Next Article in Journal
The Relationship Between Cover Crop Species and Soil Fungal Communities in Irrigated Vineyards in the Okanagan Valley, Canada
Next Article in Special Issue
Genome-Wide Identification of Epidermal Pattern Factor (EPF) Gene Family in Potato and Functional Characterization of StEPF4 in Regulating Drought Stress
Previous Article in Journal
Effects of a Diatom–Bacillus megatherium Biocrust on Nutrient Limitation and Ryegrass Growth in Fluvo-Aquic Soil Along the Yellow River
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing

1
State Key Laboratory of Aridland Crop Science, Gansu Agricultural University, Lanzhou 730070, China
2
College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2833; https://doi.org/10.3390/agronomy14122833
Submission received: 27 October 2024 / Revised: 23 November 2024 / Accepted: 24 November 2024 / Published: 28 November 2024
(This article belongs to the Special Issue Resistance-Related Gene Mining and Genetic Improvement in Crops)

Abstract

:
MicroRNAs (miRNAs) are non-coding, single-stranded RNA molecules that regulate gene expression post-transcriptionally. Potato, an essential crop for food and fodder, experiences reduced quality and yield under shading. Although miRNAs have known roles in various plants, their regulatory mechanisms in potato shade avoidance remain unexplored. To investigate this, we constructed nine small RNA libraries from potato samples at 0, 5, and 10 days post-shade treatment. High-throughput sequencing identified 525 miRNAs (307 known and 218 novel) from 99 families, and 166 differentially expressed miRNAs (DEMs) were detected. qRT-PCR verified 10 DEMs, confirming sequencing reliability. Using TargetFinder, we predicted 4320 target genes of DEMs, which were enriched in plant–pathogen interaction and hormone signal transduction pathways, among others. These findings indicate that miRNAs may play key regulatory roles in potato shade avoidance by targeting specific genes, providing valuable insights for future functional studies and potential yield enhancement.

1. Introduction

Plants are sessile organisms that cannot move to select the best survival environment, therefore, throughout the growth and development of the plant, it is often affected by various biotic and abiotic environmental factors. Light, as one of the environmental signals, plays a crucial role in a plant’s lifetime, and it is the most critical condition affecting plant growth and development among many environmental factors (illumination, temperature, gravity, water, minerals, etc.) [1]. Light is not only necessary for plants to synthesize nutrients through photosynthesis but also significantly influences the regulation of plant growth and maturation [2]. Over recent years, it is become clear that augmenting the number of plants per unit of land boosts crop yields [3]. Yet, the shade-avoidance response in plants presents a significant challenge to maximizing planting density in farming operations [4]. In natural environments and agricultural systems, many plants are subject to varying degrees of shade from themselves or from surrounding plants [5]. In contrast, shade-avoiding plants escape the shade environment by elongating stems and petioles. This has been called the shade avoidance response [6,7]. Typical shade avoidance responses are mainly characterized by increased plant height, reduced branching, reduced biomass, reduced number of leaves, increased specific leaf area, reduced chlorophyll a/b ratio, reduced assimilation rate, and reduced yield per plant [8,9,10]. In particular, heavy shade can have a detrimental impact on high-density crop populations, leading to a lack of essential nutrients for storage and reproduction. This can result in a reduction in biological yield, lower seed germination, and incomplete fruit development, ultimately leading to a significant decline in crop yields [11].
Shade avoidance can have significantly negative effects on crops that require fruit harvesting in agricultural practices. Shade treatments have been found to impact the photosynthetic rate and decrease dry matter accumulation during the developmental stages of rice, which can lead to a reduction in grain weight, spikelet number, and final yield [12,13,14]. Similarly, in maize, shade treatments have been shown to decrease chlorophyll content and net photosynthetic rate of leaves, resulting in a lower number of grains in the ear and thousand kernel weight, ultimately leading to a lower yield per plant [15,16]. Previous studies have reported that reduced yields in potato plants are caused by insufficient light, which affects photosynthesis and limits the robustness of seedling growth. This results in varying degrees of reduction in roots, stems, leaves, and total fresh weight of potato histocultured seedlings as light intensity decreases [17]. Investigating miRNA regulatory mechanisms in potato shade avoidance response may reveal strategies to enhance growth, yield, and quality under suboptimal light conditions.
MicroRNAs are a type of small RNA molecules that are 18–24 nucleotides long and can regulate gene expression after transcription [18]. miRNAs commonly bind to specific mRNAs, thereby regulating gene expression by complementing their transcriptional outputs [19]. If miRNAs and target sites are perfectly complementary, the binding of these miRNAs often leads to the degradation of target mRNA, a process commonly observed in plants. Conversely, when miRNAs and target mRNA are not perfectly complementary, the outcome can be the inhibition of target gene expression at the protein translation level, a phenomenon more commonly observed in mammals. miRNAs have been demonstrated to affect the methylation of cytosine-phosphate-guanine (CpG) islands within gene promoters, thereby exerting direct transcriptional regulation of target genes [20]. miRNAs, distinct from protein-coding counterparts, serve as pivotal inhibitors. Their function, essential in plant biology, is to regulate the synthesis of key compounds like terpenoids, flavonoids, and alkaloids despite not translating into proteins themselves. This is achieved by modulating the corresponding target genes [21]. In higher plants, miRNAs have emerged as key players in a broad spectrum of biological functions. These encompass growth and development [22,23,24], the mediation of hormone signals [25,26,27], and adaptation to challenges like drought [28,29,30], salinity [31,32,33], cold [34,35,36], and heat [37,38,39]. So far, restricted miRNAs responding to shade avoidance responses have been identified in several plant species. For instance, in maize [40], miR319 and miR166 down-regulate the expression of TCP TFs under shade conditions. This suggests that their targets are induced, resulting in enhanced shade tolerance. Additionally, miR164 up-regulates under shade conditions, targeting transcripts of NAC-domain proteins. This leads to a reduction in NAC-domain proteins and smaller maize ears, resulting in lower yields. In arabidopsis [4], the enhancement of arabidopsis shade avoidance is observed when MIR156 expression is inhibited. In rice [41], under shade conditions, miR172b-OsbHLH153 reduces pollen quality. Currently, in potatoes, researchers have pinpointed multiple miRNA families that are conserved and linked to genes regulating transcription, signaling processes and hormone signaling pathways. These miRNAs play important roles in plant growth and development. For instance, miRNA families, including miR 172, miR 156, miR 164, miR 166, miR 167, miR 171, miR 390, miR 394, miR 395, miR 399, miR 530, miR 829, miR 395, miR 398, miR 414, and miR 778, seem to play a role in the response of potato to different diseases and environmental stresses [42,43,44,45]. However, few studies have reported on the miRNAs involved in potato plants’ response to shade.
In this study, to identify the miRNAs and comprehend the regulatory mechanism of miRNAs for shade avoidance response in potatoes, 9 small RNA sequences were conducted with potato test-tube plantlets at 0 d, 5 d, and 10 d after shade avoidance treatment. In total, 307 known miRNAs and 218 novel miRNAs were identified. By analyzing the data of the control and the shaded groups, we identified 166 differentially expressed miRNAs. The expression levels of differentially expressed miRNAs were verified by qRT-PCR. We predicted target genes for the miRNAs that showed differential expression and annotated their functions. The findings presented herein provide valuable information for the functional study of microRNA and its target genes in the context of the potato shade avoidance response. The objective of this study is to establish a theoretical foundation for elucidating the regulatory function of miRNA in the shade avoidance response. The identified miRNA candidates may be employed in subsequent functional studies and molecular breeding of potatoes, which can facilitate the exploration of genetic improvement and intercropping management strategies for enhanced potato yield.

2. Materials and Methods

2.1. Plant Material and Shade Treatments

In this study, with the potato variety ‘Atlantic’ as the study material, transfer the 28-day test tube seedling and the terminal buds with three leaves on the top were transferred to the test tube for growth. Then, they were cultured in an incubator under light conditions of 25 °C (16 h during the day and 8 h at night). When the plants grew to 20 days old, the plants were randomly divided into experimental groups and control groups. Each treatment group contained three biological replicates. The experimental group was placed in an incubator with a light intensity of 3500 Lux for shade protection, while the control group continued to grow normally in an incubator with a light intensity of 20,000 Lux. Referring to the time nodes of shade treatments in pepper and rice [46,47]. Samples were collected on days 0, 5, and 10, with day 0 representing control samples and days 5 and 10 representing the treatment group samples. The collected samples were rapidly frozen in liquid nitrogen and stored at −80 °C for subsequent experiments.

2.2. Total RNA Extraction, sRNA Library Construction and Sequencing

This study assessed the purity, concentration, and integrity of RNA samples with sophisticated molecular biology instruments, confirming their suitability for sequencing. Briefly, first of all, the 3′ and 5′ SR adaptors were ligated. First, synthesize the initial strand through reverse transcription. Subsequently, perform PCR amplification and select according to size. Utilize a PAGE gel for the targeted electrophoresis of fragments. Gel bands were excised for purification, yielding small RNA libraries. The PCR products underwent purification using the AMPure XP system, followed by an assessment of the library’s quality. The constructed sRNA library preparations were then sequenced on an Illumina NovaSeq6000 platform (https://opentrons.com.cn/, accessed on 23 November 2024), and single-end reads were generated.

2.3. miRNA Sequencing Data Analysis and miRNA Identification

Raw fastq data were initially processed using custom Perl scripts. During this step, clean reads were generated by filtering out those containing adapters, poly-N sequences, or low-quality bases. Additionally, sequences shorter than 18 nt or longer than 30 nt were trimmed and excluded. Metrics such as Q20, Q30, GC content, and sequence duplication levels were also calculated for the clean data. Bowtie (2-2.4.4) [48] software was used to align clean reads with the Silva, GtRNAdb, Rfam, and Repbase databases, filtering out rRNA, tRNA, snRNA, snoRNA, and other non-coding RNAs and repeats. The rest of the unannotated reads were regarded as reads containing miRNAs. Unannotated reads were mapped to the reference genome with Bowtie (2-2.4.4) to obtain their positions on the reference genome. Reads with positions are called mapped reads. The mapped reads were analyzed to identify known miRNAs and predict novel miRNAs by aligning them with the genome and known entries from miRBase. The secondary structures of novel miRNAs were predicted using Randfold (2.0) software.

2.4. Differential Expression Analysis of Known and Novel miRNAs

To compare the differentially expressed miRNAs at three different stages of shade avoidance, the expression of miRNAs in each sample was calculated and normalized by the TPM algorithm [49]. Differential expression analyses were then performed using DESeq2 R (1.46.0) software based on a negative binomial distribution model. In this project, the threshold for defining DE-miRNAs was set as |log2(FC)| ≥ 0.58; p value ≤ 0.05. Fold change (FC) denotes the expression ratio between two comparative samples(groups). The resulting p-value was then adjusted using the Benjamini and Hochberg method to control for the false discovery rate. Finally, miRNAs with |log2(FC)| ≥ 0.58; p-value ≤ 0.05 are differentially expressed.

2.5. RT-qPCR Analysis of Shade-Related miRNAs

To validate the results of high-throughput sequencing, the expression levels of 10 miRNAs identified as responsive to shade treatment were analyzed by qPCR. Firstly, total RNA was isolated from control and shade-treated potato plants using TRIzol (Invitrogen, Carlsbad, CA, USA) following the instructions. Subsequently, the cDNA of miRNAs was synthesized using the PrimeScriptTM RT Reagent Kit (Takara, Dalian, China). Eventually, we carried out the quantitative real-time PCR (qRT-PCR) examinations employing the Super Real PreMix Plus Kit (SYBR Green, Tiangen, Beijing, China), adhering to the specified cycling parameters. under the following cycles: The cycles are as follows: incubated at 94 °C for 2 min, followed by 40 cycles of 94 °C for 10 s, 59 °C for 34 s, and 72 °C for 30 s, with a final step at 72 °C for 3 min. The 18S rRNA (GenBank: X67238.1) gene was then employed as the reference gene for real-time quantitative PCR (RT-qPCR) using the UltraSYBR mixing kit (CWBIO, Taizhou, China). Table 1 lists the miRNA primers and internal control primers employed in the qPCR analysis. To ensure statistical rigour, real-time RT-PCR reactions were performed in at least three biological replicates. The 2−ΔΔCt method was employed to calculate the change in gene expression ratio, and expression data were log2-transformed for analysis [50].

2.6. Prediction of miRNA Targets and Functional Annotation

miRNA target genes were predicted using TargetFinder (v1.2) software [51], where known and newly predicted potato miRNAs were used as query sequences, and the potato database was used as the target gene screening database for target prediction. Gene Ontology (GO) enrichment analysis of the differentially expressed genes (DEGs) was conducted using the ClusterProfiler R (4.14.3) packages, which is based on the Wallenius non-central hypergeometric distribution. GO terms associated with miRNA target genes were categorized based on biological processes, molecular functions, and cellular components. We employed KOBAS (3.0) [52] software to assess the statistical enrichment of differentially expressed genes within KEGG pathways.

2.7. Validation of miRNA Target Genes by 5′-RLM-RACE

The GeneRacer Kit (Invitrogen, Carlsbad, CA, USA) was used for RNA ligase-mediated 5′ RLM-RACE following the manufacturer’s instructions. In summary, the purified RNAs from both CK and shade avoidance treated samples were ligated with an RNA adapter. The resulting ligation products were then reverse transcribed to cDNAs. Nested PCRs were conducted with gene-specific primers. The PCR products, amplified via RACE, were purified through gel electrophoresis and subsequently cloned into the pMD19-T vector. This step prepared them for sequencing in order to pinpoint the exact cleavage points within the target genes. We chose ten distinct sets for this procedure, aiming to reveal potential targets for further study.

3. Results

3.1. Overview of sRNAs High-Throughput Sequencing

To identify miRNAs associated with shade avoidance responses in potatoes, total RNA was extracted from potato plants for small RNA sequencing. Nine potato small RNA libraries were constructed using three independent biological replicates from shade-treated plants at 0 d, 5 d, and 10 d. The high-throughput sequencing process yielded between 10,982,544–13,704,321 unprocessed small RNA reads. (Table 2). Clean reads were subsequently acquired by eliminating adaptor sequences, low-quality sequences, sequences with length < 18 nt or >30 nt, and containing ‘N’ sequences.
The clean reads were further annotated as rRNAs, scRNAs, snRNAs, snoRNAs, and tRNAs by comparing their sequences with the Silva, GtRNAdb, Rfam, and Repbase databases. After removing duplicates, the remaining unannotated reads were aligned with the potato genome. Finally, we obtained information on the Mapped_Reads, which are located at 2,076,638–3,367,345 on the reference genome. The aforementioned reads were employed for the purposes of identifying and predicting microRNAs. The sRNA length distribution revealed a consistent pattern across all libraries. Over 70% of the sRNA sequences were found to be between 21–24 nt in length, which corresponded to the typical size range generated by Dicer. Notably, the majority of sRNAs were 24 nt in length, indicating that potato sRNAs are predominantly of the 24 nt type (Figure 1).

3.2. Identification of Known and Novel miRNAs

The identified miRNAs play a pivotal role in the growth and development of plants, as well as a plethora of biological functions. In order to identify these miRNAs within potatoes, sequence reads were aligned with established mature miRNA sequences from the miRbase (v22) database. The alignment region was extended to include two nucleotides upstream and five downstream while permitting a single mismatch. A total of 307 known miRNAs from 99 miRNA families were detected in nine libraries (Supplementary Material S1). The member of the miRNA family varies greatly. The MIR399 family has the highest number of members, followed by MIR5303 with 20 family members, while 43 miRNA families have only one member, and the remaining 54 families have between 2 to 14 family members. The research on the MIR399 family is currently relatively mature, with reports on its involvement in abiotic stress responses, including light, cold, drought, salt, and heavy metal exposure, as well as its role in growth and development. For instance, miR399a-3p is induced by light stimulation in potato leaves [53,54,55,56]. However, there is a paucity of literature on the MIR5303 family, which is primarily associated with susceptibility and the regulation of anthocyanin synthesis. For instance, miR5303g may be involved in the biosynthesis of anthocyanins, which have been demonstrated to accumulate in response to bright light [57,58].
Furthermore, the length distribution of miRNAs showed that these 307 known miRNAs were distributed in the length range of 19 nt to 24 nt, with 21 nt being the most distributed, accounting for 45.6% (Figure 2A). The remaining mapped reads were further used to predict novel small RNAs. In this study, a total of 218 novel miRNAs were identified in nine libraries using miRDeep2 (0.1.3) software (Supplementary Material S2). The length distribution of the novel miRNAs was between 19–25 nt, among which, 24 nt length of miRNAs accounted for the largest proportion of 54.13% (Figure 2B). To understand the base preference of potato miRNA, we analyzed the distribution of bases for each position of these known and novel miRNAs (Figure 3), and the results showed that in these nine libraries, the first base at the 5′ end has a strong preference for U, which was consistent with the base preference of miRNAs in other plants.

3.3. Differential Expression Analysis of miRNAs

To identify miRNAs involved in the shade avoidance response in potatoes, the CK library was used as a control during differential expression miRNA detection. The screening criteria used was |log2(FC)| ≥ 0.58 and p-value ≤ 0.05. The expressional levels of miRNAs between CK vs. D5, CK vs. D10, and D5 vs. D10 were analyzed using edgeR (4.4.0) software. A total of 166 differentially expressed miRNAs (DEMs) were obtained, including 79 known DEMs and 87 novel DEMs (Supplementary Material S3). A total of 88 DEMs were observed from CK and D5, 118 DEMs from CK and D10, and 47 DEMs from D5 and D10 (Figure 4). In comparison to D5, CK showed an upregulation of 53 miRNAs and a downregulation of 35 miRNAs (Supplementary Material S4). Similarly, CK exhibited an upregulation of 55 miRNAs and a downregulation of 63 miRNAs when compared to D10 (Supplementary Material S5). Additionally, D5 had an upregulation of 14 miRNAs and a downregulation of 33 miRNAs when compared to D10 (Supplementary Material S6, Figure 5A). The Venn diagram analysis of differentially expressed miRNAs (Figure 5B) revealed that 57 miRNAs shared differentially expressed genes in the two comparison groups CK vs. D5 and CK vs. D10, 13 in CK vs. D5 and D5 vs. D10, and 23 in CK vs. D10 and D5 vs. D10. While there were six differentially expressed miRNAs shared among the three comparison groups (CK vs. D5, CK vs. D10, and D5 vs. D10), the differentially expressed miRNAs unique to the three comparison groups were 24, 44, and 17, respectively. Finally, a total of 142 highly differentially expressed miRNAs recognized between CK vs. D10 and D5 vs. D10, including 76 known miRNAs and 66 novel miRNAs. The results suggest that the highly differentially expressed miRNAs play an important regulatory role in the potato shade avoidance response.

3.4. Validation of miRNA Expression by qRT-PCR

To validate the small RNA sequencing results, this study randomly selected 10 differentially expressed miRNAs that were subjected to qRT-PCR analysis. The selected miRNAs included 3 known miRNAs (1 up-regulated and 2 down-regulated) and 7 novel miRNAs (6 up-regulated and 1 down-regulated). The results demonstrated that most of the differentially expressed miRNAs exhibited analogous expression patterns in comparison to the small RNA-sequencing data (Figure 6). In addition, qRT-PCR results also indicated that these 10 differentially expressed miRNAs were associated with the potato shade avoidance response.

3.5. Target Gene Prediction of miRNAs

A single miRNA has the capacity to regulate a multitude of target genes, and conversely, a single target gene may be recognized by multiple miRNAs. The primary function of a miRNA is to perform a variety of roles by binding with different targets. The more target genes recognized by a miRNA, the more extensive the regulatory role may be. Therefore, predicting miRNA target genes aids in uncovering their roles in gene expression, which is valuable for interpreting miRNA function and studying gene regulatory pathways. To investigate the biological functions of miRNAs in the shade avoidance response of potatoes, we performed target gene prediction for 525 miRNAs belonging to 99 miRNA families using TargetFinder (v1.2) software. A total of 6842 targets were found for 504 of the 525 miRNAs (Table 3), while the remaining 21 miRNAs (including 11 novel miRNAs and 10 known miRNAs) did not predict their target genes. Of the 307 known miRNAs, 297 miRNAs correspond to 4796 target genes, and 207 of the 218 novel miRNAs correspond to 2863 target genes. The miRNAs exhibit a large disparity in the number of target genes, with novel-miR-179 having the highest number of 360 target genes among the novel miRNAs, while 15 novel miRNAs have only one target gene. Similarly, stu-miR172e-5p has the highest number of 190 target genes among the known miRNAs, while 21 known miRNAs have only one target gene (Supplementary Material S7). On the other hand, a target gene can also be regulated by several miRNAs, e.g., the MIR167_1 family members stu-miR167a-5p, stu-miR167b-5p, stu-miR167c-5p and stu-miR167d-5p together target the same gene (Soltu.DM.11 G024270.1). 156 of the 166 differentially expressed miRNAs predicted 4320 target genes, and the remaining 10 did not predict any target genes (Supplementary Material S8).

3.6. GO Enrichment and KEGG Pathway Analyses of miRNA Target Genes

To better understand the functions of predicted miRNA target genes in the potato shade avoidance response, GO functional annotation of the target genes of all miRNAs was performed using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 23 November 2024) online website, and a total of 5821 target genes were annotated. The results showed (Figure 7) that all target genes fell into three categories: biological processes, cellular components, and molecular functions. The target genes of differentially expressed miRNAs had 19 GO terms in biological processes, of which the top three were metabolic processes, cellular processes, and single-organism processes; 18 GO terms in cellular components, of which the top three in abundance were membranes, cell and cell part; 13 GO terms in molecular functions, of which they were mainly enriched in three subfunctions: binding, catalytic activity, and transporter activity. GO analyses demonstrated that the target genes of numerous differentially expressed miRNAs were associated with plant shade avoidance responses, particularly those that matched GO terms exhibiting significant enrichment.
Functional-level enrichment analysis of target genes was also performed based on the KEGG database. The analysis revealed that the target genes of the differentially expressed miRNAs were predominantly enriched in 50 pathways across five pathway types: cellular processes, environmental information processing, genetic information processing, metabolism, and organismal systems (Figure 8). of which, the most abundant pathway was metabolism, which contained a total of 29 KEGG pathways. In the comparisons of CK vs. D5, CK vs. D10, and D5 vs. D10, the most enriched pathway was plant–pathogen interaction, containing 194, 196, and 65 target genes, respectively. The combination of D5 vs. D10 was the second most enriched pathway for plant hormone signal transduction after plant–pathogen interaction, containing 37 target genes. This suggests that shade avoidance in potatoes may mainly involve plant–pathogen interactions and plant hormone signal transduction. It has been demonstrated that crops exhibiting shade avoidance syndrome, characterized by thinning and elongation of stems, are more susceptible to pathogen attack, which subsequently reduces their yield. Furthermore, studies have demonstrated that auxin, gibberellin, and brassinosteroids can also induce stem elongation when triggered by shade avoidance [59,60].

3.7. Targets of miRNAs Involved in Shade Avoidance Response

A total of 17 target genes of 9 miRNAs were identified involved in shade avoidance response based on function annotation and a review of the literature (Table 4), among them, 12 targets of 7 miRNAs were validated by RLM-5′RACE analysis (Figure 9), including 4 target genes (Soltu.DM.02G005160.1, Soltu.DM.02G005090.1, Soltu.DM.02G005130.1 and Soltu.DM.01G010800.1) of novel_miR_175, all of which encoded gibberellin 3-beta-dioxygenase 1-like; 2 targets (Soltu.DM.06G000210.1 and Soltu.DM.06G000200.1) of stu-miR482a-3p, encoded receptor-like protein kinase ANXUR1; 2 targets (Soltu.DM.01G022170.1 and Soltu.DM.01G022170.4) of stu-miR6149-5p, encoded receptor-like protein kinase ANXUR1; One target of 4 miRNAs (novel_miR_29, novel_miR_94, novel_miR_76 and novel_miR_125) was encoded phytochrome kinase substrate (Soltu.DM.03G030260.1), indole-3-acetic acid-amido synthetase (Soltu.DM.05G019950.4), bHLH transcription factor (Soltu.DM.01G027830.1), and cryptochrome (Soltu.DM.12G007030.1), respectively.

4. Discussion

It is an inherent characteristic of plants, including crops and weeds, to compete for vital resources, such as sunlight. An understanding of the impact of reduced light from nearby vegetation on plant development is of significance for both basic research and practical agricultural applications, influencing weed management and crop enhancement strategies. miRNAs, a class of non-coding small RNAs (sRNAs), have been demonstrated to play a pivotal role in the adaptive processes of plants. They are involved in a multitude of developmental processes and the plant’s response to a diverse array of abiotic stresses [61]. The involvement of miRNAs in the shade avoidance response has been demonstrated in a number of species. To illustrate, in maize, the expressions of miR528, miR167, and miR164 were markedly elevated following shading, whereas the expressions of miR319 and miR166 targeting TCP TFs were significantly reduced after shading. This suggests that these miRNAs were involved in receiving shade stress signals [40]. In Arabidopsis thaliana, PIF has been demonstrated to directly inhibit the expression of miR159 in response to shade avoidance [4]. In rice, the interaction of 16 miRNAs and 21 target pairs, including miR5493, miR5144, miR5493, miR6245, miR5487, miR168b, miR172b, and miR168b, has been demonstrated to significantly enhance the shade tolerance phenotype and sustainable yield of rice [41]. However, a systematic investigation of this phenomenon in potatoes has yet to be conducted. The discovery of miRNAs and their target genes linked to the shade avoidance response has enhanced our understanding of miRNA regulatory mechanisms. Recently, advances in small-RNA sequencing have proved invaluable in identifying and evaluating miRNA expression patterns across a range of plant species [62,63]. In this study, we employed high-throughput sequencing of miRNAs to identify and characterize the specific miRNAs involved in the potato shade avoidance response and to elucidate their regulatory functions.
The aim of this study was to explore the regulatory mechanism of miRNAs in the shade avoidance response of potatoes using miRNA high-throughput sequencing and a total of 307 known miRNAs and 218 novel miRNAs were identified in nine libraries, and the lengths ranging from 19 to 25 nt. The most common length of sRNAs was 24 nt, followed by 21 nt, which was consistent with the length distribution of miRNAs observed in other plants [64,65]. A total of 166 differentially expressed miRNAs (DEMs) were obtained, including 79 known DEGs and 87 novel DEGs. Significant expression differences were observed in 88 miRNAs between CK and D5, 118 miRNAs between CK and D10, and 47 miRNAs between D5 and D10 among the miRNAs. Subsequent analysis revealed that 142 highly differentially expressed miRNAs were present in the CK vs. D5 and CK vs. D10, including 76 known and 66 novel miRNAs. This indicated that miRNAs may be involved in the regulation of shade avoidance response in potatoes [66].
An increasing number of studies have shown that miRNAs are involved in various biotic and abiotic stresses in plant species. For example, the MIR396 family has been reported to be involved in the regulation of plant growth and development and in response to stresses such as cold, heat, salt, and drought [67,68,69,70]. In this study, the expression level of novel_miR_76, a new member of the MIR396 family, was significantly up-regulated after shading compared to control plants. MIR397 has been reported to be involved in the regulation of salt, low temperature, and heavy metal stress in plants [71,72]. In this study, novel_miR_29, which belongs to the MIR397 family, was up-regulated after shading. In tomatoes [73], MIR159 and MIR482 were shown to be down-regulated by specific blue light treatment. Similarly, in this study, Stu-miR482-3p and novel_miR_175, which belong to the MIR159 family, were also regulated by light. Compared to other miRNA families, there are few studies on the MIR6149 family, and only cadmium stress and pathogenicity have been reported [74,75]. In our study, stu-miR6149-5 may also play a role in the shade avoidance response. Our findings contribute to the enrichment of functional studies of the miRNA family.
Given that plant miRNAs employ the principle of base complementarity to identify target genes and regulate their expression by cleaving or repressing translation [76], it is therefore crucial to identify miRNA target genes in order to elucidate the regulatory roles of miRNAs. At present, the RLM-5′ RACE analysis is an essential method to validate miRNA-target interactions in plants. In this study, a total of 12 target genes of 7 differentially expressed miRNAs were identified as involved in shade avoidance response based on function annotation and RLM-5′RACE assay. Our results showed that novel_miR_29 targeted phytochrome kinase substrate (Soltu.DM.03G030260.1), which was consistent with the previous study. It has been reported that the S-acylated motif C on a highly conserved cysteine residue mediates the binding of the phytochrome kinase substrate (PKS) protein to the plasma membrane (PM), the primary site of photostimulating hormone action, thereby participating in the photoregulatory changes in growth direction [77]. Novel_miR_94 has been demonstrated to target indole-3-acetate-amino synthetase. It has been demonstrated that GH3.5, which is a specific target of PIF4, plays a role in regulating the circadian rhythm and, consequently, plant growth. PIF4, meanwhile, acts as a regulator of auxin signal transduction and is related to the rhythmic elongation of hypocotyl. Other studies demonstrated that the hypocotyl of transgenic Arabidopsis thaliana seedlings overexpressing GH3.5 exhibited reduced length in red light, yet exhibited no significant difference from the wild type in the absence of light. This suggests that indole-3-amido synthetase may play a role in light-regulated hypocotyl growth [78,79]. Two targets (Soltu.DM.06G000210.1 and Soltu.DM.06G000200.1) of stu-miR482a-3p are preceptor-like protein kinases, which has been demonstrated to influence flowering time under diverse light conditions in Arabidopsis [80]; The target of novel_miR_76 was bHLH transcription factor (Soltu.DM.01G027830.1), previous studies have demonstrated that the bHLH family transcription factors plays a crucial role in shade-induced elongation [81]. The stu-miR6149-5p targeted two cullin-1 proteins (Soltu.DM.01G022170.1 and Soltu.DM.01G022170.4), which play significant roles involved in photomorphogenesis by interacting with CUL1-based E3 ubiquitin linker enzyme [82]. Novel_miR_175 was found to target four gibberellin 3-beta-dioxygenase genes in our research, and it has been previously documented that photosensitive pigments exert an inhibitory effect on the expression of GA3ox1 under low light conditions [83]. This implies that Novel_miR_175 may be involved in regulating light avoidance responses and may be relevant to crop improvement work focused on growth regulation under low light conditions. Novel_miR_125 targeted cryptochrome, and it has been demonstrated to be a photoreceptor that can regulate photomorphogenesis as well as the shade-avoidance response by mediating blue light [84,85]. Collectively, these data suggested that the miRNAs and the targets were probably involved in the regulation of the shade avoidance response of potatoes. To our knowledge, this is the first analysis of miRNAs in response to shade avoidance in potatoes, which may be useful in using miRNAs to design transgenic potatoes for shade tolerance or to optimize potato growth in light-competitive intercropping systems.

5. Conclusions

In this study, we present for the first time enabling genome-wide discovery of cmiRNAs, and their targets possibly involved in the regulation of the shade avoidance response in potatoes. This was achieved through the use of small RNA-seq analysis. A total of 307 known and 218 novel miRNAs were identified in the nine small RNA libraries. A total of 166 differentially expressed miRNAs were identified both in the CK vs. D10, D5 vs. D10, and D5 vs. D10 small RNA libraries, and expression levels of 10 differentially expressed miRNAs were validated by qRT-PCR. A total of 4320 transcripts were identified as target genes of 166 differentially expressed miRNAs. Based on the functional annotation and literature review of target genes, a total of 17 target genes of 9 differentially expressed miRNAs were identified as potential regulators of the potato shade avoidance response. Among them, 12 targets of 7 miRNAs were validated by RLM-5′RACE analysis. There are novel_miR_29, novel_miR_94, stu-miR482a-3p, novel_miR_76, stu-miR482a-3p, novel_miR_125, and novel_miR_175, and the target genes phytochrome kinase substrate, indole-3-acetic acid-amido synthetase, receptor-like protein kinase, bHLH transcription factor, cullin-1, gibberellin 3-beta-dioxygenase, and cryptochrome. This suggested that miRNAs and their target genes play pivotal roles in potato shade avoidance response. The findings presented herein provide new insights into the shade avoidance response of potatoes and establish a robust theoretical foundation for the utilization of miRNA molecular breeding as a strategy for enhancing the survival and yield of potato crops in dense cropping systems within agricultural fields. However, the expression levels of miRNAs in potatoes under different environments and at different developmental stages are still unclear, and the potential for functional validation of these miRNAs and examining their roles in other Solanaceae crops need to be further investigated.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14122833/s1, S1. Number of known miRNAs in each miRNA family. S2. Number of potato novel miRNAs. S3. Statistics of differentially expressed miRNAs in potato. S4. The detailed information of DEG miRNAs between CK and D5. S5. The detailed information of DEG miRNAs between CK and D10. S6. The detailed information of DEG miRNAs between D5 and D10. S7. Target gene prediction of miRNAs. S8. Prediction of differentially expressed miRNA target genes.

Author Contributions

Conceived and designed the experiments: J.Y. and H.S.; performed the experiments: M.L. and J.Y.; analyzed the data: M.L. and J.Y.; contributed reagents/materials/analysis tools: N.Z., R.Q., X.L. and F.Z.; wrote the paper: M.L. and J.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This Research was supported by the Innovation Fund by Gansu Provincial Key Research and Development Program (24YFNA020), the Innovation Fund by the Education Department of Gansu Province (2023A-061), and Gansu Provincial Key Laboratory of Aridland Crop Science, Gansu Agricultural University (No. GSCS-2017-6).

Data Availability Statement

Data is contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chang, B.W. Cloning and Analysis of Genes Related to Potato Shade-Resistance Response. Master’s Thesis, Anhui Agricultural University, Hefei, China, 2018. [Google Scholar]
  2. Zhou, Y. TCP Transcription Factors Regulate Shade Avoidance via Promoting the Activity of PIFs and the Expression of Auxin Biosynthetic Genes. Ph.D. Thesis, Lanzhou University, Lanzhou, Chian, 2018. [Google Scholar]
  3. Duvick, D.N. What Is Yield? Developing Drought- and Low N-Tolerant Maize. Proceedings of a Symposiu. 1997, pp. 332–335. Available online: https://hygeia-analytics.com/wp-content/uploads/2016/12/RP_Hist_Duvick_whatisyield.pdf (accessed on 28 March 2024).
  4. Xie, Y.R.; Liu, Y.; Wang, H.; Ma, X.J.; Wang, B.B.; Wu, G.X.; Wang, H.Y. Phytochrome-interacting factors directly suppress MIR156 expression to enhance shade-avoidance syndrome in Arabidopsis. Nat. Commun. 2017, 8, 348. [Google Scholar] [CrossRef] [PubMed]
  5. Li, Y. Screening of Proteins in Soybean Shade Avoidance Control and Their Effects on Sugar Metabolism. Master’s Thesis, Sichuan Agricultural University, Yaan, China, 2020. [Google Scholar]
  6. Dudley, S.A.; Schmitt, J. Testing the Adaptive Plasticity Hypothesis: Density-Dependent Selection on Manipulated Stem Length in Impatiens capensis. Am. Nat. 1996, 147, 445–465. [Google Scholar] [CrossRef]
  7. Schmitt, J.; Stinchcombe, J.R.; Heschel, M.S.; Huber, H. The adaptive evolution of plasticity: Phytochrome-mediated shade avoidance responses. Integr. Comp. Biol. 2003, 43, 459–469. [Google Scholar] [CrossRef] [PubMed]
  8. Gong, W.Z.; Jiang, C.D.; Wu, Y.S.; Chen, H.H.; Liu, W.Y.; Yang, W.Y. Tolerance vs. avoidance: Two strategies of soybean (Glycine max) seedlings in response to shade in intercropping. Photosynthetica 2015, 53, 259–268. [Google Scholar] [CrossRef]
  9. Green-Tracewicz, E.; Page, E.R.; Swanton, C.J. Shade Avoidance in Soybean Reduces Branching and Increases Plant-to-Plant Variability in Biomass and Yield per Plant. Weed Sci. 2011, 59, 43–49. [Google Scholar] [CrossRef]
  10. Green-Tracewicz, E.; Page, E.R.; Swanton, C.J. Light Quality and the Critical Period for Weed Control in Soybean. Weed Sci. 2012, 60, 86–91. [Google Scholar] [CrossRef]
  11. Chen, J.; Li, S.P.; Zhang, D.L. Research progress of molecular physiology on shade avoidance responses in plants. J. Trimetics Crops 2016, 36, 1355–1361. [Google Scholar]
  12. Chaturvedi, G.S.; Ingram, K.T. Growth and yield of lowland rice in response to shade and drainage. Philipp. J. Crop Sci. 1989, 14, 61–67. [Google Scholar]
  13. Yao, Y.; Yamamoto, Y.; Yoshida, T.; Nitta, Y.; Miyazaki, A. Response of differentiated and degenerated spikelets to top-dressing, shading and day/night temperature treatments in rice cultivars with large panicles. Soil Sci. Plant Nutr. 2000, 46, 631–641. [Google Scholar] [CrossRef]
  14. Greenwald, R.; Bergin, M.H.; Xu, J.; Cohan, D.; Hoogenboom, G.; Chameides, W.L. The influence of aerosols on crop production: A study using the CERES crop model. Agric. Syst. 2006, 89, 390–413. [Google Scholar] [CrossRef]
  15. Ren, B.; Liu, W.; Zhang, J.; Dong, S.T.; Liu, P.; Zhao, B. Effects of plant density on the photosynthetic and chloroplast characteristics of maize under high-yielding conditions. Sci. Nat. 2017, 104, 12. [Google Scholar] [CrossRef] [PubMed]
  16. Xu, Y.T.; Liu, C.; Li, L. Characteristics of shade avoidance response of tomato seedlings and preliminary study on the effect of bottom filling light during cultivation. Fudan J. 2021, 60, 740–751. [Google Scholar]
  17. Guo, J.Z.; Peng, L.; Jin, L.; Qu, Z.C.; Li, S.W.; Lu, W.H.; Shi, Y.; Tang, X.H. Effects of light intensity on growth and fluorescence parameters of potato plantlets in vitro. Chin. Potato 2021, 35, 300–307. [Google Scholar]
  18. Olena, A.F.; Patton, J.G. Genomic organization of microRNAs. J. Cell Physiol. 2010, 222, 540–545. [Google Scholar] [CrossRef]
  19. Marc, R.F.; Filipowicz, W.; Sonenberg, N. Regulation of mRNA translation and stability by microRNAs. Annu. Rev. Biochem. 2010, 79, 351–379. [Google Scholar] [CrossRef]
  20. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
  21. Qin, J.P.; Tang, Z.H.; Ma, X.X.; Meng, Y.J. Investigating the regulatory roles of the microRNAs and the Argonaute 1-en riched small RNAs in plant metabolism. Gene 2017, 628, 180–189. [Google Scholar] [CrossRef]
  22. Sun, C.; Zhao, Q.; Liu, D.D.; You, C.X.; Hao, Y.J. Ectopic expression of the apple Md-miRNA156h gene regulates flower and fruit development in Arabidopsis. Plant Cell Tiss. Organ. Cult. 2013, 112, 343–351. [Google Scholar] [CrossRef]
  23. Tang, F.; Wei, H.R.; Zhao, S.T.; Wang, L.J.; Zheng, H.Q.; Lu, M.Z. Identification of microRNAs involved in regeneration of the secondary vascular system in Populus tomentosa Carr. Front. Plant Sci. 2016, 7, 724–741. [Google Scholar] [CrossRef]
  24. Lopez-Ortiz, C.; Peña-Garcia, Y.; Bhandari, M.; Abburi, V.L.; Natarajan, P.; Stommel, J.; Nimmakayala, P.; Reddy, U.K. Identification of miRNAs and Their Targets Involved in Flower and Fruit Development across Domesticated and Wild Capsicum Species. Int. J. Mol. Sci. 2021, 22, 4866. [Google Scholar] [CrossRef]
  25. Liu, Q.; Zhang, Y.C.; Wang, C.Y.; Luo, Y.C.; Huang, Q.J.; Chen, S.Y.; Zhou, H.; Qu, L.H.; Chen, Y.Q. Expression analysis of phytohormone-regulated microRNAs in rice, implying their regulation roles in plant hormone signaling. FEBS Lett. 2009, 583, 723–728. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, Z.H.; Bao, M.L.; Sun, Y.Z.; Yang, Y.J.; Xu, X.H.; Wang, J.H.; Han, N.; Bian, H.W.; Zhu, M.Y. Regulation of auxin response by miR393-targeted transport inhibitor response protein 1 is involved in normal development in Arabidopsis. Plant Mol. Biol. 2011, 77, 619–629. [Google Scholar] [CrossRef] [PubMed]
  27. Zhao, Z.; Xue, Y.D.; Yang, H.L.; Li, H.M.; Sun, G.Y.; Zhao, X.F.; Ding, D.; Tang, J.H. Genome-wide identification of miRNAs and their targets involved in the developing internodes under maize ears by responding to hormone signaling. PLoS ONE 2016, 11, e0164026. [Google Scholar] [CrossRef] [PubMed]
  28. Yuan, J.; Wang, X.; Qu, S.T.; Shen, T.; Li, M.J.; Zhu, L.C. The roles of miR156 in abiotic and biotic stresses in plants. Plant Physiol. Biochem. 2023, 204, 108150. [Google Scholar] [CrossRef] [PubMed]
  29. Kumar, D.; Ramkumar, M.K.; Dutta, B.; Kumar, A.; Pandey, R.; Jain, P.K.; Gaikwad, K.; Mishra, D.C.; Chaturvedi, K.K.; Rai, A.; et al. Integration of miRNA dynamics and drought tolerant QTLs in rice reveals the role of miR2919 in drought stress response. BMC Genom. 2023, 24, 526. [Google Scholar] [CrossRef]
  30. Yu, Y.H.; Ni, Z.Y.; Wang, Y.; Wan, H.N.; Hu, Z.; Jiang, Q.Y.; Sun, X.J.; Zhang, H. Overexpression of soybean miR169c confers increased drought stress sensitivity in transgenic Arabidopsis thaliana. Plant Sci. 2019, 285, 68–78. [Google Scholar] [CrossRef]
  31. Nguyen, D.Q.; Brown, C.W.; Pegler, J.L.; Eamens, A.L.; Grof, C.P.L. Molecular Manipulation of MicroRNA397 Abundance Influences the Development and Salt Stress Response of Arabidopsis thaliana. Int. J. Mol. Sci. 2020, 21, 7879. [Google Scholar] [CrossRef]
  32. Wan, J.; Meng, S.J.; Wang, Q.Y.; Zhao, J.W.; Qiu, X.Q.; Wang, L.F.; Li, J.; Lin, Y.; Mu, L.Q.; Dang, K.T.; et al. Suppression of microRNA168 enhances salt tolerance in rice (Oryza sativa L.). BMC Plant Biol. 2022, 22, 563. [Google Scholar] [CrossRef]
  33. Qiao, H.L.; Jiao, B.; Wang, J.; Yang, Y.; Yang, F.; Geng, Z.; Zhao, G.Y.; Liu, Y.W.; Dong, F.S.; Wang, Y.Q.; et al. Comparative Analysis of miRNA Expression Profiles under Salt Stress in Wheat. Genes 2023, 14, 1586. [Google Scholar] [CrossRef]
  34. Zhou, M.Q.; Tang, W. MicroRNA156 amplifies transcription factor-associated cold stress tolerance in plant cells. Mol. Genet. Genom. 2019, 294, 379–393. [Google Scholar] [CrossRef]
  35. Abla, M.; Sun, H.G.; Li, Z.Y.; Wei, C.X.; Gao, F.; Zhou, Y.J.; Feng, J.C. Identification of miRNAs and Their Response to Cold Stress in Astragalus Membranaceus. Biomolecules 2019, 9, 182. [Google Scholar] [CrossRef]
  36. Megha, S.; Basu, U.; Kav, N.N.V. Regulation of low temperature stress in plants by microRNAs. Plant Cell Environ. 2018, 41, 1–15. [Google Scholar] [CrossRef]
  37. Li, J.; Cao, Y.M.; Zhang, J.X.; Zhu, C.J.; Tang, G.L.; Yan, J. The miR165/166-PHABULOSA module promotes thermotolerance by transcriptionally and posttranslationally regulating HSFA1. Plant Cell 2023, 35, 2952–2971. [Google Scholar] [CrossRef]
  38. Ravichandran, S.; Ragupathy, R.; Edwards, T.; Domaratzki, M.; Cloutier, S. MicroRNA-guided regulation of heat stress response in wheat. BMC Genom. 2019, 20, 488. [Google Scholar] [CrossRef]
  39. Paul, S.; Duhan, J.S.; Jaiswal, S.; Angadi, U.B.; Sharma, R.; Raghav, N.; Gupta, O.P.; Sheoran, S.; Sharma, P.; Singh, R.; et al. RNA-Seq Analysis of Developing Grains of Wheat to Intrigue into the Complex Molecular Mechanism of the Heat Stress Response. Front. Plant Sci. 2022, 13, 90439. [Google Scholar] [CrossRef]
  40. Yuan, L.Z.; Tang, J.H.; Liu, J.Y.; Song, H.; Zhang, M.B.; Li, H.P.; Li, Z.H. Differential miRNA expression in maize ear subjected to shading tolerance. Acta Physiol. Plant 2016, 38, 1–12. [Google Scholar] [CrossRef]
  41. Panigrahy, M.; Panigrahi, K.C.S.; Poli, Y.; Ranga, A.; Majeed, N. Integrated Expression Analysis of Small RNA, Degradome and Microarray Reveals Complex Regulatory Action of miRNA during Prolonged Shade in Swarnaprabha Rice. Biology 2022, 11, 798. [Google Scholar] [CrossRef]
  42. Zhang, R.X.; Marshall, D.; Bryan, G.J.; Hornyik, C. Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing. PLoS ONE 2013, 8, e57233. [Google Scholar] [CrossRef]
  43. Lakhotia, N.; Joshi, G.; Bhardwaj, A.R.; Katiyar-Agarwal, S.; Agarwal, M.; Jagannath, A.; Goel, S.; Kumar, A. Identification and characterization of miRNAome in root, stem, leaf and tuber developmental stages of potato (Solanum tuberosum L.) by high-throughput sequencing. BMC Plant Biol. 2014, 14, 6. [Google Scholar] [CrossRef]
  44. Zhang, W.W.; Luo, Y.P.; Gong, X.; Zeng, W.H.; Li, S.G. Computational identification of 48 potato microRNAs and their targets. Comput. Biol. Chem. 2009, 33, 84–93. [Google Scholar] [CrossRef]
  45. Rey-Burusco, M.F.; Daleo, G.R.; Feldman, M.L. Identification of potassium phosphite responsive miRNAs and their targets in potato. PLoS ONE 2019, 14, e0222346. [Google Scholar] [CrossRef] [PubMed]
  46. Jie, J.M. Study on Physiological and Biochemical Changes, and Identification of Tolerance of Pepper Seedlings Under Low Temperature and Poor Light Stress. Ph.D. Thesis, Gansu Agricultural University, Lanzhou, China, 2008. [Google Scholar]
  47. Wang, L. Rice Starch Quality and Grain Yield Formations and Physiological Mechanism of Hybrid Rice to Shading After Heading. Ph.D. Thesis, Sichuan Agricultural University, Yaan, China, 2016. [Google Scholar]
  48. Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed]
  49. Li, B.; Ruotti, V.; Stewart, R.M.; Thomson, J.A.; Dewey, C.N. RNA-Seq gene expression estimation with read mapping uncertainty. Bioinformatics 2010, 26, 493–500. [Google Scholar] [CrossRef] [PubMed]
  50. Schmittgen, T.; Livak, K. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1110. [Google Scholar] [CrossRef]
  51. Allen, E.; Xie, Z.; Gustafson, A.M.; Carrington, J.C. microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 2005, 121, 207–221. [Google Scholar] [CrossRef]
  52. Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
  53. Liu, J.J.; Ren, Y.; Sun, Y.; Yin, Y.G.; Han, B.; Zhang, L.P.; Song, Y.; Zhang, Z.; Xu, Y.Y.; Fan, D.Y.; et al. Identification and Analysis of the MIR399 Gene Family in Grapevine Reveal Their Potential Functions in Abiotic Stress. Int. J. Mol. Sci. 2024, 25, 2979. [Google Scholar] [CrossRef]
  54. Pegler, J.L.; Nguyen, D.Q.; Oultram, J.M.J.; Grof, C.P.L.; Eamens, A.L. Molecular Manipulation of the miR396 and miR399 Expression Modules Alters the Response of Arabidopsis thaliana to Phosphate Stress. Plants 2021, 10, 2570. [Google Scholar] [CrossRef]
  55. Wang, R.; Fang, Y.N.; Wu, X.M.; Qing, M.; Li, C.C.; Xie, K.D.; Deng, X.X.; Guo, W.W. The miR399-CsUBC24 Module Regulates Reproductive Development and Male Fertility in Citrus. Plant Physiol. 2020, 183, 1681–1695. [Google Scholar] [CrossRef]
  56. Qiao, Y.; Zhang, J.J.; Zhang, J.W.; Wang, Z.W.; Ran, A.; Guo, H.X.; Wang, D.; Zhang, J.L. Integrated RNA-seq and sRNA-seq analysis reveals miRNA effects on secondary metabolism in Solanum tuberosum L. Mol. Genet. Genom. 2017, 292, 37–52. [Google Scholar] [CrossRef]
  57. Kapadia, C.; Datta, R.; Mahammad, S.M.; Tomar, R.S.; Kheni, J.K.; Ercisli, S. Genome-Wide Identification, Quantification, and Validation of Differentially Expressed miRNAs in Eggplant (Solanum melongena L.) Based on Their Response to Ralstonia solanacearum Infection. ACS Omega 2023, 8, 2648–2657. [Google Scholar] [CrossRef] [PubMed]
  58. Zhou, Y.; Mumtaz, M.A.; Zhang, Y.H.; Yang, Z.; Hao, Y.Y.; Shu, H.Y.; Zhu, J.; Bao, W.L.; Cheng, S.H.; Zhu, G.P.; et al. Response of anthocyanin biosynthesis to light by strand-specific transcriptome and miRNA analysis in Capsicum annuum. BMC Plant Biol. 2022, 22, 79. [Google Scholar] [CrossRef] [PubMed]
  59. Lyu, X.; Mu, R.; Liu, B. Shade avoidance syndrome in soybean and ideotype toward shade tolerance. Mol. Breed. 2023, 43, 31. [Google Scholar] [CrossRef] [PubMed]
  60. Liu, Y.; Jafari, F.; Wang, H. Integration of light and hormone signaling pathways in the regulation of plant shade avoidance syndrome. aBIOTECH 2021, 2, 131–145. [Google Scholar] [CrossRef] [PubMed]
  61. Tian, Y.H.; Tian, Y.M.; Luo, X.J.; Zhou, T.; Huang, Z.P.; Liu, Y.; Qiu, Y.H.; Hou, B.; Sun, D.; Deng, H.Y.; et al. Identification and characterization of microRNAs related to salt stress in broccoli, using high-throughput sequencing and bioinformatics analysis. BMC Plant Biol. 2014, 14, 226. [Google Scholar] [CrossRef]
  62. Islam, W.; Naveed, H.; Idress, A.; Ishaq, D.U.; Kurfi, B.G.; Zeng, F.J. Plant responses to metals stress: MicroRNAs in focus. Environ. Sci. Pollut. Res. 2022, 29, 69197–69212. [Google Scholar] [CrossRef]
  63. Zhu, Q.H.; Upadhyaya, N.M.; Gubler, F.; Helliwell, C.A. Over-expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). BMC Plant Biol. 2009, 9, 149. [Google Scholar] [CrossRef]
  64. Sun, Y.; Luo, W.; Chang, H.; Li, Z.; Zhou, J.; Li, X.; Zheng, J.; Hao, M. Identification of miRNAs and Their Target Genes Involved in Cucumber Fruit Expansion Using Small RNA and Degradome Sequencing. Biomolecules 2019, 9, 483. [Google Scholar] [CrossRef]
  65. Wu, X.J.; Ma, Y.H.; Wu, J.; Wang, P.J.; Zhang, Z.C.; Xie, R.; Liu, J.; Fan, B.B.; Wei, W.; Nie, L.Z.; et al. Identification of microRNAs and their target genes related to the accumulation of anthocyanin in purple potato tubers (Solanum tuberosum). Plant Direct 2022, 6, e418. [Google Scholar] [CrossRef]
  66. Yang, Y.F.; Qiu, Y.Q.; Ye, W.; Sun, G.; Li, H.S. RNA sequencing-based exploration of the effects of far-red light on microRNAs involved in the shade-avoidance response of D. officinale. PeerJ 2023, 11, e15001. [Google Scholar] [CrossRef]
  67. Wang, L.; Gu, X.L.; Xu, D.Y.; Wang, W.; Wang, H.; Zeng, M.H.; Chang, Z.Y.; Huang, H.; Cui, X.F. miR396-targeted AtGRF transcription factors are required for coordination of cell division and differentiation during leaf development in Arabidopsis. J. Exp. Bot. 2011, 62, 761–773. [Google Scholar] [CrossRef] [PubMed]
  68. Yuan, S.R.; Zhao, J.M.; Li, Z.G.; Hu, Q.; Yuan, N.; Zhou, M.; Xia, X.X.; Noorai, R.; Saski, C.; Li, S.G.; et al. MicroRNA396-mediated alteration in plant development and salinity stress response in creeping bentgrass. Hortic. Res. 2019, 6, 48. [Google Scholar] [CrossRef] [PubMed]
  69. Akdogan, G.; Tufekci, E.D.; Uranbey, S.; Unver, T. miRNA-based drought regulation in wheat. Funct. Integr. Genom. 2016, 16, 221–233. [Google Scholar] [CrossRef] [PubMed]
  70. Ding, B.S.; Yue, Y.; Chen, X.; Long, X.H.; Zhou, Z.S. Identification and expression analysis of miR396 and its target genes in Jerusalem artichoke under temperature stress. Gene 2024, 893, 147908. [Google Scholar] [CrossRef]
  71. Gupta, O.P.; Meena, N.L.; Sharma, I.; Sharma, P. Differential regulation of microRNAs in response to osmotic, salt and cold stresses in wheat. Mol. Biol. Rep. 2014, 41, 4623–4629. [Google Scholar] [CrossRef]
  72. Ali, S.; Huang, S.L.; Zhou, J.J.; Bai, Y.S.; Liu, Y.; Shi, L.Y.; Liu, S.; Hu, Z.L.; Tang, Y.L. miR397-LACs mediated cadmium stress tolerance in Arabidopsis thaliana. Plant Mol. Biol. 2023, 113, 415–430. [Google Scholar] [CrossRef]
  73. Omidvar, V.; Mohorianu, I.; Dalmay, T.; Fellner, M. MicroRNA Regulation of Abiotic Stress Response in 7B-1 Male-Sterile Tomato Mutant. Plant Genome 2015, 8, 0008. [Google Scholar] [CrossRef]
  74. Luo, M.; Sun, X.Y.; Xu, M.; Tian, Z.D. Identification of miRNAs Involving Potato-Phytophthora infestans Interaction. Plants 2023, 12, 461. [Google Scholar] [CrossRef]
  75. Bukhari, S.A.; Shang, S.H.; Zhang, M.; Zheng, W.T.; Zhang, G.P.; Wang, T.Z.; Shamsi, I.H.; Wu, F.B. Genome-wide identification of chromium stress-responsive micro RNAs and their target genes in tobacco (Nicotiana tabacum) roots. Environ. Toxicol. Chem. 2015, 34, 2573–2582. [Google Scholar] [CrossRef]
  76. He, X.C.; Lv, H.S.; Huang, J.F.; Ma, L.Q.; Yang, M.F. Advances on Target Gene Alidation Method of Plant miRNA. Adv. Biotechnol. 2017, 2, 102–105. [Google Scholar]
  77. Lopez Vazquez, A.; Allenbach Petrolati, L.; Legris, M.; Dessimoz, C.; Lampugnani, E.R.; Glover, N.; Fankhauser, C. Protein S-acylation controls the subcellular localization and biological activity of PHYTOCHROME KINASE SUBSTRATE. Plant Cell 2023, 35, 2635–2653. [Google Scholar] [CrossRef] [PubMed]
  78. Park, J.E.; Seo, P.J.; Lee, A.K.; Jung, J.H.; Kim, Y.S.; Park, C.M. An Arabidopsis GH3 gene, encoding an auxin-conjugating enzyme, mediates phytochrome B-regulated light signals in hypocotyl growth. Plant Cell Physiol. 2007, 48, 1236–1241. [Google Scholar] [CrossRef] [PubMed]
  79. Nomoto, Y.; Kubozono, S.; Yamashino, T.; Nakamichi, N.; Mizuno, T. Circadian clock- and PIF4-controlled plant growth: A coincidence mechanism directly integrates a hormone signaling network into the photoperiodic control of plant architectures in Arabidopsis thaliana. Plant Cell Physiol. 2012, 53, 1950–1964. [Google Scholar] [CrossRef]
  80. Ren, X.Y. QTL Mapping for Phenotypic Plasticity in Arabidopsis thaliana Under Light Effects. Master’s Thesis, Beijing Forestry University, Beijing, China, 2021. [Google Scholar]
  81. Buti, S.; Hayes, S.; Pierik, R. The bHLH network underlying plant shade-avoidance. Physiol. Plant 2020, 169, 312–324. [Google Scholar] [CrossRef] [PubMed]
  82. Liu, Q. The Molecular Mechanism of Bluelight-Dependent Phosphorylation and Degradation of Arabidopsis Cryptochrome2. Ph.D. Thesis, Jilin University, Changchun, China, 2016. [Google Scholar]
  83. Pan, J.W.; Zhao, S.Z.; Zhang, Y.; Li, C.S.; Wang, Y.H.; Wang, X.J. Regulation of Phytochrome Interacting Factors (PIFs) on Plant Growth and Development. Shandong Agric. Sci. 2014, 6, 150–156. [Google Scholar]
  84. Keller, M.M.; Jaillais, Y.; Pedmale, U.V.; Moreno, J.E.; Chory, J.; Ballaré, C.L. Cryptochrome 1 and phytochrome B control shade-avoidance responses in Arabidopsis via partially independent hormonal cascades. Plant J. 2011, 67, 195–207. [Google Scholar] [CrossRef]
  85. Mao, Z.L.; Wei, X.W.; Li, L.; Xu, P.; Zhang, J.Y.; Wang, W.X.; Guo, T.T.; Kou, S.; Wang, W.T.; Miao, L.X.; et al. Arabidopsis cryptochrome 1 controls photomorphogenesis through regulation of H2A.Z deposition. Plant Cell 2021, 33, 1961–1979. [Google Scholar] [CrossRef]
Figure 1. Length distribution of sRNAs in CK, D5 and D10 libraries.
Figure 1. Length distribution of sRNAs in CK, D5 and D10 libraries.
Agronomy 14 02833 g001
Figure 2. Length distribution of miRNAs. (A) Length distribution of known miRNAs in potato. (B) Length distribution of novel miRNAs in potato. Different colors represent different lengths.
Figure 2. Length distribution of miRNAs. (A) Length distribution of known miRNAs in potato. (B) Length distribution of novel miRNAs in potato. Different colors represent different lengths.
Agronomy 14 02833 g002
Figure 3. Relative nucleotide bias for each position. (A) The nucleotide distribution of potato known miRNAs. (B) The nucleotide distribution of potato novel miRNAs.
Figure 3. Relative nucleotide bias for each position. (A) The nucleotide distribution of potato known miRNAs. (B) The nucleotide distribution of potato novel miRNAs.
Agronomy 14 02833 g003
Figure 4. Number of potatoes in differentially expressed miRNAs in different libraries.
Figure 4. Number of potatoes in differentially expressed miRNAs in different libraries.
Agronomy 14 02833 g004
Figure 5. Clustering and Venn diagrams were used to represent the differentially expressed miRNAs in potatoes after shade avoidance treatment. (A) Expression analysis and clustering of differentially expressed miRNAs in different libraries. (B) Venn distribution of differentially expressed miRNAs in different libraries.
Figure 5. Clustering and Venn diagrams were used to represent the differentially expressed miRNAs in potatoes after shade avoidance treatment. (A) Expression analysis and clustering of differentially expressed miRNAs in different libraries. (B) Venn distribution of differentially expressed miRNAs in different libraries.
Agronomy 14 02833 g005
Figure 6. Validation of the differentially expressed miRNAs between the CK, D5, and D10 libraries by qRT-PCR. “*” indicates statistically significant differences between control (CK) and stress-treated (D5 and D10) plants (p < 0.05). “**” indicate statistically extremely significant differences between control (CK) and stress-treated (D5 and D10) plants (p < 0.01).
Figure 6. Validation of the differentially expressed miRNAs between the CK, D5, and D10 libraries by qRT-PCR. “*” indicates statistically significant differences between control (CK) and stress-treated (D5 and D10) plants (p < 0.05). “**” indicate statistically extremely significant differences between control (CK) and stress-treated (D5 and D10) plants (p < 0.01).
Agronomy 14 02833 g006
Figure 7. GO classification of DE-miRNA targeted genes. (A) CK vs. D5; (B) CK vs. D10; (C) D5 vs. D10.
Figure 7. GO classification of DE-miRNA targeted genes. (A) CK vs. D5; (B) CK vs. D10; (C) D5 vs. D10.
Agronomy 14 02833 g007
Figure 8. Classification of DE-miRNA targeted gene KEGG annotations. (A) CK vs. D5; (B) CK vs. D10; (C) D5 vs. D10.
Figure 8. Classification of DE-miRNA targeted gene KEGG annotations. (A) CK vs. D5; (B) CK vs. D10; (C) D5 vs. D10.
Agronomy 14 02833 g008
Figure 9. RLM-5′RACE verification of target mRNA cleavage sites generated by stu-miR160. Fraction within parentheses represents the proportions of 5′RACE clones showing these cleavage sites (arrows) out of all sequenced clones.
Figure 9. RLM-5′RACE verification of target mRNA cleavage sites generated by stu-miR160. Fraction within parentheses represents the proportions of 5′RACE clones showing these cleavage sites (arrows) out of all sequenced clones.
Agronomy 14 02833 g009
Table 1. Oligonucleotides used for miRNA qRT-PCR.
Table 1. Oligonucleotides used for miRNA qRT-PCR.
miRNAPrimer Sequence (5′–3′)
St18s RNATTAGAGGAAGGAGAAGTCGTAACAA
novel_miR_29TCAACGCTACACTCAATCATG
novel_miR_94GGCTGTTTTCCTGTTACTACTAGC
stu-miR408b-3pGCACTGCCTCTTCCCTGG
stu-miR482a-3pTTCCAATTCCACCCATTCC
novel_miR_76GTTCAATAAGGCTGTGGGAAG
novel_miR_61GCGCTGACTGATTTTACTTGATC
stu-miR6149-5pTTGCAACACACCTGAATCGTC
novel_miR_175TTTGGATTGAAGGGAGCTCTA
novel_miR_31GCTTGGTTGAGTGAGCATCTAAG
novel_miR_125GCTTGGTTGAGTGAGCATCTAAG
Table 2. Data summary of 9 sRNA sequencing from Solanum tuberosum.
Table 2. Data summary of 9 sRNA sequencing from Solanum tuberosum.
CK-1CK-3D5–1D5–2D5–3D10–1D10–2D10–3
Raw reads12,416,90212,350,54810,982,54413,840,46811,989,18912,177,27012,015,23813,272,065
length filter2,478,8532,472,7521,234,2162,133,5802,113,0102,380,0322,225,2852,795,600
Low quality5877646165697274
Containing‘N’reads11002533
Clean reads9,937,9909,877,7189,748,26411,706,8279,876,1129,797,1649,789,87810,476,388
rRNA4,551,6045,465,3995,720,2705,289,9814,307,3913,918,6174,352,7004,181,643
scRNA00000000
snRNA00001000
snoRNA10,2438830797382576180647482385915
tRNA207,482243,521142,955207,469168,697155,323171,960223,737
Repbase78,13662,98870,062118,935109,252111,846114,343113,050
Mapped_Reads2,715,2842,109,4072,076,5383,367,3452,899,4583,077,0512,837,7573,221,056
Q20 (%)99.2799.2399.2899.2999.2799.2899.2599.23
Q30 (%)97.5597.5197.6697.6897.5897.5797.5897.41
GC (%)45.8246.7246.8545.6745.5344.8946.0245.46
Table 3. Statistics of target gene prediction.
Table 3. Statistics of target gene prediction.
TypesAll miRNAmiRNA with TargetTarget Gene
Known miRNA3072974796
Novel miRNA2182072863
Total5255046842
Table 4. Identification of miRNAs involved in potato shade avoidance response.
Table 4. Identification of miRNAs involved in potato shade avoidance response.
miRNAmiRNA SequencesTarget GeneTranscript AnnotationGO Term
novel_miR_29TCAACGCTACACTCAATCATGgene.Soltu.DM.03G030260.1protein PHYTOCHROME KINASE SUBSTRATE 3-likeGO:0009638 (phototropism); GO:0016301 (kinase activity);
novel_miR_94TGTTTTCCTGTTACTACTAGCgene.Soltu.DM.05G019950.4probable indole-3-acetic acid-amido synthetase GH3.5GO:0009416 (response to light stimulus); GO:0009628 (response to abiotic stimulus);
stu-miR482a-3pTTTCCAATTCCACCCATTCCTAgene.Soltu.DM.05G009460.1receptor-like protein kinase HERK 1GO:0004674 (protein serine/threonine kinase activity); GO:0005524 (ATP binding);
gene.Soltu.DM.09G029050.1receptor like protein kinase S.2GO:0004672 (protein kinase activity); GO:0005524 (ATP binding);
gene.Soltu.DM.06G000210.1receptor-like protein kinase ANXUR1GO:0004672 (protein kinase activity); GO:0005524 (ATP binding);
gene.Soltu.DM.06G000200.1receptor-like protein kinase ANXUR1GO:0004672 (protein kinase activity); GO:0005524 (ATP binding);
novel_miR_76GTTCAATAAGGCTGTGGGAAGgene.Soltu.DM.01G027830.1transcription factor bHLH130-likeGO:0046983 (protein dimerization activity);
novel_miR_61TGACTGATTTTACTTGATCgene.Soltu.DM.08G018860.1DDB1- and CUL4-associated factor homolog 1GO:0016567 (protein ubiquitination);
stu-miR6149-5pTTGCAACACACCTGAATCGTCgene.Soltu.DM.01G022170.1cullin-1GO:0006511 (ubiquitin-dependent protein catabolic process); GO:0031625 (ubiquitin protein ligase binding);
gene.Soltu.DM.01G022170.4cullin-1GO:0006511 (ubiquitin-dependent protein catabolic process); GO:0031625 (ubiquitin protein ligase binding);
novel_miR_175TTTGGATTGAAGGGAGCTCTAgene.Soltu.DM.02G005160.1gibberellin 3-beta-dioxygenase 1-likeGO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding);
gene.Soltu.DM.02G005090.1gibberellin 3-beta-dioxygenase 1-likeGO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding);
gene.Soltu.DM.02G005130.1gibberellin 3-beta-dioxygenase 1-likeGO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding);
gene.Soltu.DM.01G010800.1gibberellin 3-beta-dioxygenase 1-likeGO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding);
gene.Soltu.DM.03G000170.1G-type lectin S-receptor-like serine/threonine-protein kinase At1g34300GO:0004674 (protein serine/threonine kinase activity);
novel_miR_31TTGGTTGAGTGAGCATCTAAGgene.Soltu.DM.09G027910.1probable indole-3-pyruvate monooxygenase YUCCA3GO:0004499 (N,N-dimethylaniline monooxygenase activity); GO:0050660 (flavin adenine dinucleotide binding);
novel_miR_125TTGGTTGAGTGAGCATCTAAGgene.Soltu.DM.12G007030.1cryptochrome-1-likeGO:0009638phototropism (phototropism); GO:0009640 (photomorphogenesis); GO:0009644 (response to high light intensity); GO:0009646 (response to absence of light); GO:0009882 (blue light photoreceptor activity); GO:0010114 (response to red light); GO:0010117 (photoprotection); GO:0010218 (response to far red light); GO:0042752 (regulation of circadian rhythm); GO:1902448 (positive regulation of shade avoidance);
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, M.; Yang, J.; Zhang, N.; Qiao, R.; Li, X.; Zhu, F.; Si, H. Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing. Agronomy 2024, 14, 2833. https://doi.org/10.3390/agronomy14122833

AMA Style

Liu M, Yang J, Zhang N, Qiao R, Li X, Zhu F, Si H. Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing. Agronomy. 2024; 14(12):2833. https://doi.org/10.3390/agronomy14122833

Chicago/Turabian Style

Liu, Mei, Jiangwei Yang, Ning Zhang, Run Qiao, Xinxia Li, Fengjiao Zhu, and Huaijun Si. 2024. "Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing" Agronomy 14, no. 12: 2833. https://doi.org/10.3390/agronomy14122833

APA Style

Liu, M., Yang, J., Zhang, N., Qiao, R., Li, X., Zhu, F., & Si, H. (2024). Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing. Agronomy, 14(12), 2833. https://doi.org/10.3390/agronomy14122833

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop