Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. Transposon Identification
2.2.2. Identification and Functional Analysis of Novel Genes Associated with BPH Resistance
2.2.3. Quantitative Analysis
3. Results
3.1. Identification of Transposons in Insect-Susceptible and Insect-Resistant Rice Populations
3.2. Analysis of Transposon Family
3.3. Detection of Transposon Insertion into Genome
3.4. Validation of Candidate Genes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Bao, Y.; Song, G.E. Historical retrospect and the perplexity on the studies of the Oryza polyploids. J. Syst. Evol. 2008, 46, 3–12. [Google Scholar]
- Fageria, N. Yield Physiology of Rice. J. Plant Nutr. 2007, 30, 843–879. [Google Scholar] [CrossRef]
- Iamba, K.; Dono, D. A review on brown planthopper (Nilaparvata lugens Stål), a major pest of rice in Asia and Pacific. Asian J. Res. Crop Sci. 2021, 6, 7–19. [Google Scholar] [CrossRef]
- Liu, W.; Liu, Z.; Huang, C.; Lu, M.; Liu, J.; Yang, Q. Statistics and analysis of crop yield losses caused by main diseases and insect pests in recent 10 years. Plant Prot. 2016, 42, 1–9+46. [Google Scholar]
- Feuillet, C.; Leach, J.; Rogers, J.; Schnable, P.; Eversole, K. Crop genome sequencing: Lessons and rationales. Trends Plant Sci. 2010, 16, 77–88. [Google Scholar] [CrossRef]
- Sabot, F.; Hua-Van, A.; Bennetzen, J.; Capy, P.; Chalhoub, B.; Flavell, A.; Leroy, P.; Morgante, M.; Panaud, O.; Paux, E.; et al. A Unified Classification System for Eukaryotic Transposbale Elments. Nat. Rev. Genet. 2007, 8, 973–982. [Google Scholar]
- Lisch, D. How important are transposons for plant evolution? Nat. Rev. Genet. 2012, 14, 49–61. [Google Scholar] [CrossRef] [PubMed]
- Lockton, S.; Gaut, B.S. The contribution of transposable elements to expressed coding sequence in Arabidopsis thaliana. J. Mol. Evol. 2009, 68, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Fedoroff, N. Plant Transposons and Genome Dynamics in Evolution; John Wilely & Sons: Hoboken, NJ, USA, 2013. [Google Scholar]
- Fernandez, L.; Torregrosa, L.; Segura, V.; Bouquet, A.; Martínez-Zapater, J.M. Transposon-induced gene activation as a mechanism generating cluster shape somatic variation in grapevine. Plant J. 2009, 61, 545–557. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, K.; Yoshida, H. Refunctionalization of the ancient rice blast disease resistance gene pit by the recruitment of a retrotransposon as a promoter. Plant J. 2008, 57, 413–425. [Google Scholar] [CrossRef]
- Rebollo, R.; Romanish, M.; Mager, D. Transposable elements: An abundant and natural source of regulatory sequences for host genes. Annu. Rev. Genet. 2012, 46, 21–42. [Google Scholar] [CrossRef]
- Grandbastien, M.-A. Activation of plant retrotransposons under stress conditions. Trends Plant Sci. 1998, 3, 181–187. [Google Scholar] [CrossRef]
- Kimura, Y.; Tosa, Y.; Shimada, S.; Sogo, R.; Kusaba, M.; Sunaga, T.; Betsuyaku, S.; Eto, Y.; Nakayashiki, H.; Mayama, S. OARE-1, a Ty1-copia retrotransposon in oat activated by abiotic and biotic stresses. Plant Cell Physiol. 2002, 42, 1345–1354. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, H.; Hirochika, H. Efficient insertion mutagenesis of arabidopsis by tissue culture-induced activation of the tobacco retrotransposon Tto1. Plant J. 2000, 23, 291–304. [Google Scholar] [CrossRef]
- Sakamoto, K.; Ohmido, N.; Fukui, K.; Kamada, H.; Satoh, S. Site-specific accumulation of a LINE-like retrotransposon in a sex chromosome of the dioecious plant Cannabis sativa. Plant Mol. Biol. 2000, 44, 723–732. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, E.; Liu, J.; Gao, L.-Z.; Mcdonald, J. Long terminal repeat retrotransposons of Oryza sativa. Genome Biol. 2002, 3, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Tao, Z.; Hong, H.; Chen, Z.; Wu, C.; Li, X.; Xiao, J.; Wang, S. Transposon-derived small RNA is responsible for modified function of WRKY45 locus. Nat. Plants 2016, 2, 16016. [Google Scholar] [CrossRef]
- Zhao, Y.; Wu, L.; Fu, Q.; Wang, D.; Li, J.; Yao, B.; Yu, S.; Jiang, L.; Qian, J.; Zhou, X.; et al. INDITTO2 transposon conveys auxin-mediated DRO1 transcription for rice drought avoidance. Plant Cell Environ. 2021, 44, 1846–1857. [Google Scholar] [CrossRef]
- Shen, J.; Liu, J.; Xie, K.; Xing, F.; Xiong, F.; Xiao, J.; Li, X.; Xiong, L. Translational repression by a miniature inverted-repeat transposable element in the 3′ untranslated region. Nat. Commun. 2017, 8, 14651. [Google Scholar] [CrossRef]
- Carpentier, M.-C.; Manfroi, E.; Wei, F.-J.; Wu, H.-P.; Lasserre, E.; Llauro, C.; Debladis, E.; Akakpo, R.; Hsing, Y.-I.; Panaud, O. Retrotranspositional landscape of Asian rice revealed by 3000 genomes. Nat. Commun. 2019, 10, 24. [Google Scholar] [CrossRef]
- Guo, J.; Xu, C.; Wu, D.; Zhao, Y.; Qiu, Y.; Wang, X.; Ouyang, Y.; Cai, B.; Liu, X.; Jing, S.; et al. Bph6 encodes an exocyst-localized protein and confers broad resistance to planthoppers in Rice. Nat. Genet. 2018, 50, 297–306. [Google Scholar] [CrossRef] [PubMed]
- Shi, S.; Wang, H.; Nie, L.; Tan, D.; Zhou, C.; Zhang, Q.; Li, Y.; Bo, D.; Guo, J.; Jin, H.; et al. Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheath. Mol. Plant 2021, 14, 1714–1732. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Fu, Z.H. Comparative study on identification methods of resistance of rice varieties to Planthopper. Chin. J. Rice Sci. 2002, 16, 52–56. [Google Scholar]
- Ouyang, S.; Zhu, W.; Hamilton, J.; Lin, H.; Campbell, M.; Childs, K.; Thibaud-Nissen, F.; Malek, R.; Lee, Y.; Zheng, L.; et al. The TIGR rice genome annotation resource: Improvements and new features. Nucleic Acids Res. 2007, 35, D883–D887. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Wrightsman, T.; Wessler, S.R.; Stajich, J.E. RelocaTE2: A high resolution transposable element insertion site mapping tool for population resequencing. PeerJ. 2017, 5, e2942. [Google Scholar] [CrossRef] [PubMed]
- Quinlan, A.R.; Hall, I.M. BEDTools: A Flexible Suite of Utilities for Comparing Genomic Features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef] [PubMed]
- Cantalapiedra, C.P.; Hernández-Plaza, A.; Letunic, I.; Bork, P.; Huerta-Cepas, J. EggNOG-Mapper v2: Functional annotation, orthology assignments, and domain prediction at the metagenomic scale. Mol. Biol. Evol. 2021, 38, 5825–5829. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Peng, W.; Dong, Z.; Ning, Y. Studies on the role of potassium and calcium channels in plant disease resistance. Highlights Sci. Online 2018, 11, 204–211. [Google Scholar]
- Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Liu, Z.; Wang, T.; Wang, L.; Zhao, H.; Yue, E.; Yan, Y.; Irshad, F.; Ling, Z.; Duan, M.; Xu, J.-H. RTRIP: A comprehensive profile of transposon insertion polymorphisms in rice. Plant Biotechnol. J. 2020, 18, 2379–2381. [Google Scholar] [CrossRef]
- Longqing, S.; Meng, D.; Lian, L.; Zhang, J.; Zhu, Y.; Kong, W.; Qiu, L.; Liu, D.; Xie, Z.; Zhan, Z.; et al. Genome-wide association study reveals a new quantitative trait locus in rice related to resistance to brown planthopper Nilaparvata lugens (Stål). Insects 2021, 12, 836. [Google Scholar]
- Fan, J.; Hill, L.; Crooks, C.; Doerner, P.; Lamb, C. Abscisic Acid Has a Key Role in Modulating Diverse Plant-Pathogen Interactions. Plant Physiol. 2009, 150, 1750–1761. [Google Scholar] [CrossRef] [PubMed]
- Howe, G.; Jander, G. Plant immunity to insect herbivores. Annu. Rev. Plant Biol. 2008, 59, 41–66. [Google Scholar] [CrossRef]
- Zhou, C.; Zhang, Q.; Chen, Y.; Huang, J.; Guo, Q.; Li, Y.; Wang, W.; Qiu, Y.; Guan, W.; Zhang, J.; et al. Balancing selection and wild gene pool contribute to resistance in global rice germplasm against planthopper. J. Integr. Plant Biol. 2021, 63, 1695–1711. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Huang, Q.; Deng, Q.; Wu, J.; Liu, J. Advances in research on the role of abscisic acid in plant-insect resistance. J. Environ. Entomol. 2019, 41, 808–813. [Google Scholar]
- Thaler, J.; Bostock, R. Interactions between abscisic-acid-mediated responses and plant resistance to pathogens and insects. Ecology 2004, 85, 48–58. [Google Scholar] [CrossRef]
- Bodenhausen, N.; Reymond, P. Signaling pathways controlling induced resistance to insect herbivores in Arabidopsis. Mol. Plant-Microbe Interact. 2007, 20, 1406–1420. [Google Scholar] [CrossRef]
- Dinh, S.; Baldwin, I.; Galis, I. The HERBIVORE ELICITOR-REGULATED1 gene enhances abscisic acid levels and defenses against herbivores in Nicotiana attenuata Plants. Plant Physiol. 2013, 162, 2106–2124. [Google Scholar] [CrossRef]
- Aist, J.R. Papillae and related wound plugs of plant cells. Annu. Rev. Phytopathol. 1976, 14, 145–163. [Google Scholar] [CrossRef]
- Flors, V.; Ton, J.; Jakab, G.; Mauch-Mani, B. Abscisic acid and callose: Team players in defence against pathogens? J. Phytopathol. 2005, 153, 377–383. [Google Scholar] [CrossRef]
- Asselbergh, B.; Höfte, M. Basal tomato defences to Botrytis Cinerea include abscisic acid-dependent callose formation. Physiol. Mol. 2007, 71, 33–40. [Google Scholar] [CrossRef]
- Alazem, M.; He, M.-H.; Moffett, P.; Lin, N.-S. Abscisic acid induces resistance against bamboo mosaic virus through argonaute 2 and 3. Plant Physiol. 2017, 174, 339–355. [Google Scholar] [CrossRef] [PubMed]
- Domínguez, M.; Dugas, E.; Benchouaia, M.; Leduque, B.; Jiménez-Gómez, J.M.; Colot, V.; Quadrana, L. The impact of transposable elements on tomato diversity. Nat. Commun. 2020, 11, 4058. [Google Scholar] [CrossRef] [PubMed]
- Midha, M.K.; Wu, M.; Chiu, K.P. Long-read sequencing in deciphering human genetics to a greater depth. Hum. Genet. 2019, 138, 1201–1215. [Google Scholar] [CrossRef] [PubMed]
Sample ID | Resistance Level | Sample ID | Resistance Level | Sample ID | Resistance Level |
---|---|---|---|---|---|
R01 | 9 | R77 | 9 | R118 | 1–5 |
R04 | 9 | R80 | 9 | R86 | 5 |
R05 | 9 | R85 | 9 | R23 | 3 |
R11 | 9 | R93 | 9 | R112 | 3 |
R12 | 9 | R116 | 9 | R58 | 0–5 |
R16 | 9 | R122 | 9 | R61 | 1–3 |
R20 | 9 | R123 | 9 | R109 | 1–3 |
R21 | 9 | R119 | 9 | R101 | 0–3 |
R28 | 9 | R121 | 9 | R120 | 0–1 |
R31 | 9 | R102 | 7 | R27 | 0–5 |
R32 | 9 | R114 | 7 | R08 | 0–3 |
R36 | 9 | R33 | 7–9 | R63 | 0–3 |
R37 | 9 | R35 | 7–9 | R66 | 0–3 |
R38 | 9 | R113 | 7–9 | R84 | 0–3 |
R40 | 9 | R03 | 3–5 | R96 | 0–3 |
R41 | 9 | R06 | 3–5 | R97 | 0–3 |
R43 | 9 | R13 | 3–5 | R99 | 0–3 |
R47 | 9 | R14 | 3–5 | R19 | 0–1 |
R48 | 9 | R30 | 3–5 | R25 | 0–1 |
R49 | 9 | R59 | 3–5 | R87 | 0–1 |
R50 | 9 | R64 | 3–5 | R89 | 0–1 |
R51 | 9 | R73 | 3–5 | R110 | 0–1 |
R65 | 9 | R83 | 3–5 | R115 | 0–1 |
R67 | 9 | R103 | 3–5 | R17 | 1 |
R71 | 9 | R105 | 3–5 | R29 | 1 |
R72 | 9 | R18 | 1–5 | R15 | 0 |
R74 | 9 | R107 | 1–5 | R24 | 0 |
R76 | 9 | R108 | 1–5 | R26 | 0 |
Gene Name | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
---|---|---|
UBQ | ACCCTGGCTGACTACAACATC | AGTTGACAGCCCTAGGGTG |
LOC_Os04g02720 | CTCCATTGCTCTTGTTGTCATTAG | CAGTGACAAGGTGACGAAGAA |
Gene ID | Annotation |
---|---|
LOC_Os01g11670 | OsSCP2—Putative serine carboxypeptidase homologue, expressed |
LOC_Os03g49040 | Transposon protein, putative, CACTA, En/Spm sub-class, expressed |
LOC_Os04g02720 | Potassium channel KAT 2, Putative, expressed |
LOC_Os07g20360 | Retrotransposon protein, putative, unclassified, expressed |
LOC_Os10g17910 | OsWAK114–OsWak receptor-like cytoplasmic kinase OsWAK-RLCK, expressed |
LOC_Os12g22030 | Serine hydroxymethyltransferase, SHMT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, H.; Liao, Z.; Gao, Y.; Zhang, L.; Lei, W.; Huang, H.; Lei, S.; Jiang, M.; Chen, S.; Shi, L. Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.). Agronomy 2023, 13, 1699. https://doi.org/10.3390/agronomy13071699
Wang H, Liao Z, Gao Y, Zhang L, Lei W, Huang H, Lei S, Jiang M, Chen S, Shi L. Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.). Agronomy. 2023; 13(7):1699. https://doi.org/10.3390/agronomy13071699
Chicago/Turabian StyleWang, Huanhuan, Zhenyang Liao, Yingying Gao, Lingge Zhang, Wenlong Lei, Hantang Huang, Siru Lei, Mengwei Jiang, Shuai Chen, and Longqing Shi. 2023. "Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.)" Agronomy 13, no. 7: 1699. https://doi.org/10.3390/agronomy13071699
APA StyleWang, H., Liao, Z., Gao, Y., Zhang, L., Lei, W., Huang, H., Lei, S., Jiang, M., Chen, S., & Shi, L. (2023). Transposon Polymorphism and Its Potential Impacts on Brown Planthopper (Nilaparvata lugens Stål) Resistance in Rice (Oryza sativa L.). Agronomy, 13(7), 1699. https://doi.org/10.3390/agronomy13071699