A Novel SPOTTED LEAF1-1 (SPL11-1) Gene Confers Resistance to Rice Blast and Bacterial Leaf Blight Diseases in Rice (Oryza sativa L.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Magnaporthe Oryzae Strains and Xanthomonas oryzae
2.3. Evaluation of Resistance to Rice Blast and Bacterial Blight Diseases
2.4. Construction of the Mapping Population and Genetic Mapping of the SPL11-1 Gene
2.5. Bulked Segregant Analysis
2.6. Prediction of spl11-1 and spl11 Protein Structure
2.7. Phenotype Investigation
3. Results
3.1. The Main Agronomical Characteristics of the spl11-1 Mutant
3.2. Resistance Analysis of the spl11-1 Mutant and ‘Shuangkang77009’ Wild Type
3.3. Phenotypic Segregation for spl11-1 Mutant
3.4. Genetic Mapping of the SPL11-1 Locus
3.5. Genetic Fine Mapping of SPL11-1
3.6. Identification of Candidate Genes
3.7. Sequence Analyses of SPL11-1 Candidate Genes
3.8. Application of the SPL11-1 Gene
4. Discussion
4.1. Identification of SPL11-1 Alleles
4.2. Application Prospects of SPL11-2
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Wu, H.; Dai, G.X.; Rao, Y.C.; Wu, K.X.; Wang, J.G.; Hu, P.; Wen, Y.; Wang, Y.Y.; Zhu, L.X.; Chai, B.Z.; et al. Disruption of LEAF LESION MIMIC 4 affects ABA synthesis and ROS accumulation in rice. Crop J. 2023, 11, 1341–1352. [Google Scholar] [CrossRef]
- Sha, G.; Sun, P.; Kong, X.J.; Han, X.Y.; Sun, Q.; Fouillen, L.P.; Zhao, J.; Li, Y.; Yang, L.; Wang, Y.; et al. Genome editing of a rice CDP-DAG synthase confers multipathogen resistance. Nature 2023, 618, 1017–1023. [Google Scholar] [CrossRef] [PubMed]
- Xiao, G.Q.; Zhang, Y.F.; Yang, B.N.; Liu, B.C.; Zhou, J.H.; Zhang, H.W. Research progress of plant lesion mimic mutants. Mol. Plant Breed. 2017, 15, 290–299. [Google Scholar]
- Qian, J.Y.; Liu, F.; Qu, C.; Wang, Y. Research progress on cloning and mechanism of rice lesion mimic genes. Mol. Plant Breed. 2021, 19, 3274–3280. [Google Scholar] [CrossRef]
- Liu, Q.E.; Ning, Y.S.; Zhang, Y.X.; Yu, N.; Zhao, C.D.; Zhan, X.D.; Wu, W.X.; Chen, D.B.; Wei, X.J.; Wang, G.L.; et al. OsCUL3a negatively regulates cell death and immunity by degrading OsNPR1 in rice. Plant Cell 2017, 29, 345–359. [Google Scholar] [CrossRef]
- Ye, G.; Ao, M.; Cui, Z.H.; Fan, K.X.; Guan, Y.X. Development mechanism and signal transduction pathway of lesion mimic mutation in plants. Soils Crops 2023, 12, 117–129. [Google Scholar]
- Shen, W.X.; Shi, X.P.; Du, H.B.; Feng, Z.M.; Chen, Z.X.; Hu, K.M.; Fan, J.B.; Zuo, S.M. Research advances in gene cloning and occurrence mechanism of rice lesion mimic mutants. Jiangsu J. Agric. Sci. 2023, 8, 837–848. [Google Scholar]
- Arase, S. Studies on fungal pathogenicity and host resistance in rice blast disease using a lesion mimic mutant of rice. J. Gen. Plant Pathol. 2005, 71, 448–450. [Google Scholar] [CrossRef]
- Tian, D.G.; Yang, F.; Niu, Y.Q.; Lin, Y.; Chen, Z.J.; Li, G.; Luo, Q.; Wang, F.; Wang, M. Loss function of SL (sekiguchi lesion) in the rice cultivar Minghui 86 leads to enhanced resistance to (hemi) biotrophic pathogens. BMC Plant Biol. 2020, 20, 507. [Google Scholar] [CrossRef]
- Cui, Y.J.; Peng, Y.L.; Zhang, Q.; Xia, S.S.; Ruan, B.P.; Xu, Q.K.; Yu, X.Q.; Zhou, T.T.; Liu, H.; Zeng, D.L.; et al. Disruption of EARLY LESION LEAF 1, encoding a cytochrome P450 monooxygenase, induces ROS accumulation and cell death in rice. Plant J. 2021, 105, 942–956. [Google Scholar] [CrossRef]
- Zeng, L.R.; Qu, S.H.; Bordeos, A.; Yang, C.W.; Baraoidan, M.; Yan, H.Y.; Xie, Q.; Nahm, B.H.; Leung, H.; Wang, G.L. Spotted leaf11, a negative regulator of plant cell death and defense, encodes a u-box/armadillo repeat protein endowed with e3 ubiquitin ligase activity. Plant Cell 2004, 16, 2795–2808. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.B.; Bai, P.F.; Ning, Y.S.; Wang, J.Y.; Shi, X.T.; Xiong, Y.H.; Zhang, K.; He, F.; Zhang, C.Y.; Wang, R.Y.; et al. The monocot-specific receptor-like kinase SDS2 controls cell death and immunity in rice. Cell Host Microbe 2018, 23, 498–510. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Wang, Y.F.; Ma, X.D.; Meng, L.Z.; Jing, R.N.; Wang, F.; Wang, S.; Cheng, Z.J.; Zhang, X.; Jiang, L.; et al. Disruption of gene SPL35, encoding a novel CUE domain-containing protein, leads to cell death and enhanced disease response in rice. Plant Biotechnol. J. 2019, 17, 1679–1693. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Li, G.W.; Liu, M.M.; Liu, R.; Yang, S.Y.; Wang, K.; Lu, L.H.; Ye, Q.Y.; Liu, J.X.; Liang, J.; et al. A ubiquitin-specific protease functions in regulating cell death and immune responses in rice. Plant Cell Environ. 2023, 46, 1312–1326. [Google Scholar]
- Yang, D.W.; Li, S.P.; Lu, L.; Fang, J.B.; Wang, W.; Cui, H.T.; Tang, D.Z. Identification and application of the Pigm-1 gene in rice disease-resistance breeding. Plant Biol. 2020, 22, 1022–1029. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.W.; Li, S.P.; Xiao, Y.P.; Lu, L.; Zheng, Z.C.; Tang, D.Z.; Cui, H.T. Transcriptome analysis of rice response to blast fungus identified core genes involved in immunity. Plant Cell Environ. 2021, 44, 6088. [Google Scholar] [CrossRef]
- Li, L.; Sun, L.; Zhang, J.H.; Zou, X.W.; Sun, H.; Ren, J.P.; Jiang, Z.Y.; Liu, X.M. Evaluation of resistance and analysis of utilization value of the major japonica rice varieties in Jilin Province based on the physiological race variation of Magnaporthe oryzae. Sci. Agric. Sin. 2023, 56, 4441–4452. [Google Scholar]
- Ji, C.H.; Ji, Z.Y.; Liu, B.; Cheng, H.; Liu, H.; Liu, S.Z.; Yang, B.; Chen, G.Y. Xa1 allelic R genes activate rice blight resistance suppressed by interfering TAL effectors. Plant Commun. 2020, 1, 100087. [Google Scholar] [CrossRef]
- He, M.; Yin, J.J.; Feng, Z.M.; Zhu, X.B.; Zhao, J.H.; Zuo, S.M.; Chen, X.W. Methods for identification of resistance to blast and sheath blight in rice. Chin. Bull. Bot. 2020, 55, 577–587. [Google Scholar]
- Yang, D.W.; Ye, X.F.; Zheng, X.H.; Cheng, C.P.; Ye, N.Q.; Huang, F.H. Development and evaluation of chromosome segment substitution lines carrying overlapping chromosome segments of the whole wild rice genome. Front. Plant Sci. 2016, 7, 1737. [Google Scholar] [CrossRef]
- Panaud, O.; Chen, X.; Mccouch, S.R. Development of microsatellite and characterization of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol. General. Genet. 1996, 252, 597–607. [Google Scholar] [CrossRef] [PubMed]
- Lander, E.S.; Green, P.; Abrahamson, J.; Barlow, A.; Daly, M.J.; Lincoln, S.E.; Newberg, L.A. Mapmaker: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1987, 1, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.L.; Chu, S.H.; Choi, M.S.; Qiao, Y.L.; Jiang, W.Z.; Piao, R.H.; Khanam, S.K.; Cho, Y.L.; Jeung, J.U.; Jena, K.S.; et al. Identification of QTLs for some agronomic traits in rice using an introgression line from Oryaza minuta. Mol. Cell 2007, 24, 16–26. [Google Scholar] [CrossRef]
- Rosignoli, S.; Paiardini, A. Boosting the full potential of PyMOL with structural biology plugins. Biomolecules 2022, 12, 1764. [Google Scholar] [CrossRef]
- Fan, C.C.; Xing, Y.Z.; Mao, H.L.; Lu, T.T.; Han, B.; Xu, C.G.; Li, X.H.; Zhang, Q.F. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet. 2006, 112, 1164–1171. [Google Scholar] [CrossRef]
- Lin, S.J.; Liu, Z.P.; Zhang, K.; Yang, W.F.; Zhan, P.L.; Tan, Q.Y.; Gou, Y.J.; Ma, S.P.; Luan, X.; Huang, C.B.; et al. GL9 from Oryza glumaepatula controls grain size and chalkiness in rice. Crop J. 2023, 11, 198–207. [Google Scholar] [CrossRef]
- Yin, Z.C.; Chen, J.; Zeng, L.R.; Goh, M.; Leung, H.; Khush, G.S.; Wang, G.L. Characterizing rice lesion mimic mutants and identifying a mutant with broad-spectrum resistance to rice blast and bacterial blight. Mol. Plant Microbe Interact. 2000, 13, 869–876. [Google Scholar] [CrossRef]
- Vega-Sánchez, M.E.; Zeng, L.R.; Chen, S.B.; Leung, H.; Wang, G.L. SPIN1, a K homology domain protein negatively regulated and ubiquitinated by the E3 ubiquitin ligase SPL11, is involved in flowering time control in rice. Plant Cell 2008, 20, 1456–1469. [Google Scholar] [CrossRef]
- Cai, Y.H.; Vega-Sánchez, M.E.; Park, C.H.; Bellizzi, M.; Guo, Z.J.; Wang, G.L. RBS1, an RNA binding protein, interacts with SPIN1 and is involved in flowering time control in rice. PLoS ONE 2014, 9, e87258. [Google Scholar] [CrossRef]
- Liu, J.L.; Park, C.H.; He, F.; Nagano, M.; Wang, M.; Bellizzi, M.; Zhang, K.; Zeng, X.S.; Liu, W.D.; Ning, Y.S.; et al. The RhoGAP SPIN6 associates with SPL11 and OsRac1 and negatively regulates programmed cell death and innate immunity in rice. PLoS Pathog. 2015, 11, e1004629. [Google Scholar] [CrossRef]
Magnaporthe oryzae Strain | Shuangkang77009 | spl11-1 |
---|---|---|
Guy11 | R | R |
18SH-D527 | R | R |
KJ201 | R | R |
501-3 | R | R |
FJ2011 | R | R |
95085AZB | R | R |
MH86-1 | R | R |
MH86-3 | R | R |
RB22 | R | R |
20-15 | R | R |
18NH-16-3 | R | R |
M409 | R | R |
Crosses | F1 Phenotype | F2 Population | χ2 (3:1) | p | ||
---|---|---|---|---|---|---|
Wild Type | Mutants | Total | ||||
Shuangkang77009/spl11-1 | Wild-type phenotype | 322 | 111 | 433 | 0.305 * | >0.9 |
spl11-1/Shuangkang77009 | Mutant phenotype | 569 | 191 | 760 | 0.34 * | >0.9 |
Marker | Sequence of Forward Primer | Sequence of Reverse Primer |
---|---|---|
RM4125 | GTGCCTCCATCATCATCATC | TAGGACAAGCGAAGAAACCG |
RM235 | AGAAGCTAGGGCTAACGAAC | TCACCTGGTCAGCCTCTTTC |
Indel12-2 | CACGCACCTTTCTGGCTTTCAGC | AGCAACCTCCGACGGGAGAAGG |
Indel12-4 | TATGGGTCATAACTGAGCCACTCC | CACGTACACCTACTTCTTGCTTGC |
Indel12-7 | AATAGCTGCATATACCCGGTTGG | TGTGTCTCTGATGATCCGTTTCG |
Indel12-10 | CGAACACCTTCCTTGTTTCTTCG | AGAAGACGACGACTCCACCAACC |
Indel12-13 | GCATGACCAATGAGGAAACATGG | CGTCGTCTCCTTCGATTTATTCTCC |
Indel12-16 | TCACTCACTCACTCAAGCCAAGC | TCTGGATGGTGTCCTTGATCTCC |
Indel12-19 | CGCAGTGTATTTGTTGTAGCTCTCG | CCACAATACACAGGACATTGATGC |
Indel12-23 | GAGGTGATCTTAATGCCATCTTGACG | TACATGCAACCTGGGTATGAGAGTGC |
Indel12-25 | CAGATGTGGTAAACTGGTAAGAGC | TAGCCTGGGTTCTACTTGTCC |
Indel12-28 | ATCGTGAACACCTCCATGACAGC | ACCTACAAGGTCGCTCGCTACATCC |
Indel12-30 | CCTAGGTGGTTGTGTTCTGTTTGG | CGTCACCTCTTAAGTCAACACATCG |
Indel12-33 | AGCATGAGACCCACATATCAGC | CCTATCTTAGAGTGCCATCTAGTTCC |
Indel12-37 | AGTTTAGTCCGTTTCACGAG | ATTGCTCTCTTCTTGGAATG |
Indel12-39 | CTCTAGCTTCTTGCTCTTCG | CTCACCTTCTTCAAGCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, S.; He, N.; Cheng, Z.; Huang, F.; Wang, M.; Al Aboud, N.M.; Abou-Elwafa, S.F.; Yang, D. A Novel SPOTTED LEAF1-1 (SPL11-1) Gene Confers Resistance to Rice Blast and Bacterial Leaf Blight Diseases in Rice (Oryza sativa L.). Agronomy 2024, 14, 2240. https://doi.org/10.3390/agronomy14102240
Lin S, He N, Cheng Z, Huang F, Wang M, Al Aboud NM, Abou-Elwafa SF, Yang D. A Novel SPOTTED LEAF1-1 (SPL11-1) Gene Confers Resistance to Rice Blast and Bacterial Leaf Blight Diseases in Rice (Oryza sativa L.). Agronomy. 2024; 14(10):2240. https://doi.org/10.3390/agronomy14102240
Chicago/Turabian StyleLin, Shaojun, Niqing He, Zhaoping Cheng, Fenghuang Huang, Mingmin Wang, Nora M. Al Aboud, Salah F. Abou-Elwafa, and Dewei Yang. 2024. "A Novel SPOTTED LEAF1-1 (SPL11-1) Gene Confers Resistance to Rice Blast and Bacterial Leaf Blight Diseases in Rice (Oryza sativa L.)" Agronomy 14, no. 10: 2240. https://doi.org/10.3390/agronomy14102240
APA StyleLin, S., He, N., Cheng, Z., Huang, F., Wang, M., Al Aboud, N. M., Abou-Elwafa, S. F., & Yang, D. (2024). A Novel SPOTTED LEAF1-1 (SPL11-1) Gene Confers Resistance to Rice Blast and Bacterial Leaf Blight Diseases in Rice (Oryza sativa L.). Agronomy, 14(10), 2240. https://doi.org/10.3390/agronomy14102240