Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Extract Manufacture
2.2. Measurement of ROS Scavenging Activity
2.3. Measurement of Reducing Power
2.4. Analysis of Total Phenolic and Flavonoid Contents
2.5. Phenol Component Analysis Using High-Performance Liquid Chromatography (HPLC)
2.6. Expression Confirmation of Antioxidant Genes Using qPCR
2.7. Statistical Analysis
3. Results and Discussion
3.1. Analysis of the Climate, Morphological Characteristics, and Antioxidant Activity of 12 Sorghum Genetic Resource Seeds
3.2. Total Phenolic and Flavonoid Contents
3.3. Phenol Composition Analysis
3.4. Differences in Expression Levels of Antioxidant-Related Genes in Sorghum Genetic Resources
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, H.H.; Xu, N.; Wu, X.; Wang, J.; Ma, S.; Li, X.; Sun, G. Effects of four types of sodium salt stress on plant growth and photosynthetic apparatus in sorghum leaves. J. Plant Interact. 2018, 13, 506–513. [Google Scholar] [CrossRef] [Green Version]
- Zhu, M.; Chen, J.; Yuyama, N.; Luo, L.; Xiao, X.; Lv, Y.; Liu, Y.; Cai, H. Genetic diversity and population structure of broomcorn Sorghum investigated with simple sequence repeat markers. Trop. Plant Biol. 2020, 13, 62–72. [Google Scholar] [CrossRef]
- Kaufman, R.C.; Herald, T.J.; Bean, S.R.; Wilsona, J.D.; Tuinstra, M.R. Variability in tannin content, chemistry and activity in a diverse group of tannin containing sorghum cultivars. J. Sci. Food Agric. 2013, 93, 1233–1241. [Google Scholar] [CrossRef]
- Kim, J.; Noh, S.K.; Woo, K.S.; Seo, M.C. Sorghum extract lowers lymphatic absorption of trans fat and cholesterol in rats. J. Korean Soc. Food Sci. Nutr. 2016, 45, 783–788. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Huang, L.; Pei, X. Effects of sorghum rice and black rice on genes associated with cholesterol metabolism in hypercholesterolemic mice liver and intestine. Food Sci. Nutr. 2021, 9, 217–229. [Google Scholar] [CrossRef]
- Stefoska-Needham, A.; Beck, E.J.; Johnson, S.K.; Tapsell, L.C. Sorghum: An underutilized cereal whole grain with the potential to assist in the prevention of chronic disease. Food Rev. Inter. 2015, 31, 401–437. [Google Scholar] [CrossRef] [Green Version]
- Taleon, V.; Dykes, L.; Rooney, L.W. Rooney Effect of genotype and environment on flavonoid concentration and profile of black sorghum grains. J. Cereal Sci. 2012, 56, 470–475. [Google Scholar] [CrossRef]
- Griebel, S.; Web, M.M.; Campanella, O.H.; Craig, B.A.; Weil, C.F.; Tuinstra, M.R. The alkali spreading phenotype in Sorghum bicolor and its relationship to starch gelatinization. J. Cereal Sci. 2019, 86, 41–47. [Google Scholar] [CrossRef]
- Hossain, M.S.; Islam, M.N.; Rahman, M.M.; Mostofa, M.G.; Khan, M.A.R. Sorghum: A prospective crop for climatic vulnerability, food and nutritional security. J. Agri. Food Res. 2022, 8, 100300. [Google Scholar] [CrossRef]
- Soufan, W.; Okla, M.K.; Salamatullah, A.; Hayat, K.; Abdel-Maksoud, M.A.; Al-Amri, S.S. Seasonal variation in yield, nutritive value, and antioxidant capacity of leaves of alfalfa plants grown in arid climate of Saudi Arabi. Chil. J. Agri. Res. 2021, 81, 182–190. [Google Scholar] [CrossRef]
- Joshi, A.; Kaundal, B.; Raigond, P.; Singh, B.; Sethi, S.; Bhowmik, A.; Kumar, R. Low-volume procedure to determine phytate and ascorbic acid in potatoes: Standardization and analysis of Indian cultivars. J. Food Composit. Anal. 2021, 102, 103998. [Google Scholar] [CrossRef]
- Nassar, A.M.K.; Sabally, K.; Kubow, S.; Leclerc, Y.N.; Donnelly, D.J. Some canadian-grown potato cultivars contribute to a substantial content of essential dietary minerals. J. Agric. Food Chem. 2012, 60, 4688–4696. [Google Scholar] [CrossRef]
- Amombo, E.; Ashilenje, D.; Hirich, A.; Kouisni, L.; Oukarroum, A.; Ghoulam, C.; Gharous, M.E.; Nilahyane, A. Exploring the correlation between salt tolerance and yield: Research advances and perspectives for salt-tolerant forage sorghum selection and genetic improvement. Planta 2022, 255, 71. [Google Scholar] [CrossRef]
- Das, K.; Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front Environ. Sci. 2014, 2, 53. [Google Scholar] [CrossRef] [Green Version]
- Nimse, S.B.; Pal, D. Free radicals, natural antioxidants, and their reaction mechanisms. RSC Adv. 2015, 5, 27986–28006. [Google Scholar] [CrossRef] [Green Version]
- Bita, C.; Gerats, T. Plant tolerance to high temperature in a changing environment: Scientifc fundamentals and production of heat stress-tolerant crops. Front. Plant Sci. 2013, 4, 273. [Google Scholar] [CrossRef] [Green Version]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Sang, Q.Q.; Shu, S.; Shan, X.; Guo, S.R.; Sun, J. Effects of exogenous spermidine on antioxidant system of tomato seedlings exposed to high temperature stress. Russ. J. Plant Physiol. 2016, 63, 645–655. [Google Scholar] [CrossRef]
- Sharma, S.S.; Dietz, K.J. The relationship between metal toxicity and cellular redox imbalance. Trends Plant Sci. 2009, 14, 43–50. [Google Scholar] [CrossRef]
- Hossain, M.A.; Piyatida, P.; Da Silva, J.A.T.; Fujita, M. Molecular mechanism of heavy metal toxicity and tolerance in plants: Central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J. Bot. 2012, 2012, 872875. [Google Scholar] [CrossRef] [Green Version]
- Ranjan, A.; Sinha, R.; Sharma, T.R.; Pattanayak, A.; Singh, A.K. Alleviating aluminum toxicity in plants: Implications of reactive oxygen species signaling and crosstalk with other signaling pathways. Physiol. Plant. 2021, 173, 1765–1784. [Google Scholar] [CrossRef]
- Xiong, Q.; Kadota, S.; Tani, T.; Namba, T. Antioxidative effects of phenylethanoids from Cistanche deserticola. Biol. Pharm. Bull. 1996, 19, 1580–1585. [Google Scholar] [CrossRef] [Green Version]
- Ozgen, M.; Reese, R.N.; Jr Tulio, A.Z.; Scheerens, J.C.; Miller, A.R. Modified 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid(abts) method to measure antioxidant capacity of Selected small fruits and comparison to ferric reducing antioxidant power(FRAP) and 2,2′-diphenyl-1-picrylhydrazyl(DPPH) methods. J. Agri. Food Chem. 2006, 54, 1151–1157. [Google Scholar] [CrossRef] [PubMed]
- Oyaizu, M. Studies on products of browning reactions: Antioxidative activities of products of browning reaction prepared from glucosamine. Jpn. J. Nutr. 1986, 44, 307–315. [Google Scholar] [CrossRef] [Green Version]
- Appel, H.M.; Governor, H.L.; D’Ascenzo, M.; Siska, E.; Schultz, J.C. Limitations of folin assays of foliar phenolics in ecological studies. J. Chem. Ecol. 2001, 27, 761–778. [Google Scholar] [CrossRef]
- Kim, S.H.; Lee, S.Y.; Cho, S.M.; Hong, C.Y.; Park, M.J.; Choi, I.G. Evaluation on anti-fungal activity and synergy effects of essential oil and their constituents from Abies holophylla. J. Korean Wood Sci. Technol. 2016, 44, 113–123. [Google Scholar] [CrossRef] [Green Version]
- Bruno, L.B.; Karthik, C.; Ma, Y.; Kadirvelu, K.; Freitas, H.; Rajkumar, M. Amelioration of chromium and heat stresses in Sorghum bicolor by Cr6þ reducing-thermotolerant plant growth promoting bacteria. Chemosphere 2020, 244, 125521. [Google Scholar] [CrossRef]
- Ghimire, B.K.; Seo, J.W.; Yu, C.Y.; Kim, S.H.; Chung, I.M. Comparative study on seed characteristics, antioxidant activity, and total phenolic and flavonoid contents in accessions of Sorghum bicolor (L.) Moench. Molecules 2021, 26, 3964. [Google Scholar] [CrossRef] [PubMed]
- Punia, H.; Tokas, J.; Malik, A.; Sangwan, S. Characterization of phenolic compounds and antioxidant activity in Sorghum [Sorghum bicolor (L.) Moench] Grains. Cereal Res. Com. 2021, 49, 343–353. [Google Scholar] [CrossRef]
- Shen, S.; Huang, R.; Li, C.; Wu, W.; Chen, H.; Shi, J.; Chen, S.; Ye, X. Phenolic compositions and antioxidant activities differ significantly among sorghum grains with different applications. Molecules 2018, 23, 1203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, G.; Johnson, S.K.; Bornman, J.F.; Bennett, S.J.; Clarke, M.W.; Singh, V.; Fang, Z. Growth temperature and genotype both play important roles in sorghum grain phenolic composition. Sci. Rep. 2016, 6, 21835. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, S.; Bhanger, M.I. Effect of season and production location on antioxidant activity of Moringa oleifera leaves grown in Pakistan. J. Food Compos. Anal. 2006, 19, 544–551. [Google Scholar] [CrossRef]
- Pirbalouti, A.G.; Hashemi, M.; Ghahfarokhi, F.T. Essential oil and chemical compositions of wild and cultivated Thymus daenensis Celak and Thymus vulgaris L. Ind. Crops Prod. 2013, 48, 43–48. [Google Scholar] [CrossRef]
- Jugran, A.K.; Bahukhandi, A.; Dhyani, P.; Bhatt, I.D.; Rawal, R.S.; Nandi, S.K. Impact of altitudes and habitats on valerenic acid, total phenolics, flavonoids, tannins, and antioxidant activity of Valeriana jatamansi. Appl. Biochem. Biotechnol. 2016, 179, 911–926. [Google Scholar] [CrossRef]
- Olszowy, M. What is responsible for antioxidant properties of polyphenolic compounds from plants? Plant Physiol. Biochem. 2019, 144, 135–143. [Google Scholar] [CrossRef]
- Wang, M.; Zhao, H.; Wen, X.; Ho, C.T.; Li, S. Citrus flavonoids and the intestinal barrier: Interactions and effects. Compr. Rev. Food Sci. Food Saf. 2021, 20, 225–251. [Google Scholar] [CrossRef] [PubMed]
- Vanamala, J.K.; Massey, A.R.; Pinnamaneni, S.R.; Reddivari, L.; Reardon, K.F. Grain and sweet sorghum (Sorghum bicolor L. Moench) serves as a novel source of bioactive compounds for human health. Crit. Rev. Food Sci. Nutr. 2018, 58, 2867–2881. [Google Scholar] [CrossRef]
- Irondi, E.A.; Adegokea, B.M.; Effiona, E.S.; Oyewoa, S.O.; Alamuc, E.O.; Boligond, A.A. Enzymes inhibitory property, antioxidant activity and phenolics profile of raw and roasted red sorghum grains in vitro. Food Sci. Human Well. 2019, 8, 142–148. [Google Scholar] [CrossRef]
- Mulaudzi, T.; Nkuna, M.; Sias, G.; Doumbia, I.Z.; Njomo, N.; Iwuoha, E. Antioxidant capacity of chitosan on sorghum plants under salinity stress. Agriculture 2022, 12, 1544. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhai, G.; Li, X.; Tao, H.; Li, L.; He, Y.; Zhang, X.; Wang, F.; Hong, G.; Zhu, Y. Metabolomics reveals nutritional diversity among six coarse cereals and antioxidant activity analysis of grain sorghum and sweet sorghum. Antioxidants 2022, 11, 1984. [Google Scholar] [CrossRef]
- Boo, H.O.; Hwang, S.J.; Bae, C.S.; Park, S.H.; Song, W.S. Antioxidant activity according to each kind of natural plant pigments. Korean J. Plant Res. 2011, 24, 105–112. [Google Scholar] [CrossRef] [Green Version]
- McEwen, B.J. The influence of diet and nutrients on platelet function. Semin. Thromb. Hemost. 2014, 40, 214–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chun, H.C.; Jung, K.Y.; Choi, Y.D.; Lee, S.H.; Kang, H.W. The growth and yield changes of foxtail millet (Setaria italic L.), proso millet (Panicum miliaceum L.), sorghum (Sorghum bicolor L.), adzuki bean (Vigna angularis L.), and sesame (Sesamum indicum L.) as affected by excessive soil-water. Korean J. Agri. Sci. 2016, 43, 547–559. [Google Scholar]
Location | Annual Average Temperature (°C) | Annual Average Precipitation (mm) | |
---|---|---|---|
Low | High | ||
Australia, New South Wales | 16.00 | 26.00 | 863.60 |
Former Soviet Union | 8.00 | 18.50 | 488.58 |
United States, Nebraska | 2.30 | 16.60 | 882.00 |
United States, Texas | 3.80 | 35.50 | 27.25 |
United States, Virginia | −18.30 | 25.00 | 1086.00 |
Sudan, Kordofan | 23.05 | 35.79 | 104.44 |
Guadeloupe, Basse-Terre | 20.55 | 31.11 | 75.73 |
Accession No. | Color | Shape |
---|---|---|
K159041 | Brown and black | ovoid |
K159042 | Light brown and black | ovoid |
K159078 | Yellow brown | globose |
K159081 | Reddish brown | ovoid |
K159088 | Yellow brown and black | ovoid |
K159089 | Black | ovoid |
K159093 | Yellow brown | globose |
K159097 | Yellow brown and light brown | globose |
K159100 | Reddish brown and yellow brown | ovoid |
K159096 | Dark brown and yellow brown | globose |
K159048 | Ivory | globose |
K159077 | Light brown | ovoid |
Accession No. | DPPH Activity (RC50) | ABTS Activity (RC50) |
---|---|---|
K159041 | 61.01 ± 2.26 a | 536.45 ± 11.63 cd |
K159042 | 35.64 ± 1.08 a | 362.74 ± 1.91 ab |
K159078 | 582.83 ± 219.07 c | 1252.60 ± 33.84 e |
K159081 | 71.63 ± 0.56 a | 336.77 ± 24.39 ab |
K159088 | 55.56 ± 1.92 a | 430.01 ± 7.81 bc |
K159089 | 38.28 ± 1.50 a | 356.29 ± 7.05 ab |
K159093 | 43.84 ± 1.53 a | 380.56 ± 8.44 ab |
K159097 | 33.52 ± 0.70 a | 271.06 ± 13.41 a |
K159100 | 59.30 ± 1.62 a | 465.96 ± 42.51 bcd |
K159096 | 44.36 ± 0.67 a | 343.50 ± 12.07 ab |
K159048 | −289.44 ± 22.99 b | 2874.26 ± 252.45 f |
K159077 | 186.80 ± 14.33 b | 569.89 ± 25.47 d |
Accession No. | Total Phenol Contents (mg∙GAE/g) | Total Flavonoid Contents (mg∙QE/g) |
---|---|---|
K159041 | 125.71 ± 0.91 h | 17.94 ± 0.36 c |
K159042 | 231.21 ± 2.17 a | 17.17 ± 0.14 c |
K159078 | 32.14 ± 0.30 k | 16.46 ± 2.78 c |
K159081 | 147.54 ± 1.07 f | 67.71 ± 5.38 a |
K159088 | 139.08 ± 1.55 g | 21.48 ± 1.38 c |
K159089 | 199.00 ± 0.99 c | 47.04 ± 22.10 b |
K159093 | 162.39 ± 1.65 e | 17.02 ± 1.03 c |
K159097 | 216.02 ± 5.52 b | 23.72 ± 1.51 c |
K159100 | 120.60 ± 1.43 i | 22.32 ± 0.09 c |
K159096 | 182.32 ± 0.89 d | 17.00 ±0.27 c |
K159048 | 16.33 ± 0.32 l | 24.93 ± 1.08 c |
K159077 | 80.95 ± 1.73 j | 41.18 ± 5.11 b |
Accessions | Protocatechuic Acid | Caffeic Acid | p-Coumaric Acid | Ferulic Acid | Taxifolin | Naringenin |
---|---|---|---|---|---|---|
K159041 | 12.64 ± 0.11 g | 1.86 ± 0.02 f | 8.49 ± 0.43 c | 2.40 ± 0.21 b | 32.11 ± 0.07 h | ND |
K159042 | 19.54 ± 0.27 b | 3.95 ± 0.19 c | 7.83 ± 1.08 c | 1.55 ± 0.04 cd | 189.27 ± 2.61 b | 20.69 ± 0.76 b |
K159078 | 7.63 ± 0.03 j | 4.09 ± 0.09 c | 7.83 ± 1.98 c | 2.23 ± 0.08 b | 2.30 ± 0.32 j | 5.54 ± 0.33 g |
K159081 | 11.21 ± 0.16 i | 1.48 ± 0.03 g | 3.18 ± 0.05 e | 2.15 ± 0.15 b | 134.10 ± 0.71 c | ND |
K159088 | 14.63 ± 0.25 de | 4.40 ± 0.16 b | 5.94 ± 1.47 d | 2.15 ± 0.26 b | 66.27 ± 3.21 de | 1.92 ± 0.74 h |
K159089 | 21.14 ± 0.09 a | 10.37 ± 0.11 a | 8.69 ± 0.33 c | 4.21 ± 0.30 a | 19.11 ± 0.42 i | 43.93 ± 0.49 a |
K159093 | 14.37 ± 0.11 e | 2.51 ± 0.22 d | 11.27 ± 0.21 b | 2.47 ± 0.12 b | 203.67 ± 4.99 a | 14.09 ± 0.40 d |
K159097 | 12.04 ± 0.22 h | 1.24 ± 0.02 g | 22.44 ± 0.94 a | 1.43 ± 0.26 d | 61.83 ± 2.02 ef | 7.25 ± 0.24 f |
K159100 | 13.31 ± 0.83 f | 1.92 ± 0.34 f | 4.90 ± 0.60 d | 2.32 ± 0.30 b | 71.52 ± 10.52 d | ND |
K159096 | 12.14 ± 0.18 gh | 2.24 ± 0.03 e | 2.63 ± 0.14 e | 1.51 ± 0.10 cd | 59.32 ± 1.88 f | 11.95 ± 0.24 e |
K159048 | 14.90 ± 0.10 d | 4.47 ± 0.05 b | 3.03 ± 0.06 e | 1.77 ± 0.05 c | 2.36 ± 0.66 j | 17.78 ± 0.30 c |
K159077 | 16.90 ± 0.28 c | 0.46 ± 0.02 h | 2.40 ± 0.07 e | 0.86 ± 0.03 e | 51.88 ± 1.74 g | ND |
Gene Reference ID | Primer Sequence (5′ → 3′) |
---|---|
SOD | Forward: TCGAGTCAAGGCTCACGAAA Reverse: CTGGCGACTTCTTGGTCTCC |
CAT | Forward: GGCAAGTCCCACTACGTCAA Reverse: AGCTGCTCGTTCTCGTTGAA |
APX1 | Forward: AGAGCGGTCTGGTTTTGAGG Reverse: GAGCTTGAGGTGGGCTTCTT |
pp2a | Forward: AACCCGCAAAACCCCAGACTA |
Reverse: TACAGGTCGGGCTCATGGAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seo, J.W.; Ham, D.Y.; Lee, J.G.; Kim, N.Y.; Kim, M.J.; Yu, C.Y.; Seong, E.S. Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy 2023, 13, 1698. https://doi.org/10.3390/agronomy13071698
Seo JW, Ham DY, Lee JG, Kim NY, Kim MJ, Yu CY, Seong ES. Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy. 2023; 13(7):1698. https://doi.org/10.3390/agronomy13071698
Chicago/Turabian StyleSeo, Ji Won, Da Ye Ham, Jae Geun Lee, Na Young Kim, Myong Jo Kim, Chang Yeon Yu, and Eun Soo Seong. 2023. "Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe" Agronomy 13, no. 7: 1698. https://doi.org/10.3390/agronomy13071698
APA StyleSeo, J. W., Ham, D. Y., Lee, J. G., Kim, N. Y., Kim, M. J., Yu, C. Y., & Seong, E. S. (2023). Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy, 13(7), 1698. https://doi.org/10.3390/agronomy13071698