Next Article in Journal
Malt Barley Yield and Quality Response to Crop Water Stress Index
Next Article in Special Issue
A Study on the Infrageneric Classification of Hordeum Using Multiple Methods: Based on Morphological Data
Previous Article in Journal
Post-GWAS Prioritization of Genome–Phenome Association in Sorghum
Previous Article in Special Issue
Validation of KASP Markers Associated with Hydrogen Cyanide in Fresh Cassava Roots in Uganda Cassava Germplasm
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Functional Molecular Markers for Viviparous Germination Resistance in Rice

1
Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang 50424, Republic of Korea
2
Rice Breeding Innovation Department, International Rice Research Institute, Los Baños 4031, Philippines
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2024, 14(12), 2896; https://doi.org/10.3390/agronomy14122896
Submission received: 4 November 2024 / Revised: 29 November 2024 / Accepted: 2 December 2024 / Published: 4 December 2024
(This article belongs to the Special Issue Genetics and Breeding of Field Crops in the 21st Century)

Abstract

Rice (Oryza sativa) plays a pivotal role in global food security. Understanding the genetics of rice cultivation is crucial, particularly for traits such as viviparous germination, which significantly influences germination and yield. Our research aimed to elucidate the genetic and molecular mechanisms by which the Sdr4 gene influences viviparous germination and to develop novel molecular markers for this gene to enhance breeding strategies against viviparous germination. In all, 683 rice cultivars and 100 F2 plants were used for viviparous germination and genetic analysis using KASP (Kompetitive Allele-Specific PCR) and agarose gel-based markers related to viviparous germination tolerance. We developed and used a polymorphic agarose gel-based marker and a KASP marker targeting the Sdr4 gene. A genetic analysis of field-grown rice cultivars and the F2 population revealed that the two markers on Sdr4 were functional for the genomic selection of SNPs and InDels related to dormancy. The Pearson correlation coefficient (r = 0.74, p-value = 3.31 × 10−8) between the Sdr4-IND KASP marker genotype and viviparous germination rate demonstrated a significant positive correlation, supporting the marker’s utility for selecting rice varieties with diminished viviparous germination. This insight serves as a critical theoretical foundation for breeding strategies for developing early-maturing rice varieties with enhanced resistance to viviparous germination, addressing pivotal challenges in rice cultivation, and ensuring food security.

1. Introduction

Rice (Oryza sativa) serves as a staple food for billions of people and plays a pivotal role in global food security. Understanding the genetic underpinnings of rice cultivation is crucial, particularly focusing on traits such as viviparous germination, which significantly influences germination and yield. Viviparous germination refers to the premature sprouting of grains on the panicle before harvest. This phenomenon reduces yield and degrades grain quality, negatively impacting agricultural economies. Changes in climate patterns, such as increased rainfall and higher temperatures, are expected to elevate the frequency of viviparous germination. Projections indicate that rice production could decrease by 8.7% by the 2050s and 16.5% by the 2080s due to climate-related growth challenges, including viviparous germination [1]. Moreover, experiments conducted on elite Korean rice varieties have shown that viviparous germination susceptibility varies significantly depending on regional climate conditions and varietal traits. For example, while some varieties exhibited strong resistance to viviparous germination in specific regions, others were highly susceptible under the same conditions, underscoring the importance of localized breeding strategies and marker development tailored to climate and varietal characteristics [2]. Traditional breeding methods for rice improvement, which rely heavily on crossbreeding and phenotypic evaluation, have been instrumental in developing high-yielding and disease-resistant varieties. However, these approaches are time-consuming and resource-intensive, often requiring multiple growing seasons to evaluate complex traits accurately. In contrast, marker-assisted selection (MAS) leverages molecular markers to identify desirable genetic variations directly, bypassing the need for extensive field evaluations. For instance, KASP markers, as highlighted by Cheon et al. (2018) and Tang et al. (2022), provide rapid and accurate genotyping capabilities, enabling the high-throughput screening of genetic resources with minimal time and labor. Compared to traditional gel-based markers, KASP markers are particularly advantageous for distinguishing between homozygous and heterozygous individuals in a single PCR, significantly enhancing the efficiency of MAS programs. These advancements not only expedite the breeding cycle but also allow for a more precise selection of traits like viviparous germination resistance, as demonstrated in this study [3,4]. This study focused on the Seed Dormancy 4 (Sdr4) gene, a crucial regulator of seed dormancy and a key determinant of viviparous germination tolerance in rice. Recent work by Lee et al. [1] has fine-mapped genes associated with pre-harvest sprouting tolerance in rice, providing a foundation for further research on the Sdr4 gene’s role in this trait. Our research aimed to develop molecular markers for the Sdr4 gene influencing viviparous germination to enhance rice breeding strategies. We hypothesized that variations within the Sdr4 gene, through specific functional nucleotide polymorphisms (FNPs), significantly impact rice viviparous germination tolerance, offering new avenues for breeding early-maturing rice varieties with improved resistance to viviparous germination.
Rice seeds undergo complex developmental processes involving embryonic and radicle formation, nutrient accumulation, dehydration, and dormancy onset. In particular, this last trait, although crucial for ensuring germination under optimal conditions, remains understudied, as noted by Miyoshi et al. [5] and Finch-Savage and Leubner-Metzger [6]. Dormancy involves a series of intricate physiological and biological processes under the influence of both endogenous and environmental factors. Recent research has further highlighted the evolutionary trajectory of the Sdr4 gene in rice. Huh et al. (2013) provided insights into the transcriptome profiles of rice cultivars with contrasting dormancy traits, revealing key genes and pathways involved in dormancy regulation [7]. Studies have shown that Sdr4-like (Sdr4L) genes have undergone lineage-specific expansions in various monocot and dicot species due to gene duplication events, with selective constraints driving molecular evolution at the amino acid level. This evolutionary pattern indicates a rich genetic diversity within Sdr4, which provides a valuable genetic resource for breeding programs targeting viviparous germination resistance. Leveraging this diversity, our study developed KASP markers specifically targeting functional nucleotide polymorphisms (FNPs) within Sdr4. These markers enable the efficient screening of elite genetic resources, facilitating the identification and selection of varieties with enhanced tolerance to viviparous germination. By integrating evolutionary insights with practical molecular tools, this research bridges foundational genetic understanding with advanced breeding strategies, accelerating the development of resilient rice varieties. The role of Sdr4 in seed dormancy and viviparous germination tolerance is not only important for rice domestication but also provides insights into identifying functional nucleotide polymorphisms (FNPs) that can differentiate between Sdr4-n and Sdr4-k alleles. Developing markers targeting these FNPs allows for precise genotyping, thereby improving breeding efficiency and enabling the selection of varieties with enhanced resistance to pre-harvest sprouting. Understanding these evolutionary parallels and conserved motifs across species further supports the practical application of Sdr4 in marker-assisted breeding. Zhang et al. (2021) and Shilpha et al. (2021) laid the foundational understanding of the genetic and physiological mechanisms underlying viviparous germination, particularly emphasizing the role of the Sdr4-OsVP1 network and the broader genetic factors influencing seed dormancy [8,9]. Building upon their findings, this study aims to bridge the gap between theoretical insights and practical applications by developing molecular markers that can directly contribute to rice breeding strategies. By enhancing our understanding of viviparous germination and providing efficient tools for genetic selection, this research accelerates the improvement of rice varieties resistant to pre-harvest sprouting.
Our study specifically investigated the molecular mechanism underlying the expression of the Sdr4 gene in rice and examined its role in mediating the hormonal regulation of seed dormancy, as emphasized by Sugimoto et al. [10] and Izawa et al. [11]. Sugimoto et al. (2010) demonstrated that Sdr4 mediates the ABA signaling pathway, which is essential for regulating seed dormancy and preventing premature germination, ensuring optimal germination conditions. This regulation ensures optimal conditions for germination, highlighting the functional role of Sdr4 in the physiological processes of seed dormancy. Guo et al. (2013) further emphasized that regulatory genes such as GERMINATION DEFECTIVE 1 interact within the ABA pathway to modulate seed germination and seedling development, underscoring the complexity of hormonal control in dormancy mechanisms [12]. The genetic variability in the Sdr4 gene, including its two haplotypes, Sdr4-n and Sdr4-k, was a focal point of this research. As identified by Sugimoto et al. (2010), Sdr4 mediates the ABA signaling pathway, which is crucial for regulating seed dormancy and preventing premature germination, thereby ensuring optimal conditions for germination. This highlights the functional role of Sdr4 in the physiological processes of seed dormancy. The functional differences between the alleles of the Sdr4 gene can be attributed to FNPs located within a specific 1.6 kb region. This region includes the protein-coding area and the 3′-UTR, featuring an SNP within the 3′-UTR and multiple sequence changes in the coding region, corresponding to one InDel and three amino acid substitutions. Notably, the Val-Ile (VI) dipeptide sequence in Sdr4-k is highly conserved across various species, while other amino acids associated with simple SNPs are not. Thus, these polymorphisms were considered to be FNPs [10,11]. This variability is key to understanding rice adaptation and the regulation of viviparous germination, which is a critical agricultural challenge. Recent genome-wide association studies (GWASs) have further confirmed the role of genetic polymorphisms, particularly those associated with seed dormancy-related genes, in rice adaptation [13,14].
Our understanding of the role of Sdr4 in seed dormancy and viviparous germination tolerance in rice builds on the existing literature. For instance, Kovach et al. [15] provided crucial background knowledge on how genes such as Sdr4 have played significant roles in the domestication process of rice, offering new insights into the history of rice domestication. Similarly, research by Izawa et al. [11] has contributed to our understanding of the major genetic changes that occurred during rice domestication by examining DNA changes relevant to this process [15,16]. Furthermore, recent studies have highlighted the interaction between Sdr4 and OsVP1 in regulating seed dormancy through the ABA signaling pathway. Specifically, Zhang et al. [8] demonstrated that the loss-of-function mutants of OsVP1 exhibit viviparous germination, reinforcing the importance of the OsVP1-Sdr4 regulatory network in maintaining seed dormancy.
Recent progress in plant genotyping, especially the shift towards SNP-based markers, as noted by Jatayev et al. [17], influenced the methodology of this study. Specifically, we used KASP markers to elucidate the genetic pathways of the Sdr4 gene in Oryza sativa during rice germination. These cost-effective and versatile markers are useful for variety identification and breeding guidance, enhancing efficiency by distinguishing rice varieties. Additionally, PCR-based DNA markers have revolutionized plant breeding by enabling precise selection based on genetic variation. These advancements highlight the impact of molecular marker-assisted selection in rice breeding, offering a more efficient route for developing new varieties with desirable traits. Tang et al. [4] demonstrated the effectiveness of KASP markers for variety identification and breeding guidance in both conventional and hybrid rice, providing further evidence of the importance of these markers in rice breeding.
Given the critical importance of enhancing the efficiency of breeding viviparous germination-resistant rice varieties, this research specifically aimed to develop molecular markers for the Sdr4 gene, which plays a pivotal role in viviparous germination and resistance to this undesirable trait. Recognizing the substantial impact of such markers on the acceleration of the breeding process, our study focused on leveraging the genetic insights obtained by analyzing 683 rice varieties and comparing Sdr4 genotypes in an F2 population consisting of 100 individuals. Our ultimate goal in this study was to facilitate the efficient selection of rice varieties with enhanced resistance to viviparous germination, thereby increasing the productivity and sustainability of rice cultivation. Through the development and application of these molecular markers, we aimed to significantly advance molecular breeding strategies for rice, ensuring that the varieties developed are not only resilient but meet the demands of both farmers and consumers in diverse environments as well.

2. Materials and Methods

2.1. Materials and Phenotyping

The experimental materials used included F2 populations developed by crossing the elite Japonica rice variety ‘Saeilmi’ with ‘NRT383’, a near-isogenic line (NIL) incorporating the Sdr4-k allele into ‘Saeilmi’. In turn, ‘NRT383’ was created by backcrossing the elite Japonica variety Saeilmi with the Tongil-type variety Milyang23, which carries the Sdr4-k allele, followed by two additional backcrossings with Saeilmi. A total of 100 Saeilmi × NRT383 F2 populations were cultivated in 2022 at the Southern Crop Division of the National Institute of Agricultural Sciences (Miryang, Gyeongsangnam-do, Republic of Korea) using standard paddy cultivation methods. Seeds were sown on 6 May, and after 30 d in the nursery, seedlings were transplanted on 5 June at a spacing of 30 × 15 cm, with one plant per hill, across 40 rows. Germination rates were assessed by harvesting one panicle from each of the 100 individuals with similar flowering times 45 d after heading. Subsequently, 300 seeds were collected per variety, and from these, 30 healthy seeds that showed no viviparous germination were selected for further evaluation. These seeds were sown in Petri dishes lined with filter paper to which 2 mL of water was added. The dishes were then covered without sealing and incubated at 32 °C for 7 d to calculate the proportion of germinated seeds. After evaluating the effectiveness of the markers, the match between gel-based marker and KASP marker assays was calculated by the marker testing of existing varieties and genetic resources.

2.2. Extraction of Genomic DNA

Genomic DNA was extracted from young rice leaves as described by Murray and Thompson [18], using DNA extraction buffer (10% SDS, 0.2 M Tris-HCl, pH 7.5; 0.5 M NaCl; 25 mM EDTA, pH 8.0, Biosesang Inc., Yongin-si, Gyeonggi-do, Republic of Korea) instead of CTAB. Young leaf tissue samples approximately 3–4 cm in size and one 3 mm grinding bead (Masuda, Tokyo, Japan, Cat. 12-410-032) were placed into a 2 mL tube (Eppendorf, Hamburg, Germany, Cat. 0030123344) and submerged in liquid nitrogen for 5–10 min, followed by vortexing for 1 min. Subsequently, 700 μL of DNA extraction buffer was added, and the mixture was incubated at 65 °C in an oven for 30 min. After incubation, 700 μL of the CI solution (chloroform/isoamyl alcohol = 24:1) was added, and the mixture was agitated for 10 min, followed by centrifugation at 13,000 rpm for 15 min. The supernatant (approximately 500 μL) was transferred to a 1.5 mL tube (Eppendorf, Hamburg, Germany, 3810X). Then, 1000 μL of 90% ethanol was added to the supernatant and mixed 2–3 times and maintained at −20 °C overnight. The mixture was then centrifuged at 13,000 rpm for 10 min to remove the supernatant, and the pellet was washed with 70% ethanol and dried. The extracted DNA was dissolved in TE buffer (10 mM Tris-HCl, pH 8.0; 2.5 mM EDTA) for use in PCR analysis.

2.3. Developing the Molecular Markers

To distinguish between the two alleles of the Sdr4 gene, Sdr4-k and Sdr4-n, we developed a dominant InDel marker, named Sdr4-dm, specific to the functional nucleotide polymorphism (FNP) within the Sdr4 locus (Table 1). The Sdr4-n allele contains an 18 bp repeat that results in an amino acid sequence variation from -(K)VIS270–274 to R(K)LLE270–275, causing functional differences between the two alleles (Sugimoto et al., 2010). The Sdr4-dm marker targets this 3 bp FNP within the Sdr4 locus (Table 2).
As a dominant marker, the Sdr4-dm assay generates PCR bands only when the Sdr4-k allele is present, as this marker is designed to amplify sequences specific to Sdr4-k. In the absence of amplification, it can be inferred that the Sdr4-n allele is present (Figure 1a). This inherent characteristic of dominant markers allows for the identification of Sdr4-k homozygous and heterozygous individuals but not Sdr4-n homozygous individuals. However, the inability to distinguish heterozygous individuals from those carrying the Sdr4-k allele using this method highlights the need for an alternative genotyping system.

2.4. Genotype Analysis

InDel and KASP markers were designed and used for genotype analysis. The PCR protocol for the gel-based InDel marker, Sdr4-dm, involved mixing the following: 0.5 μL of primers at a concentration of 10 pmol μL−1, 5 μL of DNA at 50 ng μL−1, 0.8 μL of 0.2 mM dNTPs, 1.5 μL of 10X buffer, 0.1 μL of Taq polymerase, and 6.6 μL of dH2O. The Korean elite cultivar ‘Saeilmi’, carrying the Sdr4-n allele, and the variety ‘NRT383’, carrying the Sdr4-k allele, were used as controls. The KASP marker, Sdr4-IND, was prepared in each well of a PCR plate with 4.86 μL of 2X Master Mix 96/384 Standard ROX (LGC Genomics, London, UK), 0.14 μL of KASP assay mix, and 5 μL of diluted DNA sample to achieve a total DNA concentration of 5 ng μL−1, following the Touchdown PCR method reported by Cheon et al. [3]. The Korean elite cultivar ‘Saeilmi’ and ‘NRT-383’ were also used as negative and positive controls, respectively, in the KASP marker analysis. The PCR cycle for both markers was initiated by maintaining the reaction at 94 °C for 15 min, followed by 10 cycles of 94 °C for 20 s and 61 °C for 1 min, then 26 cycles of 94 °C for 20 s, and 55 °C for 1 min. Finally, the samples were held at 37 °C for 1 min before maintaining them at 4 °C until fluorescence measurement. The fluorescence of the PCR products was measured using real-time PCR (QuantStudio 3, Applied Biosystems, Foster City, CA, USA).

2.5. Statistical Analysis

Statistical analyses were performed to evaluate the correlation between marker genotypes and germination rates. The proportion of germinated seeds was calculated for each sample, and the correlation between germination rate and genotype was analyzed using the “corr” function in R version 4.2.2. Pearson correlation coefficients were computed to determine the strength and direction of the relationship between the Sdr4 marker genotypes and the observed germination rates. Statistical significance was set at a p-value < 0.05. The results were visualized using appropriate plots generated in R. Additionally, the efficiency of KASP and agarose gel-based markers was compared using descriptive statistics to assess their performance in distinguishing genotypes.

3. Results and Discussion

3.1. Results of Agarose Gel-Based InDel Marker Assay Specific to Sdr4 Alleles

The gene Sdr4 harbors two alleles, Sdr4-k and Sdr4-n. The Sdr4-dm marker, which targets the 3 bp FNP within the Sdr4 locus, was able to distinguish between the parental varieties ‘Saeilmi’, carrying the Sdr4-n allele, and ‘NRT383’, carrying the Sdr4-k allele (Figure 1a). Using this marker, the genotype of F2 populations derived from backcrosses using the Japonica elite variety Saeilmi (Sdr4-n allele) as the recurrent parent and the Tongil-type variety NRT383 (Sdr4-k allele) as the donor was examined. As shown in Figure 1c, clear phenotypic differences between the alleles were observed. Additionally, the viviparous germination percentages of the seeds from these crosses were determined. The results showed that individuals possessing the Sdr4-n allele exhibited significantly reduced dormancy compared with those possessing the Sdr4-k allele (Figure 1c).
The Sdr4-dm marker developed in this study successfully distinguished between the two genotypes, confirming that rice varieties carrying the Sdr4-k allele showed significantly enhanced tolerance to viviparous germination compared to those with the Sdr4-n allele. Kim et al. [1] demonstrated that viviparous germination can negatively affect both the quality and yield of rice, further emphasizing the importance of breeding strategies to mitigate its impact. However, this marker has limitations due to its labor-intensive and time-consuming nature, as it requires agarose gel electrophoresis (Table 1 and Table 2, Figure 1). These constraints make the Sdr4-dm marker less suitable for high-throughput applications, thus prompting the need for an alternative genotyping method.

3.2. The Results from the Sdr4 Gene KASP Marker Assay

To overcome the limitations of the Sdr4-dm marker, a more efficient KASP marker, Sdr4-IND, was developed (Table 3). This marker enabled the differentiation of heterozygous individuals within the F2 population through fluorescent signal detection (Figure 2). The analysis of the association between the Sdr4-IND marker genotype and germination rate indicated that the Sdr4-IND marker genotype alone could predict viviparous germination at a significant level. Furthermore, the corresponding Pearson correlation coefficient, 0.74 (p-value = 3.31 × 10−8), demonstrates a significant, strong positive correlation (Table 4).
This strong positive correlation indicates that the Sdr4-IND marker is not only statistically reliable but also biologically relevant in predicting viviparous germination tolerance. The observed correlation suggests that variations in the Sdr4 gene significantly influence the physiological processes underlying seed dormancy and germination. By accurately identifying genotypic differences, the Sdr4-IND marker provides insights into the genetic mechanisms controlling viviparous germination. These findings reinforce the role of Sdr4 in improving rice yield stability and grain quality through enhanced marker-assisted selection (MAS) strategies.
In addition, this study highlights the relevance of these markers in addressing climate-induced challenges. Climate change, characterized by increased rainfall and higher temperatures during the harvest period, exacerbates the risk of pre-harvest sprouting (PHS). By facilitating the identification of genotypes resistant to viviparous germination, the Sdr4-IND marker enables the development of rice varieties tailored to withstand such climatic stressors. This contributes to enhancing resilience in rice cultivation and ensuring food security amidst changing environmental conditions. For example, studies by Zhao et al. (2022) emphasize the impact of climatic variability on viviparous germination, further underscoring the need for advanced marker systems such as Sdr4-IND to address these emerging challenges [19].
Compared to the gel-based Sdr4-dm marker, the Sdr4-IND KASP marker provided a quicker high-throughput method for genotyping. The Sdr4-dm marker, while useful for identifying homozygous alleles, has limitations, such as its inability to distinguish heterozygous individuals and its reliance on labor-intensive gel electrophoresis. In contrast, KASP (Kompetitive Allele-Specific PCR) markers offer several advantages, including higher accuracy, real-time fluorescence detection, and the ability to distinguish between heterozygous and homozygous individuals efficiently. These features make KASP markers particularly suitable for high-throughput applications in marker-assisted selection (MAS) programs.
The Sdr4-IND marker, therefore, not only significantly reduced the time and labor required for screening, but additionally, it allowed for a more efficient identification of genotypic variations related to viviparous germination (Figure 2). Thus, the screening of 683 genetic resources using both the Sdr4-dm and Sdr4-IND markers (Table 5) confirmed their effectiveness in identifying genotypic variations related to viviparous germination. Among the 526 native resources, only 11 Japonica varieties developed in Korea harbored the Sdr4-k allele (Table 5 and Table S1). These results highlight the need for further breeding programs focused on introducing tolerance to viviparous germination in Japonica varieties, particularly in regions impacted by pre-harvest sprouting due to climate change. For instance, studies by Kim et al. (2008) demonstrated that viviparous germination significantly reduces rice yield and grain quality, emphasizing the economic and agricultural importance of developing resistant varieties. The application of markers such as Sdr4-IND offers a practical pathway for improving tolerance in breeding programs, thereby ensuring stable productivity and grain quality in adverse climatic conditions [2].

4. Conclusions

As a constitutive gene in the regulatory scheme of viviparous germination in rice, Sdr4 plays a pivotal role in ensuring that seed germination does not occur under non-optimal conditions. Extensive research, including the pioneering work by Sugimoto et al. [10], has highlighted the importance of this gene in rice adaptation to viviparous germination. Through the use of agarose gel-based InDel and KASP marker assays, in this study, we were able to identify two distinct alleles, Sdr4-k and Sdr4-n, linked to significant variations in viviparous germination. Our research complements previous efforts to understand the genetic basis of viviparous germination and provides practical tools for improving rice yield stability and grain quality—critical agricultural challenges.
Moreover, this study builds upon previous research by Sugimoto et al. [10] and Izawa et al. [11], demonstrating the usefulness of combining both gel-based and KASP marker systems for identifying allelic variations associated with viviparous germination. Kim et al. [2] further highlighted the practical implications of viviparous germination, showing its detrimental effects on rice quality and yield, thus underscoring the importance of breeding strategies aimed at mitigating these impacts. The integrated marker approach offers a robust and efficient strategy for breeding rice varieties with enhanced tolerance to pre-harvest sprouting, a trait that is becoming increasingly important due to climate-induced stress conditions.
Although Sdr4 has been identified as a key regulator of viviparous germination, it is likely that other genes and environmental factors contribute to this trait. Future studies should focus on identifying additional genetic markers and further exploring the interactions between environmental conditions and genetic factors to enhance breeding strategies even more effectively. Furthermore, this research builds upon findings by Nguyen et al. [20], who identified QTLs for seed dormancy in weedy rice and applied them to elite cultivars, demonstrating how genetic insights into seed dormancy can be used to enhance rice yield stability.
By converting the InDel marker to a KASP marker, this study provides a more efficient tool for identifying key allelic variations, directly benefiting marker-assisted selection programs. The KASP marker offers significant advantages over the gel-based markers previously developed for the Sdr4 gene, such as those reported by Zhao et al. (2022). While Zhao et al. (2022) focused on developing dominant InDel and dCAPS markers, our KASP marker was developed using a different polymorphic site within the Sdr4 gene [19]. This distinction ensures the KASP marker’s unique ability to improve accuracy and efficiency in genotyping, particularly for distinguishing heterozygous individuals. Furthermore, this marker was optimized for use with Korean elite rice varieties, making it particularly effective for identifying functional Sdr4 alleles within locally adapted varieties. These advancements will aid in the development of viviparous germination-tolerant varieties specifically adapted to the unique climatic challenges of Korea. The strong correlation between this marker and viviparous germination tolerance enables the rapid and efficient selection of tolerant lines at an early growth stage through marker-assisted screening, significantly accelerating breeding programs.
Given the increasing rainfall during Korea’s rice maturation period due to climate change, developing rice varieties with improved resistance to viviparous germination has become a critical focus. According to recent climate projections, annual precipitation in Korea has significantly increased in recent decades, particularly during the period from August to October, which overlaps with rice maturation stages. This shift in precipitation patterns, as outlined by the Korean Meteorological Administration (KMA) in their 2023 report, is likely to exacerbate the risks of viviparous germination, threatening agricultural productivity and food security. The Sdr4-IND KASP marker developed in this study addresses this challenge by enabling the efficient early-stage selection of viviparous germination-resistant lines. Its integration into breeding programs will provide a practical pathway for creating resilient rice varieties adapted to changing climatic conditions, ensuring long-term agricultural sustainability [21]. Further research should refine these markers and explore additional genetic and environmental factors affecting seed dormancy, making rice breeding more effective in addressing challenges posed by viviparous germination under different climatic conditions.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy14122896/s1, Table S1: Genotype of Sdr4 gene in various resources.

Author Contributions

Conceptualization, J.-H.L.; methodology, Y.K., S.-R.K. and J.-H.L.; software, S.-M.L. and Y.K.; validation, D.-S.P., J.-H.C. and J.-H.L.; formal analysis, S.-M.L. and Y.K.; investigation, S.-M.L., Y.K. and G.-H.E.; resources, J.-W.K., J.-K.C. and H.P.; data curation, S.-M.L., Y.K., S.-R.K. and J.-H.L.; writing—original draft preparation, S.-M.L.; writing—review and editing, S.-M.L. and J.-H.L.; visualization, S.-M.L., Y.K. and J.-H.L.; supervision, W.K. and J.-H.L.; project administration, J.-H.L.; funding acquisition, J.-H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ017389022024) of the Rural Development Administration of the Republic of Korea.

Data Availability Statement

Data are available in the Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lee, J.; Ham, T.-H.; Kwon, S.-W. Fine-Mapping Analysis of the Genes Associated with Pre-Harvest Sprouting Tolerance in Rice (Oryza sativa L.). Agronomy 2023, 13, 818. [Google Scholar] [CrossRef] [Scilit]
  2. Kim, S.J.; Won, J.G.; Ahn, D.J.; Park, S.D.; Choi, C.D. Influence of viviparous germination on quality and yield in rice. Korean J. Crop Sci. 2008, 53, 15–18. [Google Scholar]
  3. Cheon, K.-S.; Baek, J.; Cho, Y.I.; Jeong, Y.-M.; Lee, Y.-Y.; Oh, J.; Won, Y.J.; Kang, D.-Y.; Oh, H.; Kim, S.L.; et al. Single nucleotide polymorphism (SNP) discovery and kompetitive allele-specific PCR (KASP) marker development with Korean japonica rice varieties. Plant Breed. Biotech. 2018, 6, 391–403. [Google Scholar] [CrossRef] [Scilit]
  4. Tang, W.; Lin, J.; Wang, Y.; An, H.; Chen, H.; Pan, G.; Zhang, S.; Guo, B.; Yu, K.; Li, H.; et al. Selection and validation of 48 KASP markers for variety identification and breeding guidance in conventional and hybrid rice (Oryza sativa L.). Rice 2022, 15, 48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Miyoshi, K.; Nakata, E.; Nagato, Y. Characterization of viviparous mutants in rice. Breed. Sci. 2000, 50, 207–213. [Google Scholar] [CrossRef] [Scilit]
  6. Finch-Savage, W.E.; Leubner-Metzger, G. Seed dormancy and the control of germination. New Phytol. 2006, 171, 501–523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Huh, S.M.; Hwang, Y.S.; Shin, Y.S.; Nam, M.H.; Kim, D.Y.; Yoon, I.S. Comparative transcriptome profiling of developing caryopses from two rice cultivars with differential dormancy. J. Plant Physiol. 2013, 170, 1090–1100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Zhang, Z. OsVP1 activates Sdr4 expression to control rice seed dormancy via the ABA signaling pathway. Crop J. 2021, 9, 68–78. [Google Scholar] [CrossRef] [Scilit]
  9. Shilpha, J.; Satish, L.; Ramesh, M. Seed Dormancy and Pre-Harvest Sprouting in Rice—An Updated Overview. Int. J. Mol. Sci. 2021, 22, 11804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Sugimoto, K.; Takeuchi, Y.; Ebana, K.; Miyao, A.; Hirochika, H.; Hara, N.; Ishiyama, K.; Kobayashi, M.; Ban, Y.; Hattori, T.; et al. Molecular cloning of Sdr4, a regulator of seed dormancy, and rice domestication. Proc. Natl. Acad. Sci. USA 2010, 107, 5792–5797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Izawa, T.; Konishi, S.; Shomura, A.; Yano, M. DNA changes tell us about rice domestication. Curr. Opin. Plant Biol. 2009, 12, 185–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Guo, X.; Hou, X.; Fang, J.; Wei, P.; Xu, B.; Chen, M.; Feng, Y.; Chu, C. The rice GERMINATION DEFECTIVE 1, encoding a B3 domain transcriptional repressor, regulates seed germination and seedling development by integrating GA and carbohydrate metabolism. Plant J. 2013, 75, 403–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Zhang, C.; Yuan, Z.; Wang, Y.; Sun, W.; Tang, X.; Sun, Y.; Yu, S. Genetic dissection of seed dormancy in rice using two mapping populations derived from common parents. Rice 2020, 13, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Jayabalan, S.; Satish, L.; Ramesh, M. Genome-wide association mapping revealed a diverse genetic basis of seed dormancy across subpopulations in rice (Oryza sativa L.). BMC Genom. Data 2021, 22, 32. [Google Scholar] [CrossRef] [Scilit]
  15. Kovach, M.J.; Sweeney, M.T.; McCouch, S.R. New insights into the history of rice domestication. Trends Genet. 2007, 23, 578–587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Gu, X.Y.; Kianian, S.F.; Foley, M.E. Dormancy genes from weedy rice respond divergently to seed development environments. Genetics 2006, 172, 1199–1211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Jatayev, S.; Kurishbayev, A.; Zotova, L.; Khasanova, G.; Serikbay, D.; Zhubatkanov, A.; Botayeva, M.; Zhumalin, A.; Turbekova, A.; Soole, K. Advantages of Amplifluor-like SNP markers over KASP in plant genotyping. BMC Plant Biol. 2017, 17 (Suppl. S2), 254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Zhao, H.; Yao, W.; Ouyang, X.; Wang, P.; Zhu, L.; Zhang, Y.; Xue, D. Genetic and molecular characterization of seed dormancy and pre-harvest sprouting in rice (Oryza sativa L.). J. Integr. Plant Biol. 2022, 64, 1342–1358. [Google Scholar] [CrossRef] [Scilit]
  20. Nguyen, T.L.; Zhou, C.L.; Zhang, T.Y.; Yu, J.F.; Miao, R.; Huang, Y.S.; Zhu, X.J.; Song, W.H.; Liu, X.; Mou, C.L.; et al. Identification of QTL for Seed Dormancy from Weedy Rice and Its Application to Elite Rice Cultivar ‘Ninggeng 4’. Mol. Breed. 2019, 39, 123. [Google Scholar] [CrossRef] [Scilit]
  21. Korean Meteorological Administration (KMA). 2023 Regional Climate Change Projection Report: Climate Change Projections Under SSP Scenarios. 2023. Available online: http://www.climate.go.kr/home/CCS/contents_2021/36_fcstReport.php (accessed on 12 November 2024).
Figure 1. The results of the Sdr4-dm marker experiment. (a) An electrophoresis image of the Sdr4-dm InDel marker with a positive control; bands appear only in individuals with the Sdr4-k homozygous allele and heterozygous genotype, as the marker is dominant. (b) Phenotypic differences observed between individuals with the Sdr4-k and Sdr4-n alleles were noted after incubating the seeds at 32 °C and 100% relative humidity for 7 days. (c) An assessment of the relationship between the Sdr4 genotype and viviparous germination rates in the Saeilmi × NRT383 F2 population (circles represent outliers). Double asterisks (**) indicate a significant difference at the 1% significance level in viviparous germination rates between individuals with the Sdr4-k and Sdr4-n alleles.
Figure 1. The results of the Sdr4-dm marker experiment. (a) An electrophoresis image of the Sdr4-dm InDel marker with a positive control; bands appear only in individuals with the Sdr4-k homozygous allele and heterozygous genotype, as the marker is dominant. (b) Phenotypic differences observed between individuals with the Sdr4-k and Sdr4-n alleles were noted after incubating the seeds at 32 °C and 100% relative humidity for 7 days. (c) An assessment of the relationship between the Sdr4 genotype and viviparous germination rates in the Saeilmi × NRT383 F2 population (circles represent outliers). Double asterisks (**) indicate a significant difference at the 1% significance level in viviparous germination rates between individuals with the Sdr4-k and Sdr4-n alleles.
Agronomy 14 02896 g001
Figure 2. A distribution plot of alleles for the Sdr4-IND KASP marker in the Saeilmi × NRT383 F2 population. Blue dots represent individuals with the Sdr4-n homozygous allele, green dots indicate heterozygous individuals, and red dots represent individuals with the Sdr4-k homozygous allele. The two black squares on the bottom left represent the NTC (No-Template Control), which ensures there is no contamination or non-specific amplification during the KASP marker assay.
Figure 2. A distribution plot of alleles for the Sdr4-IND KASP marker in the Saeilmi × NRT383 F2 population. Blue dots represent individuals with the Sdr4-n homozygous allele, green dots indicate heterozygous individuals, and red dots represent individuals with the Sdr4-k homozygous allele. The two black squares on the bottom left represent the NTC (No-Template Control), which ensures there is no contamination or non-specific amplification during the KASP marker assay.
Agronomy 14 02896 g002
Table 1. Gel-based dominant InDel marker targeting 3 bp FNP on Sdr4 gene.
Table 1. Gel-based dominant InDel marker targeting 3 bp FNP on Sdr4 gene.
Assay NamePrimer SequenceGC Content (%)
Sdr4-dmForwardReverseForwardReverse
TGGAGCCGAAGGTCATCTCCTTGTACGCGTCGTTCACC57.957.9
Table 2. A scheme of the InDel marker Sdr4-dm targeting the 3 bp FNP in the Sdr4 locus.
Table 2. A scheme of the InDel marker Sdr4-dm targeting the 3 bp FNP in the Sdr4 locus.
Sequence Not Detected by Sdr4-dm
(Sdr4-n)
Sdr4-dm Forward Sequence
(Sdr4-k)
Sdr4-dm Reverse Sequence
(Common)
TGGAGCCGCGGAAGCTGCTGGATGGAGCCG-–-AAGGTCATCTCGGTGAACGACGCGTACAAG
Table 3. KASP marker information targeting 3 bp FNP on Sdr4 gene.
Table 3. KASP marker information targeting 3 bp FNP on Sdr4 gene.
Assay NameAllele SequencePrimer SequenceGC Content (%)
Sdr4-INDXYX (FAM)Y (HEX)CommonXYCommon
CGGAAGCTGCTGGAAAGGTCATCTCGGAAGCTGCTGGAGCCGCCGGAAGCTGCTGAGCCGAGATGTGGACTGACTCGACGTGGAT72.268.454.2
Table 4. Distribution of viviparous germination rates according to Sdr4-IND KASP marker genotype.
Table 4. Distribution of viviparous germination rates according to Sdr4-IND KASP marker genotype.
MetricGenotype
Sdr4-kSdr4-n
Mean Viviparous Germination Rate (%)5.649.2
Variance50.51607.67
Pearson Correlation Coefficient0.74
p-value3.31−8
Table 5. Genotype distribution of genetic resources on Sdr4 gene in various varieties.
Table 5. Genotype distribution of genetic resources on Sdr4 gene in various varieties.
SourceEcotypeGenotype
Sdr4-nSdr4-k
nativejaponica44511
indica1555
non-nativejaponica110
indica8534
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lee, S.-M.; Kwon, Y.; Kim, S.-R.; Kang, J.-W.; Park, H.; Cha, J.-K.; Park, D.-S.; Cho, J.-H.; Kim, W.; Eom, G.-H.; et al. Development of Functional Molecular Markers for Viviparous Germination Resistance in Rice. Agronomy 2024, 14, 2896. https://doi.org/10.3390/agronomy14122896

AMA Style

Lee S-M, Kwon Y, Kim S-R, Kang J-W, Park H, Cha J-K, Park D-S, Cho J-H, Kim W, Eom G-H, et al. Development of Functional Molecular Markers for Viviparous Germination Resistance in Rice. Agronomy. 2024; 14(12):2896. https://doi.org/10.3390/agronomy14122896

Chicago/Turabian Style

Lee, So-Myeong, Youngho Kwon, Sung-Ryul Kim, Ju-Won Kang, Hyeonjin Park, Jin-Kyung Cha, Dong-Soo Park, Jun-Hyun Cho, Woojae Kim, Gyu-Hyeon Eom, and et al. 2024. "Development of Functional Molecular Markers for Viviparous Germination Resistance in Rice" Agronomy 14, no. 12: 2896. https://doi.org/10.3390/agronomy14122896

APA Style

Lee, S.-M., Kwon, Y., Kim, S.-R., Kang, J.-W., Park, H., Cha, J.-K., Park, D.-S., Cho, J.-H., Kim, W., Eom, G.-H., & Lee, J.-H. (2024). Development of Functional Molecular Markers for Viviparous Germination Resistance in Rice. Agronomy, 14(12), 2896. https://doi.org/10.3390/agronomy14122896

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop