Next Article in Journal
Cultivation Technology and Plant Density Affecting the Yield and Carotenoid Content of Beauregard Sweet Potato
Previous Article in Journal
Assessing the Impact of No-Tillage Duration on Soil Aggregate Size Distribution, Stability and Aggregate Associated Organic Carbon
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 11
10.3390/agronomy14112487
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Anthracnose on the Structure and Diversity of Endophytic Microbial Communities in Postharvest Avocado Fruits

by
Xi Chen
1,
Zhuoen Jiang
1,
Peng He
1,
Xiuhua Tang
1,
Haiyun Song
1,
Tao Zhang
1,
Zhejun Wei
1,
Tao Dong
2,
Shufang Zheng
1,
Xinghao Tu
3,
Jian Qin
2,
Jingjing Chen
3,* and
Wenlin Wang
1,*
1
Guangxi South Subtropical Agricultural Sciences Research Institute, Guangxi Academy of Agricultural Sciences, Longzhou 532415, China
2
Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture and Rural Affairs, Guangdong Provincial Key Laboratory of Science and Technology Research on Fruit Tree, Institute of Fruit Tree Research, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China
3
Key Laboratory of Tropical Fruit Biology, Ministry of Agriculture & Rural Affairs, South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524091, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(11), 2487; https://doi.org/10.3390/agronomy14112487
Submission received: 26 August 2024 / Revised: 20 October 2024 / Accepted: 21 October 2024 / Published: 24 October 2024
(This article belongs to the Section Horticultural and Floricultural Crops)
Browse Figures
Versions Notes

Abstract

:
This study aimed to provide foundational research for the biological control of postharvest avocado fruits anthracnose and establish a microbial system of postharvest avocado fruits. The high-throughput sequencing of avocado fruits from the anthracnose-infected and healthy groups was performed using Illumina NovaSeq second-generation sequencing technology. The results revealed that, except for Colletotrichum sp. strain 38#, there were differences in the bacterial community structure of avocados before and after infection, as determined through alpha and beta diversity analysis. Additionally, there were significant differences in the endophytic fungal community structure, allowing clear differentiation between the infected and healthy avocados. The endophytic bacterial community was primarily composed of 4 phyla and 10 genera, with the Bacteroidota phylum and Chryseobacterium genus demonstrating sensitivity to anthracnose pathogens, as evidenced by a decrease in their relative abundance after infection. The endophytic fungal community was characterized by 3 phyla and 10 genera. After infection, the relative abundance of 2 phyla (Anthophyta and Basidiomycota) and 7 genera (Eucalyptus, Candida, Kluyveromyces, Talaromyces, Oidiodendron, Nigrospora, and Pestalotiopsis) decreased, whereas the relative abundance of the Colletotrichum genus increased dramatically. The LEfSe (Linear discriminant analysis Effect Size) analysis indicated that significant biomarkers were more prevalent in endophytic bacteria than in endophytic fungi in the avocados. In endophytic bacteria, the key biomarkers included the Firmicutes phylum (Bacilli class), Proteobacteria phylum (Gammaproteobacteria class, Pseudomonadales order, Pseudomonadaceae family, and Pseudomonas genus), Flavobacteriales order, Weeksellaceae family, and Chryseobacterium genus. In endophytic fungi, the important biomarkers were Saccharomycetes class (Saccharomycetales order), Glomerellales order (Glomerellaceae family and Colletotrichum genus), and Botryosphaeriales order (Botryosphaeriaceae family and Lasiodiplodia genus). These results may provide a theoretical basis for the development of future biological agents for avocado anthracnose.

1. Introduction

Avocado (Persea americana Mill) is a fruit rich in fats, fatty acids, dietary fiber, protein, and minerals, and it holds high economic values in international trade [1,2]. It is cultivated in the Hainan, Guangdong, Guangxi, Taiwan, and Yunnan provinces in China and has rapidly developed as a valuable tropical fruit tree in recent years. However, avocados face postharvest storage losses primarily due to the anthracnose diseases caused by various fungi, including Colletotrichum aenigma, C. alienum, C. fructicola, C. gloeosporioides sensu stricto, C. karstii, C. nupharicola, C. siamense, C. theobromicola, C. perseae, and others [3]. Currently, the control of avocado anthracnose relies mainly on the synthetic fungicides, but previous research has reported the inability to control fungal diseases due to the occurrence of fungicide-tolerant strains of pathogens [4,5]. Also, pesticide residue contamination compromises avocado safety [6,7]. Therefore, there is an urgent need to develop the new environmentally friendly biological control methods [8,9]. The first step towards a more sustainable disease management system involves collecting comprehensive information on all aspects of the ecosystem [10]. However, there has been limited research on the interactions between postharvest plant hosts, pathogens, environmental factors, and postharvest plant microbiota [11]. Gaining insight into microbial population dynamics in plant systems offers new opportunities for a more comprehensive approach to disease control [12]. Endophytic bacteria and endophytic fungi with antagonistic effects present a promising option for controlling postharvest avocado anthracnose, as they have shown potential in similar applications to some plants [13,14].
Endophytes are defined as organisms that inhabit plant organs and can colonize internal plant tissues at some point in their life without causing apparent harm to their host [15]. Plants are rich in endophytic flora that can promote growth and enhance resilience [16,17,18]. Endophytes also control plant diseases by competing with pathogenic bacteria for ecological niches and secreting antimicrobial substances [19,20]. Moreover, the fruit surface is colonized by complex and often resilient microbial communities [21]. Leveraging the endophytic flora of plants can help control diseases and avoid pesticide residues. However, there have been few studies on postharvest endophytes in avocados, both domestically and internationally. Some studies have focused on the fungal development level in freshly harvested avocado fruits and the changes in endophytic flora in the roots and branches of avocado trees [10,22,23,24]. However, the literature on the differential structure of endophytic flora before and after anthracnose infection in avocados is lacking, although similar studies have been conducted on cherry fruits, navel orange fruits, fresh-cut dragon fruits, and mulberry fruits [25,26,27]. These studies have revealed differences in endophytic structures between susceptible and healthy plants. The diversity of endophytic fungi was significantly lower in susceptible fruits, indicating that the structure and diversity of endophytic plant colonies are related to pathogen invasion [28]. Identifying the changes in the structural diversity of endophytes in avocado fruits before and after anthracnose infection may lead to new breakthroughs in the biological control of avocado diseases.
In this study, high-throughput sequencing of postharvest avocado fruits from anthracnose-infected and healthy groups was conducted using Illumina NovaSeq second-generation sequencing technology. This study focused on the changes in the structure and diversity of fruit endophyte colonies before and after infection. The interactions between endophytes and anthracnose pathogens were analyzed, and the findings could provide a theoretical basis for the biological control of anthracnose.

2. Materials and Methods

2.1. Materials and Treatments

The avocado fruits (cv. ‘Hass’) that reached the physiological maturity stage (dry matter content, 25.6%) were adopted as the experimental materials. Fruits with consistent size and without defects were selected. They were randomly divided into healthy (CK) and infected groups. Three infected groups comprised the avocados inoculated with three Colletotrichum sp. strains (31#, 38#, and 64#). The method of prick inoculation was adopted [29]. Two stab wounds were evenly stabbed on each fruit surface. The solid medium with Colletotrichum sp. strain (Φ = 5 mm) was inoculated on the stab wounds and placed in the fresh-keeping box together with wet absorbent cotton to achieve the purpose of moisturizing. All the samples (4 fruits in each group, 4 groups, 16 fruits in total) were incubated at 28 °C for 7 d, after which the avocado rind and the pulp from both the healthy and infected groups were collected and stored in a −80 °C refrigerator for further experiments. The details of inoculation are shown in Figure 1 and Figure 2. The Colletotrichum sp. strains used were extracted from avocados with anthracnose disease, which were previously identified in our laboratory.

2.2. Methods

2.2.1. DNA Extraction and Polymerase Chain Reaction (PCR) Amplification

The above groups of samples were fully mixed and ground by liquid nitrogen, and 80 mg of powder was weighed for use. Genomic DNA was extracted from the samples using a BioFastSpin Plant Genomic DNA Extraction Kit (BSC18S1, Bioer Technology, Hangzhou, China) according to the manufacturer’s instructions. The purity and concentration of DNA were assessed using agarose gel electrophoresis (Power source: Dyy-BC, Electrophoresis bath: DYCP-31DN, Beijing Liuyi Biotechnology Co., Ltd., Beijing, China). Briefly, the V5-V7 16S rRNA region was amplified using primers 799F (AACMGGATTAGATACCCKG) and 1193R (ACGTCATCCCCACCTTCC). The ITS2 region was amplified by using a conventional primer pair of ITS3-2024F (GCATCGATGAAGAACGCAGC) and ITS4-2409R (TCCTCCGCTTATTGATATGC). PCR was performed using Ultra HiFidelity PCR Kit (Tiangen, Beijing, China) on a Bio-Rad T100 thermal cycler (Bio-Rad, Hercules, CA, USA) to ensure amplification efficiency and accuracy. PCR products were analyzed using agarose gel electrophoresis (2% mass fraction) and an Ultramicro spectrophotometer (Nanodrop2000, Thermo Fisher, Waltham, MA, USA). The aliquots of PCR products were thoroughly mixed. Then, the Universal DNA Purification Kit (Tiangen, Beijing, China) was used for purification according to the manufacturer’s instructions.

2.2.2. Library Construction and Sequencing

The library construction was performed using the TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. The libraries were quantified using Qubit (Qubit 3.0 Fluorometer, Thermo Fisher, Waltham, MA, USA). Once the libraries were confirmed to be of adequate quality, they were subjected to online sequencing using an Illumina NovaSeq 6000 sequencing machine (Illumina, San Diego, CA, USA).

2.2.3. Processing of Sequencing Data

Based on the barcode sequences and PCR amplification primer sequences, the data for each sample were separated from the downstream data. The sample reads were spliced using FLASH software (V1.2.11, Johns Hopkins University, Baltimore, MD, USA) [30] after truncating the barcode and primer sequences. The Raw Tags were then subjected to the quality control using fastp software (V0.23.4, HaploX Biotechnology, Shenzhen, China) [31], resulting in the high-quality Clean Tags. Finally, the Clean Tags were compared to the database using vsearch software (V2.22.1, Department of Informatics, University of Oslo, Oslo, Norway) [32], and the chimeras were detected and removed, yielding the effective tags.

2.2.4. ASVs Noise Reduction and SPECIES Annotation

The following experiments were carried out according to Bolyen’s method [33] and Schloss’s method [34]. In short, the DADA2 module (v1.26.0) of QIIME 2 software (v2023.2, Northern Arizona University, Flagstaf, AZ, USA) was used for denoising, and sequences with an abundance of less than 5 were be filtered out to obtain the final ASVs (Amplicon Sequence Variants). The ASVs obtained by using Mothur software (v1.48, Department of Microbiology and Immunology, University of Michigan, Ann Arbor, MI, USA) were compared with the SSUrRNA database (SILVA138.1) and the UNITE database (v9.0) to obtain species information for each ASV. The taxonomic information was obtained, and the community composition of each sample was calculated at the levels of phylum, class, order, family, genus, and species. MAFFT software (v7.520, Department of Biophysics, Graduate School of Science, Kyoto University, Kyoto, Japan) [35] was used for sequence alignment, and the systematic relationships of all ASVs represent sequences were received. Finally, the data of each sample were homogenized and analyzed as follows.

2.2.5. Analysis of Alpha Diversity and Beta Diversity

This method was adopted for sample complexity analysis. The indices of chao1, Shannon, Simpson, ACE, and coverage were calculated using phyloseq (v1.40.0) and vegan (v2.6-8) of R software (v4.4.0, University of Auckland, Auckland, New Zealand), and rarefaction curve and species accumulation boxplot were plotted. NMDS was analyzed using the phyloseq software package of R software (v4.4.0). LEfSe analysis was conducted using LEfSe software (v1.1.2, Harvard University, Cambridge, MA, USA), and the screening value for LDA Score was set to 4.

3. Results

3.1. Analysis of Sequencing Data

The data obtained from the Illumina NovaSeq sequencing platform underwent splicing, quality control, and chimeric filtering, resulting in the Effective Tags for subsequent analysis. On average, there were 102,678; 118,839; 109,913; and 133,205 Effective Tags of bacteria in the CK, 31#, 38#, and 64# groups, respectively. For fungi, there were 127,807; 96,620; 131,409; and 128,802 Effective Tags in the same groups. The specific data are detailed in Table 1 and Table 2. Figure 3 illustrates that the length of endophytic bacterial sequences was predominantly within the 360 to 380 bp range, whereas the endophytic fungal sequences were mainly within the 300 to 320 bp range. The Effective Tags were clustered at the 100% similarity level. In Figure 4, on average, there were 474, 825, 764, and 745 ASVs for bacteria and 304, 209, 161, and 216 ASVs for fungi in the CK, 31#, 38#, and 64# groups, respectively. And the numbers of ASVs regarding kingdom, phylum, class, order, family, genus, species for bacteria and fungi in every group are shown in Figure 4, too. Significant differences between the CK group (healthy avocados) and the infected groups were observed (p < 0.05). The rarefaction curve, depicted in Figure 5, indicated the adequacy of the sequencing data and species richness, with a flattening curve suggesting reasonable data amounts. The species accumulation boxplot, shown in Figure 6, assessed whether the sample size was sufficient, with a gradually rising plot indicating adequate sampling and readiness for data analysis.

3.2. Diversity Analysis of Endophytes

3.2.1. Analysis of Alpha Diversity

Alpha diversity was applied to analyze the microbial community diversity within the sample, reflecting both the richness and diversity. In Table 3 and Table 4, the chao1 index estimated the total number of species present in a community sample, with higher values indicating more low-abundance species. The ACE index also indicated the species richness, with higher values indicating greater community richness. The Shannon index assessed the species richness and evenness, with higher values representing greater community diversity. The Simpson index characterized the species distribution diversity and evenness, with a higher index indicating better species evenness.
The coverage rates of endophytic sequences exceeded 99.90%, indicating that they accurately represented the true endophytic sequences in avocados. For bacteria, all details are shown in Table 3; the chao1 and ACE indices in the CK group were significantly lower than those in the infected groups, whereas the opposite trend was observed for fungi. The total number and richness of endophytic bacteria were higher than those of endophytic fungi. In Table 4, the Shannon and Simpson indices were significantly higher in the CK groups for fungi than in the infected groups, but no such differences were observed for bacteria. Additionally, the diversity and uniformity of bacteria in the infected groups were higher than those of fungi. This suggests that the diversity and richness of endophytic bacteria in healthy avocados were lower than those in diseased avocados, whereas the endophytic fungi did not exhibit such a pattern. Overall, the diversity of endophytic bacteria in both healthy and diseased avocados was greater than that of endophytic fungi.

3.2.2. Analysis of Beta Diversity

Beta diversity was employed to analyze the microbial community composition of the samples and assess their differences. Non-metric multidimensional scaling (NMDS), a ranking method suitable for ecological research, was employed to address the limitations of linear models such as principal component analysis and principal coordinates analysis, thereby better reflecting the nonlinear structure of ecological data [36], as shown in Figure 7. For the endophytic bacteria (Figure 7a), although each sample exhibited independence, there was a notable difference between the groups infected with pathogenic bacteria 31# and 64# and CK groups, whereas 38# did not present significant differences. This indicates that different pathogens can alter the original colony structure of healthy fruits to varying degrees. For the endophytic fungi (Figure 7b), a clear separation was observed between the CK group and the infected group despite the independence of samples within each group, highlighting the significant differences.

3.3. Composition of Endophyte Community Structure

In this study, four groups of samples were analyzed for their community structure at the phylum and genus levels (Figure 8). For the endophytic bacteria, four major phyla were identified in Figure 8a. Proteobacteria was the dominant phylum across all the samples, with Bacteroidota being relatively dominant in the CK groups. In the infected groups, the relatively dominant phyla varied: Firmicutes in Colletotrichum sp. strain 31# and Bacteroidota in the strains 38# and 64#. Eleven major genera are identified in Figure 8b, revealing the distinct microbial community structures among the groups. In the CK group, Stenotrophomonas and Pseudomonas were the dominant genera, with Chryseobacterium being relatively dominant. In group 31#, Stenotrophomonas and Pseudomonas were dominant, while Paenibacillus was relatively dominant. In group 38#, Pseudomonas was the dominant genus, with Stenotrophomonas was relatively dominant. And in 64# group, Stenotrophomonas was the dominant genus, while Ochrobactrum genera were relatively dominant. These findings indicate that although these were both anthracnose pathogens, the avocado fruits infected by different pathogens exhibited distinct colony structures. In contrast, the diversity of endophytic bacteria in the CK groups was significantly lower than that in the infected groups, as detailed in Table 5 and Table 6. These results are consistent with those observed in Section 3.2.1 and Section 3.2.2. The pathogens significantly affected the phyla Bacteroidota, Firmicutes, and Actinobacteriota, with Bacteroidota showing a decreasing trend, whereas Firmicutes and Actinobacteriota showed an increasing one. At the genus level, the structure varied considerably across all groups. Owing to the influence of pathogenic fungi, the abundance of Chryseobacterium decreased, while that of Bacillus increased, with other genera showing inconsistent changes. This variability may be related to the extent of pathogen invasion or individual differences in sample susceptibility.
Among the endophytic fungi, 3 major phyla and 10 major genera were identified, as shown in Table 7 and Table 8 and Figure 9a,b. Ascomycota was the dominant phylum in all samples, whereas Anthophyta was relatively dominant in the CK groups but not in the infected groups. At the genus level, Eucalyptus and Candida were dominant and relatively dominant, respectively, in the CK groups. In the infected groups, Colletotrichum and Lasiodiplodia were the dominant and relatively dominant genera, respectively. The structure of endophytic fungal colonies was similar within the infected groups, and their diversity was significantly lower than that in the CK groups, consistent with the results of Section 3.2.1 and Section 3.2.2. At the phylum level, the abundance of Ascomycota increased, while the abundance of Anthophyta and Basidiomycota decreased significantly in the infected groups compared to that in the CK group. At the genus level, the variation was pronounced, with the exception of the increased abundance of Colletotrichum and Lasiodiplodia, as other genera largely disappeared from the infected groups.

3.4. Analysis of Differences Between Groups of Endophytes

The LEFSe method was employed to analyze differences in endophytes before and after the avocado infection, allowing for the identification of the biomarkers that were statistically different between groups [37]. In the LEFSe cladogram of endophytes, circles radiating from the center outward represent taxonomic levels from phylum to genus. Each small circle at a different taxonomic level denotes a taxon, with the circle diameter proportional to its relative abundance. Species without the significant differences are uniformly colored in yellow. The differential species biomarkers are highlighted by coloring, with the red nodes indicating the microbial taxa that are significant in the red grouping and the green nodes indicating those significant in the green grouping; the details are shown in Figure 10a,b.
Figure 10a and Figure 11a illustrate the significant endophytic bacterial taxa in each group. The biomarkers in the CK groups were substantially lower than those in the infected groups. Specifically, in the CK groups, one phylum (Bacteroidota) with its branches (one class, Bacteroidia; one order, Flavobacteriales; one family, Weeksellaceae; and one genus, Chryseobacterium) was significantly different, with all showing high abundance. In the 31# groups, two phyla (Firmicutes and Actinobacteriota) and their branches (two classes, three orders, three families, and three genera) as well as one family (Beijerinckiaceae) and its branch (one genus) exhibited significant differences, with Bacilli and Firmicutes showing higher abundance. The 38# groups showed significant differences in two orders (Pseudomonadales and Streptomycetales) and their branches (two families, two genera, and one species), with high abundances in Pseudomonadales, Pseudomonadaceae, and Pseudomonas. In 64# groups, one phylum (Proteobacteria) and its branches (two classes, three orders, two families, and two genera) were significantly different, with high abundances of Proteobacteria and Gammaproteobacteria.
For endophytic fungi, Figure 10b and Figure 11b demonstrate that the biomarkers in the CK groups were significantly higher than those in the infected groups, which was the opposite of the trend observed for endophytic bacteria. In the CK groups, classifications with significant differences included one kingdom and its branch (one phylum, one class, one order, one family, and one genus), one phylum (Basidiomycota), two classes (Saccharomycetes and Eurotiomycetes), and the branches of Saccharomycetes (one order, one family, three genera, and one species). Additionally, two orders (Helotiales and Trichosphaeriales) and their branches (two families and two genera) were identified, with Saccharomycetes and Saccharomycetales demonstrating higher abundances than the others. In the 31# groups, one class (Sordariomycetes) with its branch (one order, one family, and one genus) was significantly different, all showing high abundance. Similarly, in the 64# groups, one class (Dothideomycetes) with its branch (one order, one family, and one genus) was significantly different, with high abundance.

4. Discussion

4.1. Endophyte Diversity in Healthy and Infected Avocados

Few studies have investigated the impact of anthracnose pathogens on endophyte community structure in avocados. However, research on other crops, such as wheat (crown rot) [38], citrus (Huanglong disease) [39], and potato (scab) [40], has demonstrated significant alterations in the endophytic colony structure due to pathogenic bacterial and fungal infection. High-throughput sequencing was used to analyze the structure and diversity of endophytic microbial communities in the healthy and anthracnose-infected postharvest avocado fruits. It was revealed through analyses of the alpha and beta diversity that pathogenic fungal infection significantly affected the avocado endophytes. These results indicated that the diversity and richness of endophytic bacteria in healthy avocado fruits (CK) were lower than those in the infected groups, while the endophytic fungi presented no such difference. These results are consistent with those of Peng et al. [27] on mulberry fruits. Li et al. [41] observed the decreased internal beneficial fungi and reduced diversity in infected plants, with increasing levels of pathogenic fungi. The anthracnose pathogens damaged the normal tissues of avocado fruits, reducing the fruit defenses and allowing more external bacteria to infiltrate. Consequently, the diversity of endophytic bacteria in the infected avocado fruits increased [42].

4.2. Structural Composition and Differences of Endophytic Bacterial Communities in Avocados

The endophytic bacterial community structure of healthy avocados was simpler than that of infected avocados, a pattern that contrasted with the diversity observed in endophytic fungi. Proteobacteria and Bacteroidota predominated in healthy avocados, whereas Firmicutes and Actinobacteriota were introduced in infected avocados. The Bacteroidota phylum exhibited a consistent decline and demonstrated the greatest variability in infected avocados, indicating a higher sensitivity to the anthracnose pathogens than other phyla. This result aligns with the study by Wang et al. [43], who identified these phyla as predominant in avocado fruits, and these phyla are similar to the main bacterial phyla in the human gut [44]. Proteobacteria, one of the largest divisions within prokaryotes, includes 6 classes and over 200 genera [45,46,47]. Firmicutes was noted by Ludwing et al. [48] to comprise more than 240 genera. Additionally, Li et al. [49] reported that chitin application significantly increased the relative abundances of Firmicutes and Actinobacteriota and reduced symptoms caused by root-knot nematodes. At the genus level, significant differences were observed in avocado fruits before and after infection. The healthy group contained only 3 genera, while the infected groups had between 8 and 10 genera. These genera are commonly found in soil, plants, food, and the environment. Some species within Chryseobacterium [50], Paenibacillus [51], Curtobacterium [52], Streptomyces [53], Pseudomonas [54], and Methylobacterium-Methylorubrum [55] were found to be known spoilage bacteria and plant pathogens, whereas the species in Stenotrophomonas [56], Bacillus [57], Paenibacillus [51], and Ochrobactrum [58] were found able to cause diseases in humans. Among the three infected groups, strain 64# exhibited a distinct colony structure compared to strains 31# and 38#, with higher relative abundances of Stenotrophomonas, Sphingobacterium, and Ochrobactrum and lower relative abundances of Chryseobacterium, Curtobacterium, and Pseudomonas. This variation may be due to differences in pathogen strains and infection severity. Further research is likely be required.

4.3. Structural Composition and Differences of Endophytic Fungal Communities in Avocados

The composition of endophytic fungal phyla in avocados was simpler than that of endophytic bacteria. Previous studies have identified Ascomycota and Basidiomycota as the main endophytic fungi in avocados [10] and noted their dominance among fungi in other fruits [59,60]. Specifically, the phylum Ascomycota comprises 805 species across 352 genera, whereas Basidiomycota includes 21 species in 17 genera [61]. Additionally, the Anthophyta phylum was observed in this study, which is consistent with the findings of Wang et al. [43], who reported its presence in blueberry fruit. Notably, the abundance of Anthophyta decreased significantly in both infected avocados and post-storage blueberries. Following the anthracnose pathogen influence, the relative abundance of Anthophyta and Basidiomycota fell below 0.1%. These results suggest that these endophytic phyla could serve as the sensitive indicators for anthracnose. At the genus level, the endophytic fungi were highly abundant in the healthy avocados, with 10 genera exhibiting relative abundances greater than 0.3%. Some of these genera, including Candida, Oidiodendron, Nigrospora, Talaromyces, Colletotrichum, Pestalotiopsis, Lasiodiplodia, and Fusarium [43,62,63,64,65,66], are known spoilage and pathogenic fungi. These genera are common pathogens in various fruits, causing diseases such as stem blight, gray mold, canker lesions, shoot dieback, and anthracnose [67,68,69,70]. An increasing number of records have identified these renowned pathogens within asymptomatic hosts, although explanations for this phenomenon are not immediately available [71,72,73]. The healthy avocados contained a variety of pathogenic fungi without exhibiting disease, likely due to the plant–microbe synergism that helped the plant resist the pathogenic bacteria, supported by a rich endophytic fungal community antagonistic to Anthracnose spp. [74,75,76]. The infection with anthracnose pathogens led to a rapid increase in the relative abundance of the Colletotrichum genus (78.68–86.28%), followed by Lasiodiplodia (11.17–20.12%), with an observed inverse proportionality between the two genera. The endophytic fungal community structure in the infected avocados was drastically reduced, consistent with the findings of Blaustein et al. [77], which suggested that the variations in endophytic flora could directly correlate with the differences in disease severity. The high levels of pathogen infection may destabilize the original endophytic fungal community and increase the relative abundance of Anthracnose genera, leading to dominant anthracnose disease in avocados.
Recently, various actinomycetes, bacteria, and fungi, including Streptomyces spp., Bacillus megaterium, Bacillus subtilis [78], Pseudomonas fluorescence, Pseudomonas putida [79], Penicillium spp. [80], Phoma spp., and Trichoderma spp. [81], have proven effective as biocontrol agents. These fungi that are found in healthy avocados, such as Eucalyptus, Candida, and Kluyveromyces, could be combined into a composite fungal agent with the potential to inhibit anthracnose through synergistic effects. Future research should focus on developing and assessing the efficacy of bacterial and fungal microbial agents for anthracnose inhibition.

5. Conclusions

This study preliminarily explored the structure and diversity of endophytic microbial in both healthy and anthracnose-infected postharvest avocado fruits. The results revealed that there were differences in the endophytic microbial communities of avocado fruits before and after infection. The endophytic bacterial community was primarily composed of 4 phyla and 10 genera, and the endophytic fungal community was characterized by 3 phyla and 10 genera. The key biomarkers included two phyla, two classes, two orders, two families, and two genera in endophytic bacteria. The important biomarkers were one class, three orders, two families, and two genera in endophytic fungi. Further experimental research is required to elucidate the reasons for these differences. These findings provide the foundational data for constructing microbial systems related to postharvest avocado fruits anthracnose and developing composite microbial agents. These studies would have potential positive implications for the biological control of postharvest avocado fruits anthracnose.

Author Contributions

Writing—original draft preparation, X.C.; software, H.S. and Z.W.; writing—review and editing, S.Z. and W.W.; funding acquisition, J.C. and X.T. (Xinghao Tu); methodology, P.H., Z.J., T.Z., T.D. and J.Q.; resources, X.T. (Xiuhua Tang). All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Foundation of Research Project from Key Laboratory of Tropical Fruit Biology, Ministry of Agriculture & Rural Affairs (grant number 2023KFKT-01); Foundation of Fundamental Research Project from Guangxi Academy of Agricultural Sciences (grant number 2021YT159 and 2023YM20); and Foundation of Research Project from Science and Technology Vanguard (grant number 202404-08); Central Public-interest Scientific Institution Basal Research Fund (grant number 1630062022001).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors are grateful for the support of the Guangxi Key Laboratory of Fruits and Vegetables Storage-Processing Technology, Guangxi Academy of Agri-cultural Sciences.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lu, Q.Y.; Zhang, Y.; Wang, Y.; Wang, D.; Lee, R.P.; Gao, K.; Byrns, R.; Heber, D. California hass avocado: Profiling of carotenoids, tocopherol, fatty acid, and fat content during maturation and from different growing areas. J. Agric. Food Chem. 2009, 57, 10408–10413. [Google Scholar] [CrossRef] [PubMed]
  2. Marlett, J.A.; Cheung, T.-F. Database and quick methods of assessing typical dietary fiber intakes using data for 228 commonly consumed foods. J. Am. Diet. Assoc. 1997, 97, 1139–1151. [Google Scholar] [CrossRef] [PubMed]
  3. Sharma, G.; Maymon, M.; Freeman, S. Epidemiology, pathology and identification of Colletotrichum including a novel species associated with avocado (Persea americana) anthracnose in lsrael. Sci. Rep. 2017, 7, 15839. [Google Scholar] [CrossRef] [PubMed]
  4. Ippolito, A.; Nigro, F. Impact of preharvest application of biological control agents on postharvest diseases of fresh fruits and vegetables. Crop Prot. 2000, 19, 715–723. [Google Scholar] [CrossRef]
  5. Dessalegn, Y.; Ayalew, A.; Woldetsadik, K. Integrating plant defense inducing chemical, inorganic salt and hot water treatments for the management of postharvest mango anthracnose. Postharvest Biol. Technol. 2013, 85, 83–88. [Google Scholar] [CrossRef]
  6. EFSA. Conclusion on the peer review of the pesticide risk assessment of the active substance prochloraz. EFSA J. 2011, 9, 2323. [Google Scholar] [CrossRef]
  7. Shimshoni, J.A.; Bommuraj, V.; Chen, Y.; Sperling, R.; Barel, S.; Feygenberg, O.; Maurer, D.; Alkan, N. Postharvest fungicide for avocado fruits: Antifungal efficacy and peel to pulp distribution kinetics. Foods 2020, 9, 124. [Google Scholar] [CrossRef]
  8. Wisniewski, M.; Droby, S.; Norelli, J.; Liu, J.; Schena, L. Alternative management technologies for postharvest disease control: The journey from simplicity to complexity. Postharvest Biol. Technol. 2016, 122, 3–10. [Google Scholar] [CrossRef]
  9. Lamichhane, J.R.; Dürr, C.; Schwanck, A.A.; Robin, M.-H.; Sarthou, J.-P.; Cellier, V.; Messéan, A.; Aubertot, J.-N. Integrated management of damping-off diseases. A review. Agron. Sustain. Dev. 2017, 37, 10. [Google Scholar] [CrossRef]
  10. Bill, M.; Gokul, J.K.; Viljoen, F.; Korsten, L. Fungal microbiome shifts on avocado fruit associated with a combination of postharvest chemical and physical interventions. J. Appl. Microbiol. 2022, 133, 1905–1918. [Google Scholar] [CrossRef]
  11. Peñuelas, J.; Terradas, J. The foliar microbiome. Trends Plant Sci. 2014, 19, 278–280. [Google Scholar] [CrossRef] [PubMed]
  12. Massart, S.; Martinez-Medina, M.; Jijakli, M.H. Biological control in the microbiome era: Challenges and opportunities. Biol. Control 2015, 89, 98–108. [Google Scholar] [CrossRef]
  13. Ibrahim, M.; Kaushik, N.; Sowemimo, A.; Chhipa, H.; Koekemoer, T.; Van De Venter, M.; Odukoya, O.A. Antifungal and antiproliferative activities of endophytic fungi isolated from the leaves of Markhamia tomentosa. Pharm. Biol. 2017, 55, 590–595. [Google Scholar] [CrossRef] [PubMed]
  14. Xu, W.; Wang, F.; Zhang, M.; Ou, T.; Wang, R.; Strobel, G.; Xiang, Z.; Zhou, Z.; Xie, J. Diversity of cultivable endophytic bacteria in mulberry and their potential for antimicrobial and plant growth-promoting activities. Microbiol. Res. 2019, 229, 126328. [Google Scholar] [CrossRef] [PubMed]
  15. Petrini, O. Fungal endophytes of tree leaves. In Microbial Ecology of Leaves; Springer: New York, NY, USA, 1991; pp. 179–197. [Google Scholar] [CrossRef]
  16. Da Silva, S.F.; Olivares, F.L.; Canellas, L.P. The biostimulant manufactured using diazotrophic endophytic bacteria and humates is effective to increase sugarcane yield. Chem. Biol. Technol. Agric. 2017, 4, 24. [Google Scholar] [CrossRef]
  17. Waqas, M.; Khan, A.L.; Kamran, M.; Hamayun, M.; Lee, I.J. Endophytic fungi produce gibberellins and indoleacetic acid and promotes host-plant growth during stress. Molecules 2012, 17, 10754–10773. [Google Scholar] [CrossRef]
  18. Armada, E.; Roldán, A.; Azcon, R. Differential activity of autochthonous bacteria in controlling drought stress in native Lavandula and Salvia plants species under drought conditions in natural arid soil. Microb. Ecol. 2014, 67, 410–420. [Google Scholar] [CrossRef]
  19. Moronta-Barrios, F.; Gionechetti, F.; Pallavicini, A.; Marys, E.; Venturi, V. Bacterial microbiota of rice roots: 16s-based taxonomic profiling of endophytic and rhizospheric diversity, endophytes isolation and simplified endophytic community. Microorganisms 2018, 6, 14. [Google Scholar] [CrossRef]
  20. Zheng, C.J.; Li, L.; Zou, J.P.; Han, T.; Qin, L.P. Identification of a quinazoline alkaloid produced by Penicillium Vinaceum, an endophytic fungus from Crocus Sativus. Pharm. Biol. 2012, 50, 129–133. [Google Scholar] [CrossRef]
  21. Sare, A.R.; Jijakli, M.H.; Massart, S. Microbial ecology to support integrative efficacy improvement of biocontrol agents for postharvest diseases management. Postharvest Biol. Technol. 2021, 179, 111572. [Google Scholar] [CrossRef]
  22. Prusky, D.; Plumbley, R.A.; Kobiler, I. The relationship between antifungal diene levels and fungal inhibition during quiescent infection of unripe avocado fruits by Colletotrichum gloeosporioides. Plant Pathol. 1991, 40, 45–52. [Google Scholar] [CrossRef]
  23. Bejarano-Bolívar, A.A.; Lamelas, A.; Wobeser, E.A.; Sánchez-Rangel, D.; Méndez-Bravo, A.; Eskalen, A.; Reverchon, F. Shifts in the structure of rhizosphere bacterial communities of avocado after fusarium dieback. Rhizosphere 2021, 18, 100333. [Google Scholar] [CrossRef]
  24. Shetty, K.G.; Rivadeneira, D.V.; Jayachandran, K.; Walker, D.M. Isolation and molecular characterization of the fungal endophytic microbiome from conventionally and organically grown avocado trees in south florida. Mycol. Prog. 2016, 15, 977–986. [Google Scholar] [CrossRef]
  25. Zhang, Q.; Shi, W.; Zhou, B.; Du, H.; Xi, L.; Zou, M.; Zou, H.; Xin, L.; Gao, Z.; Chen, Y. Variable characteristics of microbial communities on the surface of sweet cherries under different storage conditions. Postharvest Biol. Technol. 2021, 173, 111408. [Google Scholar] [CrossRef]
  26. Sim, H.L.; Hong, Y.-K.; Yoon, W.B.; Yuk, H.-G. Behavior of Salmonella spp. and natural microbiota on fresh-cut dragon fruits at different storage temperatures. Int. J. Food Microbiol. 2013, 160, 239–244. [Google Scholar] [CrossRef] [PubMed]
  27. Peng, F.F.; Wei, Z.X.; Li, X.L.; Luo, Y.J.; Han, G.H. Analysis of diversity and community structure of endophytes in Sclerotinia sclerotiorum-infected and healthy mulberry fruits by high-throughput sequencing. Food Sci. 2021, 42, 61–68. [Google Scholar] [CrossRef]
  28. Fisher, M.C.; Henk, D.A.; Briggs, C.J.; Brownstein, J.S.; Madoff, L.C.; McCraw, S.L.; Gurr, S.J. Emerging fungal threats to animal, plant and ecosystem health. Nature 2012, 484, 186–194. [Google Scholar] [CrossRef] [PubMed]
  29. Hu, M.J. Study on Latent Infection, Pathogenic Mechanism of Botryodiplodia theobromae and Control for Stem-End Rot of Mango Fruit. Ph.D. Thesis, Hainan University, Haikou, China, 2013. [Google Scholar]
  30. Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef]
  31. Chen, F. Ultrafast one-pass FASTQ data preprocessing, quality control, and deduplication using fastp. iMeta 2023, 2, e107. [Google Scholar] [CrossRef]
  32. Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef]
  33. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
  34. Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [PubMed]
  35. Kazutaka, K.; Misakwa, K.; Kei-ichi, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
  36. Rivas, M.N.; Burton, O.T.; Wise, P.; Zhang, Y.-Q.; Hobson, S.A.; Lloret, M.G.; Chehoud, C.; Kuczynski, J.; DeSantis, T.; Warrington, J. A microbiota signature associated with experimental food allergy promotes allergic sensitization and anaphylaxis. J. Allergy Clin. Immunol. 2013, 131, 201–212, ISBN 972-97465-2-4. [Google Scholar] [CrossRef] [PubMed]
  37. Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
  38. Liu, H.; Li, J.; Carvalhais, L.C.; Percy, C.D.; Prakash Verma, J.; Schenk, P.M.; Singh, B.K. Evidence for the plant recruitment of beneficial microbes to suppress soil-borne pathogens. New Phytol. 2021, 229, 2873–2885. [Google Scholar] [CrossRef]
  39. Zhang, Y.; Xu, J.; Riera, N.; Jin, T.; Li, J.; Wang, N. Huanglongbing impairs the rhizosphere-to-rhizoplane enrichment process of the citrus root-associated microbiome. Microbiome 2017, 5, 97. [Google Scholar] [CrossRef]
  40. Shi, W.; Li, M.; Wei, G.; Tian, R.; Li, C.; Wang, B.; Lin, R.; Shi, C.; Chi, X.; Zhou, B. The occurrence of potato common scab correlates with the community composition and function of the geocaulosphere soil microbiome. Microbiome 2019, 7, 14. [Google Scholar] [CrossRef]
  41. Li, X.G.; Ding, C.F.; Zhang, T.L.; Wang, X.X. Fungal pathogen accumulation at the expense of plant-beneficial fungi as a consequence of consecutive peanut monoculturing. Soil. Biol. Biochem. 2014, 72, 11–18. [Google Scholar] [CrossRef]
  42. Xiang, L.G.; Zhou, H.; Wang, H.C.; Li, Z.; Chen, Q.L.; Yu, Z.H. Bacterial community structure and diversity of rhizosphere soil and stem of healthy and bacterial wilt tobacco plants. Acta Microbiol. Sin. 2019, 59, 1984–1999. [Google Scholar] [CrossRef]
  43. Wang, J.; Shi, C.; Fang, D.; Che, J.; Wu, W.; Lyu, L.; Li, W. The impact of storage temperature on the development of microbial communities on the surface of blueberry fruit. Foods 2023, 12, 1611. [Google Scholar] [CrossRef] [PubMed]
  44. Khanna, S.; Tosh, P.K. In A clinician’s primer on the role of the microbiome in human health and disease. Mayo Clin. Proc. 2014, 89, 107–114. [Google Scholar] [CrossRef] [PubMed]
  45. Stackebrandt, E.; Murray, R.; Trüper, H. Proteobacteria classis nov. a name for the phylogenetic taxon that includes the “purple bacteria and their relatives”. Int. J. Syst. Evol. Microbiol. 1988, 38, 321–325. [Google Scholar] [CrossRef]
  46. Gupta, R.S. The phylogeny of proteobacteria: Relationships to other eubacterial phyla and eukaryotes. FEMS Microbiol. Rev. 2000, 24, 367–402. [Google Scholar] [CrossRef] [PubMed]
  47. Rizzatti, G.; Lopetuso, L.; Gibiino, G.; Binda, C.; Gasbarrini, A. Proteobacteria: A common factor in human diseases. BioMed Res. Int. 2017, 2017, 9351507. [Google Scholar] [CrossRef]
  48. Ludwig, W.; Schleifer, K.H.; Whitman, W.B. Revised road map to the phylum Firmicutes. In Bergey’s Manual® of Systematic Bacteriology; Springer, New York, NY, USA, 2009; pp. 1–13. [CrossRef]
  49. Li, C.-M.; Cheng, T.-H.; Liang, Y.-R.; Huang, C.-L. Enhancement of Actinobacteriota and suppression of root-knot nematode infection in cucumbers through chitin application. Res. Sq. 2023, 1, 1–60. [Google Scholar] [CrossRef]
  50. Mwanza, E.P.; Hugo, A.; Charimba, G.; Hugo, C.J. Pathogenic potential and control of Chryseobacterium species from clinical, fish, food and environmental sources. Microorganisms 2022, 10, 895. [Google Scholar] [CrossRef]
  51. Grady, E.N.; MacDonald, J.; Liu, L.; Richman, A.; Yuan, Z.-C. Current knowledge and perspectives of Paenibacillus: A review. Microb. Cell Factories 2016, 15, 203. [Google Scholar] [CrossRef]
  52. Chase, A.B.; Arevalo, P.; Polz, M.F.; Berlemont, R.; Martiny, J.B. Evidence for ecological flexibility in the cosmopolitan genus Curtobacterium. Front. Microbiol. 2016, 7, 1874. [Google Scholar] [CrossRef]
  53. Loria, R.; Bukhalid, R.A.; Fry, B.A.; King, R.R. Plant pathogenicity in the genus Streptomyces. Plant Dis. 1997, 81, 836–846. [Google Scholar] [CrossRef]
  54. Höfte, M.; Vos, P. Plant pathogenic Pseudomonas species. In Plant-Associated Bacteria; Springer: Dordrecht, The Netherlands, 2006; pp. 507–533. [Google Scholar] [CrossRef]
  55. Green, P.N.; Ardley, J.K. Review of the genus Methylobacterium and closely related organisms: A proposal that some Methylobacterium species be reclassified into a new genus, Methylorubrum gen. nov. Int. J. Syst. Evol. Microbiol. 2018, 68, 2727–2748. [Google Scholar] [CrossRef] [PubMed]
  56. Ryan, R.P.; Monchy, S.; Cardinale, M.; Taghavi, S.; Crossman, L.; Avison, M.B.; Berg, G.; Van Der Lelie, D.; Dow, J.M. The versatility and adaptation of bacteria from the genus Stenotrophomonas. Nat. Rev. Microbiol. 2009, 7, 514–525. [Google Scholar] [CrossRef] [PubMed]
  57. Shu, L.J.; Yang, Y.L. Bacillus classification based on matrix-assisted laser desorption ionization time-of-flight mass spectrometry-effects of culture conditions. Sci Rep. 2017, 7, 15546. [Google Scholar] [CrossRef] [PubMed]
  58. Ryan, M.P.; Pembroke, J.T. The genus Ochrobactrum as major opportunistic pathogens. Microorganisms 2020, 8, 1797. [Google Scholar] [CrossRef]
  59. Carmichael, P.C.; Siyoum, N.; Chidamba, L.; Korsten, L. Exploring the microbial communities associated with botrytis cinerea during berry development in table grape with emphasis on potential biocontrol yeasts. Eur. J. Plant Pathol. 2019, 154, 919–930. [Google Scholar] [CrossRef]
  60. Shen, Y.; Nie, J.; Li, Z.; Li, H.; Wu, Y.; Dong, Y.; Zhang, J. Differentiated surface fungal communities at point of harvest on apple fruits from rural and peri-urban orchards. Sci. Rep. 2018, 8, 2165. [Google Scholar] [CrossRef]
  61. Jones, E.G.; Suetrong, S.; Sakayaroj, J.; Bahkali, A.H.; Abdel-Wahab, M.A.; Boekhout, T.; Pang, K.-L. Classification of marine Ascomycota, Basidiomycota, Blastocladiomycota and Chytridiomycota. Fungal Divers. 2015, 73, 1–72. [Google Scholar] [CrossRef]
  62. Salvatore, M.M.; Alves, A.; Andolfi, A. Secondary metabolites produced by Neofusicoccum species associated with plants: A review. Agriculture 2021, 11, 149. [Google Scholar] [CrossRef]
  63. Modrzewska, B.; Kurnatowski, P. Selected pathogenic characteristics of fungi from the genus Candida. Ann. Parasitol. 2013, 59, 57–66. Available online: https://agro.icm.edu.pl/agro/element/bwmeta1.element.agro-00217c2e-7e37-4a13-a56e-004b5b173c33 (accessed on 23 May 2024).
  64. Hambleton, S.; Egger, K.N.; Currah, R.S. The genus Oidiodendron: Species delimitation and phylogenetic relationships based on nuclear ribosomal DNA analysis. Mycologia 1998, 90, 854–868. [Google Scholar] [CrossRef]
  65. Maharachchikumbura, S.S.; Hyde, K.D.; Groenewald, J.Z.; Xu, J.; Crous, P.W. Pestalotiopsis revisited. Stud. Mycol. 2014, 79, 121–186. [Google Scholar] [CrossRef] [PubMed]
  66. Salvatore, M.M.; Andolfi, A.; Nicoletti, R. The thin line between pathogenicity and endophytism: The case of Lasiodiplodia theobromae. Agriculture 2020, 10, 488. [Google Scholar] [CrossRef]
  67. Angeli, D.; Sare, A.R.; Jijakli, M.H.; Pertot, I.; Massart, S. Insights gained from metagenomic shotgun sequencing of apple fruit epiphytic microbiota. Postharvest Biol. Technol. 2019, 153, 96–106. [Google Scholar] [CrossRef]
  68. Xu, M.; Zhang, X.; Li, D.; Gu, X.; Godana, E.A.; Dhanasekaran, S.; Zhao, L.; Zhang, H. Transcriptome analysis of postharvest grapes in response to Talaromyces rugulosus O1 infection. Postharvest Biol. Technol. 2021, 178, 111542. [Google Scholar] [CrossRef]
  69. Wang, M.; Liu, F.; Crous, P.W.; Cai, L. Phylogenetic reassessment of Nigrospora: Ubiquitous endophytes, plant and human pathogens. Persoonia-Mol. Phylogeny Evol. Fungi 2017, 39, 118–142. [Google Scholar] [CrossRef]
  70. Ma, L.-J.; Geiser, D.M.; Proctor, R.H.; Rooney, A.P.; O’Donnell, K.; Trail, F.; Gardiner, D.M.; Manners, J.M.; Kazan, K. Fusarium pathogenomics. Annu. Rev. Microbiol. 2013, 67, 399–416. [Google Scholar] [CrossRef]
  71. Nicoletti, R. Endophytic fungi of citrus plants. Agriculture 2019, 9, 247. [Google Scholar] [CrossRef]
  72. Nicoletti, R.; Di Vaio, C.; Cirillo, C. Endophytic fungi of olive tree. Microorganisms 2020, 8, 1321. [Google Scholar] [CrossRef]
  73. James, M.; Michael, W.; Jolanda, R.; Bernard, S. Invasive everywhere? Phylogeographic analysis of the globally distributed tree pathogen Lasiodiplodia theobromae. Forests 2017, 8, 145. [Google Scholar] [CrossRef]
  74. Bai, Y.; Müller, D.B.; Srinivas, G.; Garrido-Oter, R.; Potthoff, E.; Rott, M.; Dombrowski, N.; Münch, P.C.; Spaepen, S.; Remus-Emsermann, M. Functional overlap of the arabidopsis leaf and root microbiota. Nature 2015, 528, 364–369. [Google Scholar] [CrossRef]
  75. Mendes, R.; Kruijt, M.; De Bruijn, I.; Dekkers, E.; Van Der Voort, M.; Schneider, J.H.; Piceno, Y.M.; DeSantis, T.Z.; Andersen, G.L.; Bakker, P.A. Deciphering the rhizosphere microbiome for disease-suppressive bacteria. Science 2011, 332, 1097–1100. [Google Scholar] [CrossRef] [PubMed]
  76. Ritpitakphong, U.; Falquet, L.; Vimoltust, A.; Berger, A.; Métraux, J.P.; L’Haridon, F. The microbiome of the leaf surface of arabidopsis protects against a fungal pathogen. New Phytol. 2016, 210, 1033–1043. [Google Scholar] [CrossRef] [PubMed]
  77. Blaustein, R.A.; Lorca, G.L.; Meyer, J.L.; Gonzalez, C.F.; Teplitski, M. Defining the core citrus leaf-and root-associated microbiota: Factors associated with community structure and implications for managing huanglongbing (citrus greening) disease. Appl. Environ. Microbiol. 2017, 83, e00210-17. [Google Scholar] [CrossRef] [PubMed]
  78. Nguyen, M.T.; Ranamukhaarachchi, S.L.; Hannaway, D.B. Efficacy of antagonist strains of Bacillus megaterium, Enterobacter cloacae, Pichia guilliermondii and Candida ethanolica against bacterial wilt disease of tomato. J. Phytol. 2011, 3, 1–10. [Google Scholar]
  79. Dawoud, M.E.; Kamel, Z.; Hanaa, A.; Farahat, M.G. Growth promotion and biocontrol of leaf spot and leaf speck diseases in tomato by Pseudomonas spp. Egypt. J. Exp. Biol. 2012, 8, 61–70. Available online: https://www.egyseb.net/fulltext/15-1430045299.pdf (accessed on 23 May 2024).
  80. Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus by Penicillium simplicissimum GP17-2 in arabidopsis and tobacco. Plant Pathol. 2012, 61, 964–976. [Google Scholar] [CrossRef]
  81. Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Ozaki, K.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus in Arabidopsis thaliana by Trichoderma asperellum SKT-1. Plant Pathol. J. 2013, 29, 193–200. Available online: https://pmc.ncbi.nlm.nih.gov/articles/PMC4174775/ (accessed on 23 May 2024). [CrossRef]
Agronomy 14 02487 g001
Figure 1. Healthy Avocado Groups (CK).
Figure 1. Healthy Avocado Groups (CK).
Agronomy 14 02487 g001
Agronomy 14 02487 g002
Figure 2. Infected Avocado Groups. (a) Colletotrichum sp. strain No. 31 (31#). (b) Colletotrichum sp. strain No. 38 (38#). (c) Colletotrichum sp. strain No. 64 (64#).
Figure 2. Infected Avocado Groups. (a) Colletotrichum sp. strain No. 31 (31#). (b) Colletotrichum sp. strain No. 38 (38#). (c) Colletotrichum sp. strain No. 64 (64#).
Agronomy 14 02487 g002
Agronomy 14 02487 g003
Figure 3. Distribution of endophytic sequences. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 3. Distribution of endophytic sequences. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g003
Agronomy 14 02487 g004
Figure 4. Annotation result statistics of ASVs. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent infected groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 4. Annotation result statistics of ASVs. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent infected groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g004
Agronomy 14 02487 g005
Figure 5. Rarefaction curve of endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 5. Rarefaction curve of endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g005
Agronomy 14 02487 g006
Figure 6. Species accumulation boxplot of endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi.
Figure 6. Species accumulation boxplot of endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi.
Agronomy 14 02487 g006
Agronomy 14 02487 g007
Figure 7. NMDS of endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 7. NMDS of endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g007
Agronomy 14 02487 g008
Figure 8. Histogram of relative abundance of species in the endophytic bacteria. (a) Phylum Level. (b) Genus Level. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 8. Histogram of relative abundance of species in the endophytic bacteria. (a) Phylum Level. (b) Genus Level. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g008
Agronomy 14 02487 g009
Figure 9. Histogram of relative abundance of species in the endophytic fungi. (a) Phylum Level. (b) Genus Level. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 9. Histogram of relative abundance of species in the endophytic fungi. (a) Phylum Level. (b) Genus Level. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g009
Agronomy 14 02487 g010
Figure 10. LEfSe Cladogram of Endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 10. LEfSe Cladogram of Endophytes. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g010
Agronomy 14 02487 g011
Figure 11. Histogram of LDA score distribution. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Figure 11. Histogram of LDA score distribution. (a) Endophytic Bacteria. (b) Endophytic Fungi. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Agronomy 14 02487 g011
Table 1. Statistical results of endophytic bacterial tags.
Table 1. Statistical results of endophytic bacterial tags.
SampleReadsEffective TagsMerged
(%)		GCQ20Q30MeanError
CK-1146,146133,00291.0152.7098.9596.070.43
CK-2140,549128,32591.3053.1598.9196.000.44
CK-351,01846,70791.5553.2798.9696.160.43
S31-1148,218135,60991.4954.5398.9296.020.44
S31-2132,163121,49091.9254.5798.9796.160.43
S31-3107,98899,41792.0654.2798.9596.110.43
S38-1148,125135,52891.5054.0498.9396.070.44
S38-266,23960,93792.0054.0998.9396.090.44
S38-3147,885133,27490.1254.1198.9396.060.44
S64-1148,010134,51590.8854.3398.8795.850.46
S64-2147,765132,01889.3454.3398.8395.730.48
S64-3147,694133,08390.1154.3298.8895.910.46
Note: CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 2. Statistical results of endophytic fungal tags.
Table 2. Statistical results of endophytic fungal tags.
SampleReadsEffective TagsMerged
(%)		GCQ20Q30MeanError
CK-1140,771128,28491.1353.5798.9896.320.37
CK-2136,655127,33693.1854.1699.2097.050.29
CK-3137,931127,80092.6653.5199.1496.840.31
S31-169,49365,27193.9252.6599.2797.330.26
S31-2139,577129,98793.1352.6099.2497.220.27
S31-3100,34594,60394.2852.5999.3197.430.25
S38-1137,993128,96693.4652.6299.2697.310.26
S38-2147,063137,56393.5452.6199.2597.270.27
S38-3137,068127,69893.1652.6099.2997.380.26
S64-1142,588133,04493.3152.2999.2797.310.26
S64-2146,918137,94193.8952.3099.2597.280.27
S64-3122,538115,42194.1952.2799.2997.380.26
Note: CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 3. Diversity indexes of endophytic bacterial communities in avocado fruits.
Table 3. Diversity indexes of endophytic bacterial communities in avocado fruits.
SampleChao1ACEShannonSimpsonCoverage
CK-1653.92654.212.440.8399.91
CK-2580.56570.491.900.6899.92
CK-3433.21434.872.220.7799.80
S31-1900.60878.103.270.9099.93
S31-2911.04907.293.570.9399.92
S31-3863.67852.602.970.8299.88
S38-1844.82845.832.850.8499.94
S38-2759.64758.122.870.8499.79
S38-3862.42831.992.970.8599.93
S64-1848.88839.712.100.5899.91
S64-2861.99857.842.190.6099.89
S64-3833.72823.871.910.5299.90
Note: CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 4. Diversity indexes of endophytic fungal communities in avocado fruits.
Table 4. Diversity indexes of endophytic fungal communities in avocado fruits.
SampleChao1ACEShannonSimpsonCoverage
CK-1313.23320.123.160.9099.96
CK-2367.44369.683.680.9499.97
CK-3400.67370.383.560.9399.96
S31-1274.93277.040.860.3399.90
S31-2250.41254.620.650.2499.96
S31-3276.69288.810.720.2799.93
S38-1174.33191.630.700.3399.96
S38-2290.02295.100.730.3299.94
S38-3202.36215.820.690.3199.96
S64-1265.10265.690.950.4199.95
S64-2281.22292.500.980.4299.95
S64-3258.29260.000.950.4199.95
Note: CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 5. Major phyla identified for endophytic bacteria (%).
Table 5. Major phyla identified for endophytic bacteria (%).
PhylumCKS31S38S64
Proteobacteria76.61 ± 4.09 a53.33 ± 9.69 a79.27 ± 2.30 a88.49 ± 1.38 a
Bacteroidota21.31 ± 3.35 b 4.16 ± 1.02 c7.74 ± 0.40 b5.66 ± 0.48 b
Firmicutes1.06 ± 0.42 c27.4 ± 2.93 b5.08 ± 1.01 c4.16 ± 0.89 b
Actinobacteriota0.69 ± 0.46 c13.89 ± 6.66 c7.53 ± 0.89 bc1.30 ± 0.27 c
Note: Means with different lowercase letters in the same column are significantly different (p < 0.05). Same as below. CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 6. Major genera identified for endophytic bacteria (%).
Table 6. Major genera identified for endophytic bacteria (%).
GenusCKS31S38S64
Stenotrophomonas38.16 ± 16.50 a25.02 ± 14.82 a23.82 ± 1.33 b66.44 ± 3.35 a
Chryseobacterium20.02 ± 3.66 b3.86 ± 0.97 de7.24 ± 0.43 d0.94 ± 0.17 e
Others10.65 ± 1.19 bc9.85 ± 1.18 cd11.94 ± 0.56 c10.05 ±0.64 b
Bacillus0.09 ±0.02 c11.14 ± 3.49 cd4.07 ± 0.71 e2.89 ± 0.64 ef
Paenibacillus0.06 ± 0.02 c15.56 ± 1.85 bc0.10 ± 0.04 g0.95 ± 0.18 ef
Sphingobacterium0.05 ± 0.03 c0.03 ± 0.01 e0.05 ± 0.03 g4.60 ± 0.46 de
Curtobacterium0.03 ± 0.01 c10.34 ± 4.93 cd3.37 ± 0.47 e0.36 ± 0.11 f
Ochrobactrum0.03 ± 0.01 c0.07 ± 0.02 e0.07 ± 0.01 g6.83 ± 1.24 c
Streptomyces0.03 ± 0.02 c0.42 ± 0.27 e2.12 ± 0.41 f0.50 ± 0.07 f
Pseudomonas30.86 ± 11.92 a21.48 ± 4.85 ab46.35 ± 1.12 a6.31 ± 0.50 cd
Methylobacterium-Methylorubrum0.02 ± 0.01 c2.22 ± 1.19 de0.86 ± 0.24 g0.11 ± 0.01 f
CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 7. Major phyla identified for endophytic fungi (%).
Table 7. Major phyla identified for endophytic fungi (%).
PhylumCKS31S38S64
Ascomycota70.18 ± 2.25 a99.87 ± 0.03 a99.92 ± 0.03 a99.86 ± 0.05 a
Anthophyta23.71 ± 2.65 b0.06 ± 0.02 b0.04 ± 0.01 b0.09 ± 0.09 b
Basidiomycota5.25 ± 0.48 c0.06 ± 0.01 b0.04 ± 0.02 b0.05 ± 0.01 b
Note: CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Table 8. Major genera identified for endophytic fungi (%).
Table 8. Major genera identified for endophytic fungi (%).
GenusCKS31S38S64
Others29.91 ± 8.23 a1.24 ± 0.20 c0.89 ± 0.07 c0.80 ± 0.05 c
Eucalyptus22.49 ± 3.36 ab0.06 ± 0.02 c0.04 ± 0.01 d0.08 ± 0.04 d
Candida14.46 ± 6.49 bc0.11 ± 0.03 c0.04 ± 0.03 d0.08 ± 0.04 d
Kluyveromyces11.63 ± 8.50 cd0.07 ± 0.03 c0.03 ± 0.02 d0.06 ± 0.02 d
Talaromyces6.28 ± 5.26 cd0.04 ± 0.00 c0.02 ± 0.01 d0.04 ± 0.02 d
Oidiodendron5.89 ± 8.49 cd0.03 ± 0.01 c0.01 ± 0.01 d0.03 ± 0.01 d
Colletotrichum3.88 ± 1.05 de86.28 ± 2.57 a83.24 ± 0.98 a78.68 ± 0.90 a
Nigrospora3.21 ± 1.33 de0.04 ± 0.01 c0.01 ± 0.01 d0.03 ± 0.00 d
Pestalotiopsis1.34 ± 0.79 e0.03 ± 0.01 c0.01 ± 0.01 d0.03 ± 0.01 d
Lasiodiplodia0.58 ± 0.51 e11.17 ± 2.16 b15.67 ± 1.07 b20.12 ± 0.78 b
Fusarium0.34 ± 0.18 e0.92 ± 0.13 c0.04 ± 0.02 d0.05 ± 0.02 d
Note: CK represents the healthy group. S31, S38, and S64 represent the groups infected by anthracnose strains 31#, 38#, and 64# in sequence.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, X.; Jiang, Z.; He, P.; Tang, X.; Song, H.; Zhang, T.; Wei, Z.; Dong, T.; Zheng, S.; Tu, X.; et al. Effects of Anthracnose on the Structure and Diversity of Endophytic Microbial Communities in Postharvest Avocado Fruits. Agronomy 2024, 14, 2487. https://doi.org/10.3390/agronomy14112487

AMA Style

Chen X, Jiang Z, He P, Tang X, Song H, Zhang T, Wei Z, Dong T, Zheng S, Tu X, et al. Effects of Anthracnose on the Structure and Diversity of Endophytic Microbial Communities in Postharvest Avocado Fruits. Agronomy. 2024; 14(11):2487. https://doi.org/10.3390/agronomy14112487

Chicago/Turabian Style

Chen, Xi, Zhuoen Jiang, Peng He, Xiuhua Tang, Haiyun Song, Tao Zhang, Zhejun Wei, Tao Dong, Shufang Zheng, Xinghao Tu, and et al. 2024. "Effects of Anthracnose on the Structure and Diversity of Endophytic Microbial Communities in Postharvest Avocado Fruits" Agronomy 14, no. 11: 2487. https://doi.org/10.3390/agronomy14112487

APA Style

Chen, X., Jiang, Z., He, P., Tang, X., Song, H., Zhang, T., Wei, Z., Dong, T., Zheng, S., Tu, X., Qin, J., Chen, J., & Wang, W. (2024). Effects of Anthracnose on the Structure and Diversity of Endophytic Microbial Communities in Postharvest Avocado Fruits. Agronomy, 14(11), 2487. https://doi.org/10.3390/agronomy14112487

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop