities in an Apple Orchard

by
Yuyang Yan
1,2,3,4,†,
Xinran Zhang
1,2,†,
Yuan Liu
5,
Lei Hou
6,
Zengchao Geng
1,2,
Feinan Hu
3,4 and
Chenyang Xu
1,2,*
1
College of Natural Resources and Environment, Northwest A&F University, Yangling 712100, China
2
Key Laboratory of Plant Nutrition and Agri-Environment in Northwest China, Ministry of Agriculture and Rural Affairs, Northwest A&F University, Yangling 712100, China
3
State Key Laboratory of Soil Erosion and Dryland Farming on the Loess Plateau, Northwest A&F University, Yangling 712100, China
4
Institute of Soil and Water Conservation, Chinese Academy of Sciences, Ministry of Water Resources, Yangling 712100, China
5
Farmland Irrigation Research Institute, Chinese Academy of Agricultural Sciences, Xinxiang 453000, China
6
Tibet Agriculture and Animal Husbandry University, Nyingchi 860000, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2024, 14(12), 2917; https://doi.org/10.3390/agronomy14122917
Submission received: 19 October 2024 / Revised: 23 November 2024 / Accepted: 3 December 2024 / Published: 6 December 2024

Abstract

:
To mitigate the issues of soil quality degradation and environmental pollution caused by excessive fertilizer use in apple orchards, the present study investigated the effects of organic fertilizer substitution combined with chemical nitrogen (N) fertilizer reduction on soil nutrient status, enzyme activity, and microbial communities (bacteria, fungi and archaea) over one year in an apple orchard. Five fertilization treatments were implemented, including 100% chemical fertilizer (CK), 80% chemical fertilizer + 20% liquid humic fertilizer (S1), 60% chemical fertilizer + 40% liquid humic fertilizer (S2), 60% chemical fertilizer + 20% liquid humic fertilizer (S3), and 40% chemical fertilizer + 40% liquid humic fertilizer (S4). Substituting chemical fertilizers with liquid humic fertilizers effectively enhanced the soil organic matter (SOM) content in the topsoil (0–20 cm) for all treatments. Compared to CK, the amounts of available N (NO3-N and NH4+-N) were decreased in the topsoil and the amounts of total N, total phosphorous and available phosphorous were increased in the subsoil (20–40 cm) for all treatments. The β-diversity of bacterial communities exhibited the highest sensitivity to soil environmental changes, followed by that of archaea, whereas fungi demonstrated the least susceptibility. The higher soil carbon/nitrogen ratio and SOM content in S2 altered the abundance of microorganisms (Proteobacteria, Ascomycota, and Crenarchaeota) that were closely related to the decomposition and mineralization of SOM and N, enhancing the efficiency of SOM decomposition. The activities of sucrase (SUC), urease (UE), and phosphatase were increased, also promoting the conversion efficiency of SOM and improving N fixation and soil fertility. In the organic fertilizer substitution treatments (S1 and S2), the abundance of dominant Actinobacteriota, Ascomycota and Crenarchaeota phyla were increased, as well as the activities of SUC and UE, accelerating the decomposition and mineralization of SOM and improving soil fertility. In the top, organic fertilizer substitution combined with reduced chemical N fertilizer (S3 and S4) treatments increased the abundance of bacteria and fungi. In addition, RDA showed that total potassium content could significantly affect changes in the bacterial and fungal community structure in subsoil. Overall, organic fertilizer substitution enhanced the content of soil available nutrients and improved soil nutrient retention. It is recommended to promote organic fertilizer substitution + chemical N fertilizer reduction (S4) with the supplementation of potassium fertilizer in the subsoil. The findings provide a theoretical basis and practical guidance for improving orchard soil management and achieving sustainable development in the apple industry.

1. Introduction

China is the largest apple producer in the world, with its apple production accounting for nearly half of the global total [1]. However, China’s current apple production is confronted with the significant challenge of high input and low output [2], which hampers the sustainable, high-quality development of the apple industry. Studies have shown that the average nitrogen (N) application rate in apple orchards on the Loess Plateau region has reached as high as 1220 kg/hm2, far exceeding the recommended application rate of 150–250 kg/hm2, and is 5 to 12 times higher than that in developed apple-producing countries (100–220 kg/hm2) [3]. The overuse of chemical N fertilizers in apple orchards not only leads to resource inefficiency but also contributes to the degradation of soil structure and the contamination of downstream aquatic ecosystems [4]. Reducing chemical fertilizer use through combining organic and inorganic fertilizers is a viable approach to promoting green and sustainable development in the apple industry.
Organic fertilizer substitution can increase soil organic matter (SOM) content, enhance soil biological activity, and maintain soil productivity [5]. In a crop rotation system of winter wheat (Triticum aestivum L.) and summer maize (Zea mays L.), a 20% organic fertilizer substitution increased the content of SOM, total nitrogen (TN), and total phosphorus (TP), and increased the abundance of bacterial flora in typical calcareous alluvial soil [6]. Organic fertilizers can provide more carbon and energy material for microorganisms. The application of biogas slurry combined with chemical fertilizer in a 50:50 ratio could modify the apple orchard soil bacterial community structure and increase the relative abundance of beneficial flora (e.g., Acidobacteria and Parasegetibacter). Meanwhile, it also enhanced functional groups involved in carbon and N cycling, such as chemoheterotrophy, cellulolysis, and N fixation [7]. A 50% substitution of pig manure for chemical fertilizer increased the abundance of Clostridiales and Bacillales in peanut soils, and the co-occurrence network structure of soil bacteria became more complex, with a more stable community structure [8]. In a winter wheat–summer maize double-cropping system, long-term 30% pig manure substitution could improve soil fertility, leading to stable crop yield and soil enzyme activity [9].
Chemical N fertilizer reduction could affect the pH and SOM content of the rhizosphere soil in tobacco, affecting the activities of sucrase (SUC), catalase (CAT), urease (UE), and phosphatase (PHO), and altering soil bacterial community dynamics [10]. The substitution of pigeon manure organic fertilizer combined with a 20% reduction in N application significantly increased the SOM content and the activities of CAT and UE in vegetable fields [11]. Compared to bacteria, fungi were more sensitive to changes in soil physicochemical properties caused by N reduction practices, whereas chicken manure substitution of chemical fertilizers could increase the stability of fungal community structure in maize fields [12,13,14]. Substituting chemical fertilizers with commercial organic fertilizers over a one-year period in an apple orchard had shown that a 40% substitution with organic fertilizer improved apple fruit yield and quality [15]. A 25% reduction in N fertilizer combined with bio-organic fertilizer also decreased soil pH, enhanced soil nutrient levels, and increased red raspberry yield [16]. Overall, organic fertilizer substitution and chemical N fertilizer reduction can increase SOM and total N content, improve soil fertility [17], and enhance the abundance of soil bacteria and fungi, stabilizing the soil microenvironment under extreme conditions such as water and nutrient stress [18]. However, there is limited research on the effects of organic fertilizer substitution and N fertilizer reduction on soil microbial community structure with respect to bacteria, fungi and archaea in orchards.
This study investigated the impact of organic fertilizer substitution and chemical N fertilizer reduction on soil physicochemical properties, nutrient content, extracellular enzyme activities, and the microbial communities of bacteria, fungi, and archaea. The scientific hypothesis is that organic fertilizer substitution and chemical N fertilizer reduction not only enhance the activities of SUC, UE, and PHO, but also promote the transformation of SOM and improve N fixation capacity. Additionally, these changes influence the diversity of soil microorganisms, alter their community structure, and increase the abundance of microorganisms related to the decomposition of SOM and N. The findings offer theoretical insights and practical guidance for optimizing integrated soil management practices in apple orchards, thereby supporting green and sustainable development in the apple industry.

2. Materials and Methods

2.1. Study Area

This study was conducted at the Baishui Apple Experimental Station in Weinan city, Shaanxi Province, China (109°16′–109°45′ E, 35°4′–35°27′ N) (Figure S1), which is located in the transition zone between the Guanzhong Plain and the Northern Shaanxi Plateau, characterized by the typical loess hills and gullies of the Weibei Loess Plateau. This region has a warm temperate continental monsoon climate, with an average annual rainfall of 577 mm and elevation of 1080 m above sea level, an average annual temperature of 9.2 °C, an annual total of 2552 h of sunshine, and a frost-free period of 180 days. The soil type is black loessial soil, based on the Chinese Soil Genetic Classification System, which is developed from loess. The soil texture is classified as clay loam based on the soil texture classification system of United States Department of Agriculture. According to the World Reference Base for Soil Resource [19], black loessial soil is classified as Cambisols.
The Baishui Apple Experimental Station encompasses 10.67 ha of land. Specifically, an area of 420 m2 had been designated for conducting fertilizer research, with each plot covering 24 m2. Six-year-old dwarf Ruiyang apple trees were selected as the research material. Healthy, high-quality, and mature trees with consistent growth were chosen. The planting spacing was 1.5 × 4 m. Four trees were used for each treatment, with three replicates per treatment; thus, 60 trees were adopted. The replicate groups were arranged randomly, and buffer rows were set between every two treatments (Figure S2).

2.2. Organic Fertilizer Substitution and N Reduction Treatments

The field fertilization control experiment was initiated from August of 2020, prior to which 59,970 kg/ha of well-decomposed sheep manure had been applied to enhance soil quality. Fertilizer was applied using a trenching method, where trenches were dug on both sides of the apple trees. The trenches were located 40 cm from the tree trunks within the row spacing, with a trench width of 40 cm and a depth of 30 cm. Other agronomic practices followed the standard practices of the experimental station, including weeding, summer pruning, etc. Basal fertilizer was applied in September, bud-promoting fertilizer in April of the following year, and fruit-promoting fertilizer in June, accounting for 30%, 20%, and 50% of the total chemical fertilizer application, respectively.
Five fertilization treatments were implemented, including 100% chemical fertilizer (CK), 80% chemical fertilizer + 20% liquid humic fertilizer (S1), 60% chemical fertilizer + 40% liquid humic fertilizer (S2), 60% chemical fertilizer + 20% liquid humic fertilizer (S3), and 40% chemical fertilizer + 40% liquid humic fertilizer (S4) (Table 1). In the control (CK) treatment, the chemical fertilizer used was a balanced fertilizer containing 14% N, 15% P2O5, and 16% K2O. For S2–S4 treatments, a commercial humic acid fertilizer made from weathered coal was applied, with a pH of 6.5 and N, P2O5, and K2O contents of 14.10%, 1.43%, and 4.68%, respectively. In CK, chemical N fertilizer was applied in the form of balanced fertilizer, so reducing chemical N fertilizer in other treatments also led to a reduction in phosphorus (P) and potassium (K) application, which were supplemented with calcium superphosphate (16% P2O5) and potassium sulfate (50% K2O). Therefore, compared to CK, the total N application amounts in S1 and S2 treatments remained the same, but 20% and 40% of the chemical N fertilizers were replaced with organic fertilizers, respectively. In S3 and S4 treatments, based on the organic fertilizer substitution in S1 and S2, the total N application amounts were reduced to 80% of the total N application. The application amounts of P and K were the same for all treatments.

2.3. Soil Sampling

In October 2021, after one year of fertilization, soil samples were collected from the apple orchard. For each treatment group, soil samples were collected at a distance of 1.2 m from the tree trunk along the direction of the fertilization trench. Topsoil (0–20 cm) and subsoil (20–40 cm) were sampled using a stainless steel soil auger. Each treatment included four apple trees, from which eight soil core samples were collected. These samples were thoroughly mixed to form one bulk soil sample. A total of 30 bulk samples, comprising 15 topsoil and 15 subsoil samples, were collected. A portion of the soil was placed in sterile bags, transported in insulated boxes, and stored in an ultra-low temperature freezer at −80 °C for microbial analysis. Another portion was stored in a refrigerator at 4 °C for the determination of soil enzyme activity. The remaining soil was air-dried, sieved, and used for the determination of soil physicochemical properties.
The basic physical and chemical properties of soils were analyzed with standard soil analysis methods [20]. Soil pH was measured at a 1:2.5 soil-to-water ratio using a pH meter (FE28, Mettler Toledo, Zurich, Switzerland). Soil electrical conductivity (EC) was measured at a 1:5 soil-to-water ratio using electrical conductivity (Mettler Toledo, Zurich, Switzerland). The SOM content was quantified through the K2Cr2O7 oxidation method. The cation exchange capacity (CEC) of the soil was measured with the exchange method. TN content in the soil was determined using the Kjeldahl method. Both NH4+-N and NO3-N were extracted with KCl solution, with the resulting extracts analyzed with a continuous flow analyzer (FIA Compact, Berlin, Germany). TP and available phosphorous (AP) levels were measured using the molybdenum blue method. Total potassium (TK) and available potassium (AK) contents were analyzed using a flame photometer (PinAAciie 900F, Waltham, MA, USA). The basic physical and chemical properties reported in the study were the average result of nine measurements. The apple fruit yield under each fertilization treatment was also measured.

2.4. Determination of Soil Enzyme Activity

The activities of four soil extracellular enzymes, CAT, SUC, UE, and PHO, were measured. CAT activity was determined using the K permanganate titration method; SUC activity was measured using the 3,5-dinitrosalicylic acid method; UE activity was determined using the phenol–sodium hypochlorite colorimetric method, and PHO activity was measured using the disodium phenyl phosphate colorimetric method [21].

2.5. Analysis of Soil Microbial Community

High-throughput sequencing was used to analyze the types and abundance of bacteria, fungi, and archaea in the soil [22]. The primers used for bacteria, fungi, and archaea were 341F (CCTAYGGGRBGCASCAG) and 806R (GGACTACNNGGGTATCTAAT), ITS5-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC), and U519F (CAGYMGCCRCGGKAAHACC) and 806R (GGACTACNSGGGTMTCTAAT), respectively.
Soil samples were processed using a magnetic bead soil genomic DNA extraction kit (Tiangen Biotech Co., Ltd., Beijing, China) to extract genomic DNA. PCR products were detected using 2% agarose gel electrophoresis. Qualified PCR products were purified using magnetic beads and quantified using enzyme labeling. Equal amounts of PCR products were pooled based on their concentrations, thoroughly mixed, and checked using 2% agarose gel electrophoresis. The target bands were recovered using a universal DNA purification recovery kit (Tiangen Biotech Co., Ltd., Beijing, China). Library construction was performed using a NEB Next Ultra II DNA Library Prep Kit (New England Biolabs, Inc., Ipswich, MA, USA), and the constructed library was quantified using Qubit and Q-PCR. Once the library met the quality standards, sequencing was performed on the NovaSeq6000 platform.
The raw data were obtained by matching the barcode sequences and PCR amplification primer sequences from the sequenced data. After removing the barcode and primer sequences, the data were compared with the database to detect and eliminate chimeras, yielding effective data (Effective Tags). The Effective Tags were denoised using the DADA2 module in QIIME2, with sequences with an abundance of less than five being filtered out. The ASV (Amplicon Sequence Variant) sequences were obtained and subjected to species annotation.

2.6. Statistical Analysis

Data analysis was performed using SPSS 22.0 (SPSS Inc., Chicago, IL, USA) and Origin 2021 (OriginLab, Northampton, MA, USA). One-way analysis of variance (ANOVA) was used to compare the significant differences (p < 0.05) in soil physicochemical properties, enzyme activities and α-diversity (Pielou, Shannon, and Simpson) between treatments at the same depth. The microbial community β-diversity was compared using the R based vegan package. Significant differences (p < 0.05) between different treatments were compared using Duncan’s test. Pielou index measures the uniformity of species distribution within a community. The Shannon index assigns greater weight to rare species, whereas the Simpson index is more influenced by dominant species [23]. Redundancy analysis (RDA) was employed to explore the correlations between soil microbial communities and soil physicochemical properties and nutrient contents.

3. Results

3.1. Soil Physicochemical Properties and Nutrient Content Under Different Fertilization Treatments

The physicochemical properties and nutrient contents of orchard soil under different fertilization treatments are shown in Figure 1. In the topsoil, the pH value was highest in the CK treatment, while the pH in the S3 treatment was significantly lower than in other treatments. In the subsoil, the pH in all fertilization treatments was significantly lower than in CK (Figure 1a). Compared to CK, the EC (Figure 1b) was increased in the subsoil and the CEC (Figure 1c) in the topsoil was reduced for all treatments. As soil depth increased, SOM content decreased. The SOM content in the topsoil was higher in all treatments compared to CK, with the S1 and S4 treatments having SOM contents of 25.56 g/kg and 25.27 g/kg, respectively, representing increases of 13.6% and 12.3%. In the 20–40 cm subsoil, the SOM content in the CK treatment was lower than those in the S1, S2, and S3 treatments but significantly higher than that in S4 (Figure 1d) The TN, TP, TK, NO3-N, AP, and AK contents decreased with increasing soil depth (Figure 1f–k). In the S4 treatment, the NH4+-N content in the topsoil was higher than in other treatments (Figure 1e). The S2 treatment significantly increased NO3-N and NH4+-N contents in the subsoil compared to other treatments (Figure 1e,f). Compared to CK, all treatments except S4 reduced the total nutrient content in the topsoil and increased the TN and TP contents in the subsoil, but TK content was reduced in the subsoil (Figure 1g–k), even though this was not statistically significant. Meanwhile, the apple yield of CK was measured to be 30,071.51 kg/ha, while there was an insignificant decrease of 1.27% for S1, and the yields were increased by 11.84% 1.11% and 7.58% in the S2, S3 and S4 treatments, respectively. Thus, the fertilization treatments applied in this study resulted in negligible reductions in yield.

3.2. Soil Enzyme Activity Under Different Fertilization Treatments

The effects of different fertilization treatments on soil enzyme activity are shown in Figure 2. As soil depth increased, CAT activity showed an increasing trend, while SUC, UE, and PHO activities showed a decreasing trend. In both the topsoil and subsoil, CAT activities under all fertilization treatments were lower than those in CK. However, SUC activity was higher, especially in the topsoil in the S2 treatment, where it was 78.45% greater than in CK. In the topsoil, UE activity was significantly higher in all fertilization treatments compared to CK. However, no significant differences were detected among the treatments in the subsoil. PHO activity in the topsoil was higher in the S1 treatment compared to CK, while it was significantly lower in the S4 treatment. In the subsoil, PHO activity in the CK treatment was lower than in all other fertilization treatments.
The correlation analysis of enzyme activity with soil physicochemical properties and nutrient contents, as shown in Figure 3, indicated that soil CAT activity was significantly negatively correlated with SOM (−0.76), TN (−0.86), NO3-N (−0.86), TP (−0.87), AP (−0.75), and AK (−0.73), while it was positively correlated with soil pH. This suggests that higher pH promoted CAT activity. Conversely, SUC, UE, and PHO activities were positively correlated with EC, SOM, TN, NO3-N, TP, AP, TK, and AK, but negatively correlated with pH and NH4+-N content. Additionally, CAT activity showed negative correlations with SUC (−0.83), UE (−0.71), and PHO (−0.71) activities.

3.3. Soil Microbial Community Structure Under Different Fertilization Treatments

3.3.1. Changes in Soil Bacterial Community Structure

Table S1 presents the effects of different fertilization treatments on the α-diversity of soil microorganisms. α-diversity reflects the diversity of the soil microbial community within a specific habitat. In the topsoil, the Pielou, Shannon, and Simpson indices were higher in all fertilization treatments compared to CK, indicating that organic fertilizer substitution and N reduction increased the evenness and diversity of the soil bacterial community in the topsoil. In the subsoil, the Pielou indices were decreased in all fertilization treatments compared to CK, while the Shannon indices increased in the S1 and S3 treatments, and the Simpson indices showed no significant changes. These differences were not statistically significant, suggesting that organic fertilizer substitution and N reduction had a minimal impact on the bacterial community structure in the subsoil.
The β-diversity analysis of the soil bacterial community structure is shown in Figure 4a. β-diversity effectively measures the variation in species composition within a habitat. The first principal component (PC1) and the second principal component (PC2) explained 6.96% and 4.30% of the total variability, respectively. In the topsoil, there were differences between the S1 and S2 treatments, revealing that a high proportion of organic fertilizer substitution significantly influenced the species composition of the soil bacterial community. There were also significant differences between S2 and S4, indicating that N reduction significantly affected the species composition of the soil bacterial community. In the subsoil, CK formed a distinct group compared to the other treatments, demonstrating that all treatments significantly altered the species composition of the bacterial community in the subsoil.
Figure 5a shows the relative abundance of bacteria under different fertilization treatments. In the topsoil, Proteobacteria was the most abundant bacterial phylum, with an average proportion of 33.38%. In addition, Actinobacteriota, Acidobacteriota, and Bacteroidota also had relatively high abundance. Compared to CK, a higher proportion of organic substitution (S2) increased the abundance of Proteobacteria and Actinobacteriota, while a lower proportion of organic substitution (S1) reduced the abundance of Proteobacteria, Acidobacteriota, and Bacteroidota. In the topsoil, all treatments increased the abundance of Actinobacteriota while decreasing the abundance of Proteobacteria (except S2), Acidobacteriota, and Bacteroidota. In the subsoil, the most abundant bacterial phyla were Proteobacteria, Acidobacteriota, and Actinobacteriota. Compared to CK, all treatments reduced the abundance of Actinobacteriota in the subsoil, while increasing the relative abundance of Proteobacteria, Acidobacteriota, and Gemmatimonadota.
Linear Discriminant Analysis Effect Size (LEfSe) analysis is a method for discovering and interpreting high-dimensional biomarkers, aiding in the identification of microbial taxa with notable differences across various samples or treatments [24]. Due to significant disparities in β-diversity between the S2 and S4 treatments, LEfSe analysis identified that the bacterial taxa differed notably among treatments (Figure S3). Significant discrepancies in microbial phyla were observed in the CK treatment, where Bacteroidota was predominant in the topsoil, while Actinobacteriota was more abundant in the subsoil. In the S2 treatment, significant differences were noted with Proteobacteria in the topsoil and Cyanobacteria in the subsoil. Figure 6a shows the redundancy analysis (RDA) of soil physicochemical properties and nutrient contents within the bacterial community structure. In the topsoil, the main factors influencing the bacterial community structure were SOM, TP, and pH. In the subsoil, the primary factors driving changes in the bacterial community structure were soil pH, TN, TP, and TK.

3.3.2. Changes in Soil Fungal Community Structure

In the topsoil, compared to CK, the Pielou, Shannon, and Simpson indices were decreased in the S2 and S4 treatments, indicating that a high proportion of organic fertilizer substitution reduced fungal community diversity. In contrast, the S1 and S3 treatments had little effect on the Pielou and Simpson indices but increased the Shannon index, suggesting that a low proportion of organic fertilizer substitution enhanced fungal community diversity (Table S1). In the subsoil, the Pielou, Shannon, and Simpson indices in the S3 and S4 treatments were lower than in CK, indicating that organic fertilizer substitution and N reduction reduced fungal community diversity in the subsoil (Table S1).
The β-diversity analysis of the fungal community structure is shown in Figure 4b. PC1 explained 6.71% of the total variation, and PC2 explained 6.47% of the total variation. Significant differences in fungal communities were observed between the topsoil and subsoil, except for treatment S2, while the differences between fungal communities among treatments in the topsoil and subsoil were relatively small, suggesting that organic fertilizer substitution and N reduction had a minimal impact on changes in fungal composition.
Figure 5b shows the relative abundance of fungi in different fertilization treatments. Among the fungal phyla, the relative abundance of Ascomycota reached 50% in all treatments, followed by Basidiomycota and Mortierellomycota. In the topsoil, organic fertilizer substitution treatments (S1 and S2) increased the relative abundance of Ascomycota compared to CK. In the subsoil, the relative abundance of Ascomycota in all treatments was higher than in CK. RDA (Figure 6b) revealed that SOM and TP were the main factors influencing fungal community structure in the topsoil, whereas soil pH, TN, and TK were the primary factors affecting fungal community structure in the subsoil.

3.3.3. Changes in Soil Archaeal Community Structure

Compared to CK, the S3 and S4 treatments significantly increased the Pielou, Shannon, and Simpson indices in the topsoil, indicating that organic fertilizer substitution and N reduction increased the evenness and diversity of the archaeal community in the topsoil. In contrast, the indices decreased in the subsoil across all treatments (Table S1). The β-diversity analysis of the archaeal community structure is shown in Figure 4c. PC1 explained 7.05% of the total variation, and PC2 explained 5.33%. The results revealed significant differences in archaeal communities between the topsoil and subsoil (except for the S4 treatment). In the topsoil, the S4 treatment formed a distinct group compared to the S1 and S2 treatments, indicating that a high proportion of organic substitution and N reduction significantly affected the β-diversity of the archaeal community structure. In the subsoil, differences in archaeal community structure among treatments were smaller, suggesting that organic fertilizer substitution and N reduction had a minimal impact on changes in archaeal composition in the subsoil.
Figure 5c shows the relative abundance of archaea under different fertilization treatments. A total of eight archaeal phyla were detected, with Crenarchaeota being the dominant phylum, accounting for over 90% of the relative abundance in all treatments, followed by Thermoplasmatota. In the topsoil, Crenarchaeota abundance was higher in the S2 and S4 treatments compared to CK. The relative abundance of Nanoarchaeota was higher in the CK and S2 treatments. In the subsoil, Crenarchaeota abundance was higher in the S2 and S4 treatments compared to CK, and organic fertilizer substitution treatments (S1 and S2) increased the abundance of Nanoarchaeota. RDA analysis (Figure 6c) indicated that soil TP, TN, and NH4+-N were the main factors influencing changes in the archaeal community structure in the topsoil, while NH4+-N was the main factor driving changes in the subsoil archaeal community structure.

4. Discussion

4.1. Effects of Different Fertilization Treatments on Soil Physicochemical Properties and Enzyme Activities

The reduction in soil pH could primarily be attributed to the application of humic fertilizer, which had a lower pH (6.5) than both the topsoil (pH 8.4) and the subsoil (pH 8.5) [25]. Additionally, the nitrification process, known to produce H+, further exacerbated this reduction in pH [26]. The SOM content in the topsoil was higher in all treatments compared to CK, indicating that the partial substitution of chemical fertilizer with humic acid fertilizer increased SOM content, consistent with previous research [27,28]. The decreased SOM content in the subsoil in the S2, S3, and S4 treatments could be attributed to the increased C/N ratio resulting from both high organic fertilizer substitution and N reduction, which enhanced microbial mineralization and decomposition of SOM [29]. Organic fertilizer substitution (S1 and S2) improved CEC in the subsoil, enhancing its buffering capacity and nutrient retention ability. The S4 treatment was most effective in increasing subsoil TN and TP contents. The reductions in TK and AK contents were caused by enhanced microbial activity in this treatment, which led to the utilization of some K in microbial metabolism [30]. The reduction in AK content may also be attributed to the application of organic fertilizer converting some free K+ into adsorbed K+ [31]. Figure 1 suggests that liquid humic fertilizer may primarily infiltrate into the subsoil, where apple roots are most densely distributed [32], benefiting apple production.
The CAT activity was inhibited in different fertilization treatments, likely because the humic acid derived from weathered coal could reduce CAT activity. On the other hand, these treatments increased SUC and UE activities, which is consistent with previous research [33]. This can be explained by the fact that organic fertilizer increased SOM content, root exudates, and microbial activity, thereby enhancing soil enzyme activity. Additionally, under N reduction conditions, the reduced NH4+-N and NO3-N contents in the soil accelerated microbial decomposition, further increasing UE activity. The application of organic fertilizer also enhanced the PHO activity of the subsoil, primarily alkaline PHO, and its activity was negatively correlated with pH, in line with previous research findings [34].

4.2. Effects of Different Fertilization Treatments on Changes in the Soil Microbial Community Structure

Organic fertilizer substitution and N reduction treatments increased the richness and diversity of the soil bacterial community, particularly in the subsoil, where organic fertilizer substitution significantly altered bacterial community structure. In the topsoil, Actinobacteriota, Acidobacteriota, and Cyanobacteria were the key contributors to bacterial community differences, while in the subsoil, Proteobacteria played a dominant role. Cyanobacteria participated in N fixation, whereas Actinobacteriota, Acidobacteriota, and Proteobacteria were involved in SOM decomposition in the soil [35]. Actinobacteriota, Proteobacteria, and Bacteroidota are copiotrophic r-strategists that thrive in high-fertility soils, mainly consuming unstable soil carbon pools; in contrast, Acidobacteriota are oligotrophic k-strategists [36,37,38]. Proteobacteria, Acidobacteriota, and Bacteroidota were highly sensitive to changes in soil chemical properties [39]. The S2 treatment increased the abundance of Proteobacteria in the topsoil, indicating that the application of humic acid fertilizer could enhance SOM content. The S3 treatment showed higher bacterial diversity in the subsoil, suggesting that the combined application of humic acid fertilizer and reduced N improves the stability of the subsoil bacterial community structure.
Fungal community diversity was increased in the topsoil, while significant differences in fungal community structure were observed in the subsoil under high organic fertilizer substitution treatments (S2 and S4), suggesting that fungal community structure was influenced by SOM and N content. P is a crucial nutrient for both bacterial and fungal growth, directly affecting the composition and function of the soil microbial community. Across all treatments, the dominant fungal phyla were Ascomycota, Basidiomycota, and Mortierellomycota, consistent with findings in other alkaline soils [40]. Ascomycota were organic decomposers and typically increased with the application of organic fertilizers.
The organic fertilizer substitution combined with N reduction treatment in the topsoil increased the richness, evenness, and diversity of the archaeal community, while archaeal diversity was decreased in the subsoil across all treatments. Fertilization treatments had a significant impact on the diversity of archaea, with high community similarity likely caused by the limited diversity of archaea species and the dominance of Crenarchaeota. In both the topsoil and subsoil, the S2 treatment increased the abundance of Crenarchaeota and Nanoarchaeota. Crenarchaeota participated in the decomposition of SOM, breaking down proteins and glucose, while Nanoarchaeota decomposed glycogen into glucose [41]. Current research on the ecological roles of archaea is still limited, and further studies are needed to understand their function in complex soil ecosystems.

5. Conclusions

Organic fertilizer substitution effectively increased SOM content in the topsoil and nutrient levels in the subsoil. The β-diversity of bacterial communities showed the greatest sensitivity to soil environmental changes, followed by archaea, while fungi were the least susceptible. All treatments significantly affected the α-diversity of soil bacteria or fungi. S2 increased the soil C/N ratio and SOM content, altering the abundance of microorganisms closely related to the decomposition and mineralization of SOM and N (such as Proteobacteria, Ascomycota, and Crenarchaeota), and improving the efficiency of SOM decomposition. Soil enzyme activity data supported these findings, showing that the subsoil enzyme activities of SUC, UE, and PHO increased, promoting the conversion of SOM, enhancing N fixation capacity, and improving soil fertility. In the subsoil, the combination of organic fertilizer substitution and N reduction (S3 and S4) increased the abundance of bacteria and fungi. Additionally, RDA showed that microbial abundance was highly correlated with TK content. Therefore, when promoting organic fertilizer substitution combined with N reduction, K supplementation in the subsoil should be considered. Future research should focus on the long-term effects of organic fertilizer substitution and N reduction on apple orchard soil quality and its application to diverse soil types, sustaining green development in the global apple industry.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14122917/s1, Table S1. The α-diversity of soil microorganisms in the apple orchard. Figure S1. Location of the study area. Figure S2. Design of the study plots. Figure S3. Microbiological LEfSe analysis (a. 0–20 cm, b. 20–40 cm).

Author Contributions

Conceptualization, Y.Y., X.Z., C.X., Y.L., L.H., Z.G. and F.H.; methodology, C.X.; software, Y.Y.; formal analysis, X.Z.; investigation, X.Z.; resources, Y.Y.; writing—original draft, Y.Y.; writing—review and editing, C.X. and F.H.; visualization, C.X. and Y.Y.; funding acquisition, C.X., Z.G. and F.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Natural Science Foundation of Shaanxi Province (2023-JC-YB-263), the National Natural Science Foundation of China (42277311), the Shaanxi Provincial Agricultural Science and Technology Innovation Program Project (NYKJ-2022-YL(XN)49), and the Tibet Agriculture and Animal Husbandry University–Northwest A&F University Joint Project (XNLH2022-04).

Data Availability Statement

The authors state that all data generated or analyzed during this study are included in this article.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Jiang, S.; Yang, C.; Guo, Y.; Jiao, X.Q. Integrated horticultural practices for improving apple supply chain sustainability: A case study in the North China Plain. Agronomy 2021, 11, 1975. [Google Scholar] [CrossRef]
  2. Wang, N.; Wolf, J.; Zhang, F.S. Towards sustainable intensification of apple production in China—Yield gaps and nutrient use efficiency in apple farming systems. J. Integr. Agric. 2016, 15, 716–725. [Google Scholar] [CrossRef]
  3. Glover, J.D.; Reganold, J.P.; Andrews, P.K. Systematic method for rating soil quality of conventional, organic, and integrated apple orchards in Washington State. Agr. Ecosyst. Environ. 2000, 80, 29–45. [Google Scholar] [CrossRef]
  4. Wan, L.; Zhao, Y.M.; Xia, L.D.; Hu, J.; Xue, T.X.; Lv, H.F.; Yao, Z.S.; Meng, F.Q.; Li, G.Y.; Butterbach-Bahl, K. Assessing the environmental sustainability of different soil disinfestation methods used in solar greenhouse vegetable production systems. Sci. Total Environ. 2023, 885, 163962. [Google Scholar] [CrossRef]
  5. Tian, S.Y.; Zhu, B.J.; Yin, R.; Wang, M.W.; Jiang, Y.J.; Zhao, C.Z.; Li, D.M.; Chen, X.Y.; Kardol, P.; Liu, M.Q. Organic fertilization promotes crop productivity through changes in soil aggregation. Soil Biol. Biochem. 2022, 165, 108533. [Google Scholar] [CrossRef]
  6. Wang, Y.J.; Xu, Y.; Jiang, L.H.; Yang, Y.; Guan, X.L.; Sun, T.; Zhao, H.Y.; Wang, Y.F.; Liu, Y.M. Effect of Mild Organic Substitution on Soil Quality and Microbial Community. Agronomy 2021, 14, 888. [Google Scholar] [CrossRef]
  7. Zhang, H.; Ma, Y.; Shao, J.Z.; Di, R.; Zhu, F.; Yang, Z.C.; Sun, J.S.; Zhang, X.Y.; Zheng, C.Y. Changes in soil bacterial community and functions by substituting chemical fertilizer with biogas slurry in an apple orchard. Front. Plant Sci. 2022, 13, 1013184. [Google Scholar] [CrossRef]
  8. Ren, T.B.; Feng, H.L.; Xu, C.S.; Xu, Q.; Fu, B.; Azwar, E.; Wei, Y.W.; Lam, S.S.; Liu, G.S. Exogenous application and interaction of biochar with environmental factors for improving functional diversity of rhizosphere’s microbial community and health. Chemosphere 2022, 294, 133710. [Google Scholar] [CrossRef]
  9. Ma, L.; Li, Z.S.; Li, Y.; Wei, J.L.; Zhang, L.F.; Zheng, F.L.; Liu, Z.H.; Tan, D.S. Variations in crop yield caused by different ratios of organic substitution are closely related to microbial ecological clusters in a fluvo-aquic soil. Field Crops Res. 2024, 306, 109239. [Google Scholar] [CrossRef]
  10. Shen, M.C.; Zhang, Y.Z.; Bo, G.D.; Yang, B.B.; Wang, P.; Ding, Z.G.; Wang, Z.B.; Yang, J.M.; Zhang, P.; Yuan, X.L. Microbial responses to the reduction of chemical fertilizers in the rhizosphere soil of flue-cured tobacco. Front. Bioeng. Biotechnol. 2022, 9, 812316. [Google Scholar] [CrossRef]
  11. Ning, C.C.; Gao, P.; Wang, B.Q.; Lin, W.P.; Jiang, N.H.; Cai, K. Impacts of chemical fertilizer reduction and organic amendments supplementation on soil nutrient, enzyme activity and heavy metal content. J. Integr. Agric. 2017, 16, 1819–1831. [Google Scholar] [CrossRef]
  12. Liu, Z.P.; Zhou, H.P.; Xie, W.Y.; Yang, Z.X.; Zhang, P.F. Effects of returning different organic materials in combination with inorganic fertilizers on the diversity of eukaryotic microorganisms in semi-arid Northern China. Agronomy 2022, 12, 3116. [Google Scholar] [CrossRef]
  13. Jin, N.; Jin, L.; Wang, S.Y.; Li, J.W.; Liu, F.H.; Liu, Z.C.; Luo, S.L.; Wu, Y.; Lyu, J.; Yu, J.H. Reduced chemical fertilizer combined with bio-organic fertilizer affects the soil microbial community and yield and quality of lettuce. Front. Microbiol. 2022, 13, 863325. [Google Scholar] [CrossRef] [PubMed]
  14. Ren, J.H.; Liu, X.L.; Yang, W.P.; Yang, X.X.; Li, W.G.; Xia, Q.; Li, J.H.; Gao, Z.Q.; Yang, Z.P. Rhizosphere soil properties, microbial community, and enzyme activities: Short-term responses to partial substitution of chemical fertilizer with organic manure. J. Environ. Manage. 2021, 299, 113650. [Google Scholar] [CrossRef] [PubMed]
  15. Li, Q.; Chen, Y.A.; Zhu, J.D.; Liu, L.Z.; Liu, J.; Cheng, C.Z.; Li, L. Effects of organic substitution on the yield and quality of apples and residual nitrate-N leaching in soil. Agronomy 2024, 14, 415. [Google Scholar] [CrossRef]
  16. Yuan, X.; Zhang, J.A.; Chang, F.Y.; Wang, X.Y.; Zhang, X.M.; Luan, H.A.; Qi, G.H.; Guo, S.P. Effects of nitrogen reduction combined with bio-organic fertilizer on soil bacterial community diversity of red raspberry orchard. PLoS ONE 2023, 7, e0283718. [Google Scholar] [CrossRef] [PubMed]
  17. Zhu, Z.L.; Bai, Y.; Lv, M.L.; Tian, G.; Zhang, X.; Li, l.; Jiang, Y.M.; Ge, S.F. Soil Fertility, microbial biomass, and microbial functional diversity responses to four years fertilization in an apple orchard in North China. Hortic. Plant J. 2020, 4, 223–230. [Google Scholar] [CrossRef]
  18. Ma, Y.J.; Shen, S.Z.; Wan, C.; Wang, S.Q.; Yang, F.X.; Zhang, K.Q.; Gao, W.X. Organic fertilizer substitution over six years improves the productivity of garlic, bacterial diversity, and microbial communities network complexity. Appl. Soil Ecol. 2023, 182, 104718. [Google Scholar] [CrossRef]
  19. IUSS Working Group WRB. World Reference Base for Soil Resources; International Soil Classification System for Naming Soils and Creating Legends for Soil Maps; International Union of Soil Sciences (IUSS): Vienna, Austria, 2022. [Google Scholar]
  20. Pansu, M.; Gautheyrou, J. Handbook of Soil Analysis: Mineralogical, Organic and Inorganic Methods; Springer: Berlin/Heidelberg, Germany, 2006. [Google Scholar]
  21. Xiao, Q.Q.; He, B.P.; Wang, S. Effect of the different fertilization treatments application on paddy soil enzyme activities and bacterial community composition. Agronomy 2023, 13, 712. [Google Scholar] [CrossRef]
  22. Lin, Y.X.; Ye, G.P.; Kuzyakov, Y.; Liu, D.Y.; Fan, J.B.; Ding, W.X. Long-term manure application increases soil organic matter and aggregation, and alters microbial community structure and keystone taxa. Soil Biol. Biochem. 2019, 134, 187–196. [Google Scholar] [CrossRef]
  23. Wang, C.; Liu, D.W.; Bai, E. Decreasing soil microbial diversity is associated with decreasing microbial biomass under nitrogen addition. Soil Biol. Biochem. 2018, 120, 126–133. [Google Scholar] [CrossRef]
  24. Lin, H.; Peddada, S.D. Analysis of microbial compositions: A review of normalization and differential abundance analysis. Npj Biofilms Microbiomes 2020, 6, 60. [Google Scholar] [CrossRef] [PubMed]
  25. Kai, T.; Adhikari, D. Effect of organic and chemical fertilizer application on apple nutrient content and orchard soil condition. Agriculture 2021, 11, 340. [Google Scholar] [CrossRef]
  26. Schroder, J.L.; Zhang, H.L.; Girma, K.; Raun, W.R.; Penn, C.J. Soil acidification from long-term use of nitrogen fertilizers on winter wheat. Soil Sci. Soc. Am. J. 2011, 75, 957–964. [Google Scholar] [CrossRef]
  27. Shang, L.R.; Wan, L.Q.; Zhou, X.X.; Li, S.; Li, X.L. Effects of organic fertilizer on soil nutrient status, enzyme activity, and bacterial community diversity in Leymus chinensis steppe in Inner Mongolia, China. PLoS ONE 2020, 15, e0240559. [Google Scholar] [CrossRef]
  28. Chen, Y.; Zhang, X.D.; He, H.B.; Xie, H.T.; Yan, Y.; Zhu, P.; Ren, J.; Wang, L.C. Carbon and nitrogen pools in different aggregates of a Chinese Mollisol as influenced by long-term fertilization. J. Soils Sediments 2010, 10, 1018–1026. [Google Scholar] [CrossRef]
  29. Pinggera, J.; Geisseler, D.; Piepho, H.P.; Joergensen, R.G.; Ludwig, B. Effect of substrate quality on the N uptake routes of soil microorganisms in different soil depths. Pedobiologia 2015, 58, 211–218. [Google Scholar] [CrossRef]
  30. Philippot, L.; Chenu, C.; Kappler, A.; Rillig, M.C.; Fierer, N. The interplay between microbial communities and soil properties. Nat. Rev. Microbiol. 2024, 22, 226–239. [Google Scholar] [CrossRef]
  31. Soumare, A.; Sarr, D.; Diedhiou, A.G. Potassium sources, microorganisms and plant nutrition: Challenges and future research directions. Pedosphere 2023, 33, 105–115. [Google Scholar] [CrossRef]
  32. Zhao, Y.G.; Ma, J.J.; Sun, X.H.; Guo, X.H. Spatial distribution of soil moisture and fine roots of apple trees under water storage pit irrigation. J. Irrig. Drain. Eng. 2014, 140, 06013001. [Google Scholar] [CrossRef]
  33. Yang, Y.H.; Li, M.J.; Wu, J.C.; Pan, X.Y.; Gao, C.M.; Tang, D.W.S. Impact of combining long-term subsoiling and organic fertilizer on soil microbial biomass carbon and N, soil enzyme activity, and water use of winter wheat. Front. Plant Sci. 2022, 12, 788651. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, G.N.; Chen, Z.H.; Zhang, A.M.; Chen, L.J.; Wu, Z.J.; Ma, X.Z. Phosphorus composition and phosphatase activities in soils affected by long-term application of pig manure and inorganic fertilizers. Commun. Soil Sci. Plant Anal. 2014, 45, 1866–1876. [Google Scholar] [CrossRef]
  35. Li, Y.L.; Tremblay, J.; Bainard, L.D.; Cade-Menun, B.; Hamel, C. Long-term effects of nitrogen and phosphorus fertilization on soil microbial community structure and function under continuous wheat production. Environ. Microbiol. 2020, 22, 1066–1088. [Google Scholar] [CrossRef] [PubMed]
  36. Luo, J.P.; Liao, G.C.; Banerjee, S.; Gu, S.H.; Liang, J.B.; Guo, X.Y.; Zhao, H.P.; Liang, Y.C.; Li, T.Q. Long-term organic fertilization promotes the resilience of soil multifunctionality driven by bacterial communities. Soil Biol. Biochem. 2023, 177, 108922. [Google Scholar] [CrossRef]
  37. Gao, R.P.; Duan, Y.; Zhang, J.; Ren, Y.F.; Li, H.C.; Liu, X.Y.; Zhao, P.Y.; Jing, Y.P. Effects of long-term application of organic manure and chemical fertilizer on soil properties and microbial communities in the agro-pastoral ecotone of North China. Front. Environ. Sci. 2022, 10, 993973. [Google Scholar] [CrossRef]
  38. Ma, T.F.; He, X.H.; Chen, S.G.; Li, Y.J.; Huang, Q.W.; Xue, C.; Shen, Q.R. Long-term organic-inorganic fertilization regimes alter bacterial and fungal communities and rice yields in paddy soil. Front. Microbiol. 2022, 13, 890712. [Google Scholar] [CrossRef]
  39. Shen, J.P.; Zhang, L.M.; Guo, J.F.; Ray, J.L.; He, J.Z. Impact of long-term fertilization practices on the abundance and composition of soil bacterial communities in Northeast China. Appl. Soil Ecol. 2010, 46, 119–124. [Google Scholar] [CrossRef]
  40. Hua, L.Q.; Yang, S.Q.; Xia, Z.F.; Zeng, H. Application of sophora alopecuroides organic fertilizer changes the rhizosphere microbial community structure of melon plants and increases the fruit sugar content. J. Sci. Food Agric. 2023, 103, 164–175. [Google Scholar] [CrossRef]
  41. Lv, X.F.; Yu, J.B.; Fu, Y.Q.; Ma, B.; Qu, F.Z.; Ning, K.; Wu, H.F. A meta-analysis of the bacterial and archaeal diversity observed in wetland soils. Sci. World J. 2014, 2014, 437684. [Google Scholar] [CrossRef]
Figure 1. Soil physiochemical properties and nutrient contents under different fertilization treatments. (a) pH; (b) EC; (c) CEC; (d) SOM; (e) NH4+-N; (f) NO3-N; (g) TN; (h) TP; (i) TK; (j) AP; (k) AK. Different lowercase letters indicate significant differences among treatments at p < 0.05.
Figure 1. Soil physiochemical properties and nutrient contents under different fertilization treatments. (a) pH; (b) EC; (c) CEC; (d) SOM; (e) NH4+-N; (f) NO3-N; (g) TN; (h) TP; (i) TK; (j) AP; (k) AK. Different lowercase letters indicate significant differences among treatments at p < 0.05.
Agronomy 14 02917 g001
Figure 2. Soil enzymes activity under different fertilization treatments. (a) CAT activity; (b) SUC activity; (c) UE activity; (d) PHO activity. Different lowercase letters indicate significant differences among treatments at p < 0.05.
Figure 2. Soil enzymes activity under different fertilization treatments. (a) CAT activity; (b) SUC activity; (c) UE activity; (d) PHO activity. Different lowercase letters indicate significant differences among treatments at p < 0.05.
Agronomy 14 02917 g002
Figure 3. Heatmap of correlations between enzyme activities and soil physicochemical properties and nutrient contents. * indicates significant correlations at p < 0.05.
Figure 3. Heatmap of correlations between enzyme activities and soil physicochemical properties and nutrient contents. * indicates significant correlations at p < 0.05.
Agronomy 14 02917 g003
Figure 4. Principal component analysis plot of microbial community composition. (a) bacteria; (b) fungi; (c) archaea. The numbers 20 and 40 represent 0–20 and 20–40 cm, respectively.
Figure 4. Principal component analysis plot of microbial community composition. (a) bacteria; (b) fungi; (c) archaea. The numbers 20 and 40 represent 0–20 and 20–40 cm, respectively.
Agronomy 14 02917 g004
Figure 5. Relative abundance of soil microorganisms under different fertilization treatments. (a) bacteria; (b) fungi; (c) archaea.
Figure 5. Relative abundance of soil microorganisms under different fertilization treatments. (a) bacteria; (b) fungi; (c) archaea.
Agronomy 14 02917 g005
Figure 6. Redundancy analysis of microbial communities in relation to soil physicochemical properties and nutrient contents. (a) bacteria; (b) fungi; (c) archaea.
Figure 6. Redundancy analysis of microbial communities in relation to soil physicochemical properties and nutrient contents. (a) bacteria; (b) fungi; (c) archaea.
Agronomy 14 02917 g006
Table 1. Different fertilization modes for soils in the apple orchard.
Table 1. Different fertilization modes for soils in the apple orchard.
TreatmentFertilization ModeBasal Fertilizer
kg/ha
Ratio of Chemical and Organic FertilizerApplication Amounts of Chemical Fertilizer (kg/tree)Application Amount of Liquid Humic Fertilizer (kg/tree)
Well-Decomposed Sheep ManureBalanced FertilizerSuperphosphatePotassium Sulfate
CKControl59,970100% chemical fertilizer2.5000
S1Organic fertilizer substitution mode59,97080% chemical fertilizer + 20% liquid humic fertilizer 20.4240.1140.496
S259,97060% chemical fertilizer + 40% liquid humic fertilizer 1.50.8490.2270.994
S3Organic fertilizer substitution + N reduction mode59,97060% chemical fertilizer + 20% liquid humic fertilizer 1.50.8940.2740.496
S459,97040% chemical fertilizer + 40% liquid humic fertilizer 11.3180.3870.994
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yan, Y.; Zhang, X.; Liu, Y.; Hou, L.; Geng, Z.; Hu, F.; Xu, C. Impact of Organic Fertilizer Substitution and Chemical Nitrogen Fertilizer Reduction on Soil Enzyme Activity and Microbial Communities in an Apple Orchard. Agronomy 2024, 14, 2917. https://doi.org/10.3390/agronomy14122917

AMA Style

Yan Y, Zhang X, Liu Y, Hou L, Geng Z, Hu F, Xu C. Impact of Organic Fertilizer Substitution and Chemical Nitrogen Fertilizer Reduction on Soil Enzyme Activity and Microbial Communities in an Apple Orchard. Agronomy. 2024; 14(12):2917. https://doi.org/10.3390/agronomy14122917

Chicago/Turabian Style

Yan, Yuyang, Xinran Zhang, Yuan Liu, Lei Hou, Zengchao Geng, Feinan Hu, and Chenyang Xu. 2024. "Impact of Organic Fertilizer Substitution and Chemical Nitrogen Fertilizer Reduction on Soil Enzyme Activity and Microbial Communities in an Apple Orchard" Agronomy 14, no. 12: 2917. https://doi.org/10.3390/agronomy14122917

APA Style

Yan, Y., Zhang, X., Liu, Y., Hou, L., Geng, Z., Hu, F., & Xu, C. (2024). Impact of Organic Fertilizer Substitution and Chemical Nitrogen Fertilizer Reduction on Soil Enzyme Activity and Microbial Communities in an Apple Orchard. Agronomy, 14(12), 2917. https://doi.org/10.3390/agronomy14122917

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop