Next Article in Journal
Rare Earth Elements Transfer from Soil to Vegetables and Health Risks Associated with Vegetable Consumption in a Former Mining Area
Previous Article in Journal
Artificial Intelligence: Implications for the Agri-Food Sector
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 5
10.3390/agronomy13051398
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

H2O2 Participates in the Induction and Formation of Potato Tubers by Activating Tuberization-Related Signal Transduction Pathways

by
Chunxia Lei
1,†,
Mingwang Ye
1,†,
Canhui Li
2 and
Ming Gong
1,*
1
School of Life Sciences, Yunnan Key Laboratory of Potato Biology, Engineering Research Center of Sustainable Development and Utilization of Biomass Energy, Ministry of Education, Yunnan Normal University, Kunming 650500, China
2
Yunnan Key Laboratory of Potato Biology, Joint Academy of Potato Science, Yunnan Normal University, Kunming 650500, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2023, 13(5), 1398; https://doi.org/10.3390/agronomy13051398
Submission received: 18 April 2023 / Revised: 13 May 2023 / Accepted: 15 May 2023 / Published: 18 May 2023
(This article belongs to the Section Crop Breeding and Genetics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Reactive oxygen species (ROS), especially hydrogen peroxide, H2O2, act as signaling molecules to widely mediate growth, development, and stress response of plants. In the present study, internal ROS accumulation, effects of exogenous H2O2 treatment, the expression of the key tuberization-related genes, and the effect of knockout of Solanum tuberosum self-pruning 6A (StSP6A) on H2O2-induced tuber formation were investigated to elucidate whether and how H2O2 is involved in induction and formation of potato tubers using two diploid landraces, Solanum phureja and S. ajanhuiri. The results showed that there was a significant accumulation of ROS (including H2O2, superoxide anion, O2−, and total ROS) during tuber induction and formation in stolons/tubers, especially in the hook-like subapical part of stolons prior to tuberization, as detected by staining observation and quantitative measurement. Furthermore, exogenous H2O2 treatment significantly enhanced percentage of tuber formation. By contrast, addition of either the ROS inhibitor diphenyleneiodonium chloride (DPI) or H2O2 scavenger catalase (CAT) resulted in a decline of tuber formation. In addition, expression analysis of nine key tuberization-related genes demonstrated that the H2O2-induced tuberization could be associated with H2O2-controlled regulation of these tuberization- and signaling-pathway-related genes, especially StSP6A, which was dramatically up-regulated during the early stage of tuber induction and H2O2 treatment. When StSP6A was knocked out by CRISPR-Cas9-mediated genome editing, the tuberization frequency of StSP6A null-mutants became significantly lower at various H2O2 concentration treatments. These findings indicate that H2O2 accumulation in stolons might play an important role by acting as a signaling molecule to initiate tuber induction, H2O2-induced tuber formation is triggered by regulating the tuberization-related gene expression and activating signal transduction pathways, and StSP6A is a pivotal player in H2O2-induced tuber formation in potato.

1. Introduction

The induction and formation of potato tubers are among the most pivotal events in the tubers’ growth and development, and in the determination of their yield. These events involve the interaction of multiple environmental factors with plant hormones and signal molecules, as well as the regulations of this interaction on a large number of key genes and multiple signal transduction and metabolic pathways. The process involves a series of physiological and biochemical changes, such as changes in endogenous hormone composition, content, and their ratio, enhancement of leaf photosynthetic rate, acceleration of assimilate export, increase in sucrose and starch content, and the appearance of specific proteins at the top of stolon. A better understanding of the molecular mechanism of potato tuberization is of great significance and could provide a theoretical basis for improving potato yield and quality through precise molecular breeding in the future [1,2,3]. Potato tuberization is a complex process consisting of four successive stages: (1) stolon formation and growth; (2) the subsequent bending of the apical region into a hook; (3) swelling of the subapical part; and (4) the growing tuber [2,4]. Among the factors influencing potato tuberization, the photoperiod and temperature are the most important environmental factors, with short days (SDs) and low temperature inducing tuber formation [5,6]. In addition, potato tuber formation is controlled mainly by its genetic characteristics. In the same external environment, different varieties of potato have differential capacities to form tubers [2,3]. The development stage of potato plants is also an important factor governing tuber formation, and they must reach a certain physiological age in order to respond to the environmental cues inducing tuber formation [2,7]. Tuber formation requires precise synchronization of biochemical pathways and morphogenesis, which is regulated by specific gene expression and the production of various signaling molecules, mRNAs, specific proteins, miRNAs, plant hormones, and sugars [7]. Key genes involved in the tuberization process include Flowering locus T (FT)-like self-pruning 6A (SP6A), potato homeobox1 (POTH1), Solanum tuberosum BEL5 (StBEL5), Solanum tuberosum phytochrome B (StPHYB), Solanum tuberosum constans (StCO), and Solanum tuberosum sucrose transporter 4 (StSUT4) [5]. Photoperiod-regulated potato tuber formation is mainly controlled by the StSP6A gene [2,3]. Reactive oxygen species (ROS) play an integral role as signaling molecules in the regulation of almost all biological processes such as plant growth, development, and response to abiotic stresses and immune responses [8]. Accumulating evidence suggests that hydrogen peroxide (H2O2), a main form of ROS, can act as an important second messenger in the signal transduction pathways to mediate a variety of responses directly or indirectly, including stomatal closure, geotropism, seed germination, normal growth and development of plants, programmed cell death (PCD), and resistance to biotic and abiotic stresses [9,10,11]. H2O2 can trigger physiological, biochemical, and gene expression changes in plants to produce corresponding traits and enhance adaptability [9]. However, little is known about whether and how ROS, especially H2O2, are involved in the induction and formation of potato tubers.
In the present study, ROS accumulation was observed by histochemical staining, and H2O2 levels and the superoxide anion (O2−) production rate were measured in stolons/tubers of potato. Additionally, the effects of exogenous addition of H2O2 and the ROS inhibitor diphenyleneiodonium chloride (DPI) or H2O2 scavenger catalase (CAT) on tuber formation were evaluated. Finally, the expression of nine tuberization-related genes was detected, and the effects of knockout of the key gene StSP6A on H2O2-induced tuber formation were investigated, with the aim of revealing whether and how H2O2 is involved in the induction and formation of potato tubers.

2. Materials and Methods

2.1. Plant Materials

The aseptic seedlings of two diploid landraces CIP-149 (Solanum phureja) and CIP-178 (S. ajanhuiri) from the International Potato Center (CIP) were used as experimental materials. The stem segments with one axillary bud were cultured on solid Murashige and Skoog (MS) medium (pH 5.8) with 3% (w/v) sucrose at 25 ± 2 °C under a 16 h light photoperiod for 30 d.

2.2. Observation of the Accumulation of O2−, H2O2, and Total ROS in Stolons/Tubers during Four Stages of Tuber Formation by Histochemical Staining

Single-node seedling stems without leaves were inoculated on solid ½ MS medium containing 5.5% (w/v) sucrose under tuber-inducing conditions (in total darkness (TD) at 18 ± 2 °C) for 14 d. The top part (about 1 cm in length) of stolons/tubers, including four typical successive morphological stages of tuberization [2,4], was used for histochemical staining.
The amounts of O2− and H2O2 were assessed using the NBT (nitroblue tetrazolium chloride, BioFroxx, Guangzhou, China) and DAB (3,3ʹ-diaminobenzidine, BioFroxx, Guangzhou, China) staining methods, respectively [12,13] with minor modifications. Stolons/tubers were stained by incubating in 50 mM sodium phosphate buffer (pH 7.5) containing 0.2% (w/v) NBT for 0.5 h and DAB staining solution (1 mg/mL DAB solution in 50 mM sodium phosphate buffer, pH 3.8) for 5 h in amber-colored bottles at room temperature. The brownish-red or blue precipitate indicated the relative amounts of O2− and H2O2, respectively. Stained stolon/tuber samples were rinsed by sterile water, and all images were obtained with a dissecting microscope (Olympus, SZX7, Tokyo, Japan).
Total ROS accumulation in stolons/tubers was examined using the fluorescent probe H2DCFDA (2′,7′-dichlorodihydrofluorescein diacetate, Sigma, St. Louis, MO, USA) staining method [14] with minor modifications. Stolons/tubers were incubated in 50 µM H2DCFDA for 3 h. After rinsing with distilled water, all images were obtained with an inverted fluorescence microscope (Olympus, DP73, Tokyo, Japan).

2.3. Quantitative Determination of O2− Production Rate and H2O2 Levels in Stolons/Tubers

The O2− production rate in the tip (about 1 cm in length) of stolons/tubers during the four stages of tuber formation [2] was determined using the XTT (2,3-Bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) method [15] with minor modifications. Briefly, stolons/tubers (1 g) were ground in 3 mL of extracting solution [50 mM Tris-HCl buffer (pH 7.5), containing 1% w/v polyvinylpyrrolidone (PVP), 1 mM EDTA, 1.1 mM XTT] with a multi-sample tissue grinding machine. The extracts were centrifuged at 10,000 r·min−1 for 20 min; an aliquot of 1.5 mL of supernatant was incubated with 1.5 mL of 50 mM Tris-HCl buffer (pH 7.5) and 300 µL of XTT (final concentration of 100 µM). After reaction at 30 °C for 30 min, the absorbance at 470 nm was read with a microplate reader (Naritech Technologies, Shenzhen, China) and calculated using the molar extinction coefficient of 2.16 × 104 L mol−1 cm−1. The O2− production rate was expressed as nmol min−1·g−1 FW.
The H2O2 content was determined by the xylenol orange method [15] with some modifications. Stolons/tubers (0.5 g) were homogenized in 2 mL of cold acetone. After centrifugation at 10,000 r·min−1 for 10 min, 1 mL of the supernatant was mixed with 3 mL of extraction agent (CCl4:CHCl3 3:1, v/v). Then, 5 mL of distilled water was added to the mixture and centrifuged at 5000 r·min−1 for 1 min. The absorbance of the upper water phase was measured at 560 nm. The H2O2 content was expressed as μmol·g−1 FW.

2.4. Effects of Exogenous H2O2 and the ROS Inhibitor DPI or H2O2 Scavenger CAT Treatments on Tuber Formation

To investigate the effect of exogenous H2O2 on potato tuberization, the single-node cuttings of CIP-149 were incubated on solid ½ MS medium containing 3% (w/v) sucrose supplemented with 0 (control), 1, 5, 10, 20, 30, 50, and 100 mM H2O2 in TD at 18 ± 2 °C for 14 d. On day 14, tuberization frequency was calculated based on the percentage of tuber formation. There were 3 replicates in each treatment and 60 stem segments in each replicate. We also measured stolon length on day 14. Considering that the distance between the upper surface of the medium in the culture bottle and the cap of the bottle was 6 cm, we classified all stolons growing to the cap as >6.0 cm. Stolons smaller than 0.5 cm, as well as axillary buds that never grew, were all classified as <0.5 cm.
DPI is considered as an NADPH oxidase inhibitor and inhibits ROS production, and catalase (CAT) can break H2O2 down into H2O and O2 [16]. In the present experiments, DPI was dissolved in dimethyl sulfoxide (DMSO, BioFroxx, Guangzhou, China), and DPI solution was added into the ½ MS medium with the final concentrations of 0 (control), 10, and 20 µM. The control was appropriately treated with an equivalent amount of DMSO. Catalase (CAT, Sigma-Aldrich, St. Louis, MO, USA) was dissolved in PBS and added into the ½ MS medium with the final concentrations of 0 (control), 50, 100, 150, and 200 U mL−1. Single-stem segments of the pre-cultured plantlets of CIP-149 were cut off and planted on solid ½ MS medium containing 3% (w/v) sucrose with DPI or CAT in TD at 18 ± 2 °C. The tuberization frequency was calculated after 14 days of incubation.

2.5. Analysis of Key Tuberization-Related Genes Using RT-qPCR

Single-node explants without leaves from potato CIP-149 were used for tuber induction on solid ½ MS medium containing 3% (w/v) sucrose and supplemented with 0 (control) or 5 mM H2O2 in TD at 18 ± 2 °C for 14 d. At different time points (0, 3, 9, 12, and 16 d), tips (about 1 cm in length) of stolons/tubers were cut off, and RNA was isolated from 5 typical developmental stages of tuber formation, namely, axillary buds, slightly larger axillary buds, about 1 cm long stolon tips, swelling stolon tips, and the growing tubers (Figure 1).
Total RNA was extracted using a RNAprep Pure Plant Plus Kit (Tiangen, Beijing, China), and 800 ng total RNA was reverse-transcribed into first-strand cDNA using a PrimeScript TM RT reagent Kit (TaKaRa, Beijing, China) with gDNA Eraser. Quantitative real-time PCR (RT-qPCR) was performed in 10 µL reaction volume (1 µL template cDNA, 0.4 µL each upstream and downstream primer, 5 µL SYBR Green PCR Master Mix, and 3.2 µL ddH2O) with TB Green® Premix Ex Taq TM Π (TaKaRa, Beijing, China) on Roche Light Cycler 960 (Roche Diagnostics, Basel, Switzerland). The expression of 8 key tuberization-related genes (StSP6A, StSUT4, POTH, Solanum tuberosum calcium-dependent protein kinase1 (StCDPK1), StPHYB, StBEL5, StCO, and Solanum tuberosum GA 20-oxidase1 (Stga20ox1)) selected based on references [2,3,17,18] was determined. The plasma membrane NADPH oxidase, also known as respiratory burst oxidase homolog (Rboh), is a key enzyme for ROS production [8,9]. StRboh was also selected to evaluate the effect of ROS on potato tuberization. The reference gene L2 (cytoplasmic ribosomal protein) [19] was used to normalize target gene expression. The primers were designed using Primer3 web (https://bioinfo.ut.ee/primer3-0.4.0/, accessed on 10 May 2019). The primer sequences used for RT-qPCR are listed in Table 1. The RT-qPCR program was set up for 600 s preincubation at 95 °C, 2-step amplification of 45 cycles at 95 °C for 10 s and 55 °C for 15 s, following a 55 to 97 °C melting curve analysis at the final step. Three independent biological repetitions and three parallel reactions were conducted in RT-qPCR, and the comparative CT method (2−ΔΔCT method) was used to quantify the RT-qPCR data [20].

2.6. Construction of StSP6A Knockout Vector for Null-Mutants

2.6.1. Plasmid Construct

The binary vector pKESE401 expressing SpCas9 and intermediate vector pCBC-DT1T2 were used in this experiment as described previously [21]. The gene sequences of StSP6A of potato (gene ID: Soltu.DM.05G026370.1) were downloaded from the Spud DB database (http://solanaceae.plantbiology.msu.edu, accessed on 3 May 2020). Two 20 nt single-guide RNA sequences for StSP6A were selected using the CRISPR-P tool 2.0 (http://crispr.hzau.edu.cn/CRISPR2/, accessed on 3 May 2020), and the primers for constructed knockout vector were DT1F, TCGAAGTAGTGATTGGGTTGCATAACAACTTGTGAGTTTTAGAGCTAGAAATAGC and DT2R, TTCTAGCTCTAAAACTTCACTAGGTCTGTTGATCTCAATCTCTTAGTCGACTCTAC. DT1F and DT2R were used to amplify the pCBC-DT1T2. After purification, the PCR product was incorporated in the vector pKESE401 which was digested by BsaI using the Seamless Cloning and Assembly Kit (ClonExpress II One Step Cloning Kit, Vazyme, Nanjing, China) [22]. The constructed CRISPR/ Cas9 vector with StSP6A target sites is shown in Figure 2.

2.6.2. A. Tumefaciens Transformation of Potato

CIP-149 was used in this study, and A. tumefaciens transformation followed the protocol reported previously [21,23] with modifications as follows: after 2 days of pre-culture, the explants were co-cultured with Agrobacterium harboring pKSE401 with the target sequence for 2 days in the presence of 2 mg·L−1 α-naphthaleneacetic acid and 1 mg·L−1 trans-zeatin, and followed by callus induction mediated by 0.1 mg·L−1 α-naphthaleneacetic acid and 2 mg·L−1 trans-zeatin for 2 weeks, and regeneration mediated by 0.01 mg·L−1 α-naphthaleneacetic acid and 1 mg·L−1 trans-zeatin until shoot proliferation. Transformants were screened based on growth on the medium containing 50 mg·L−1 kanamycin. The transformants’ DNA was amplified by specific primers spanning the target sites, which were 5′-AGGCGGCATGTCTTCTAGAG-3′ and 5′-TAAACCCCTCTACCCCTCCA-3′. PCR amplicons were cloned into pBM16A Vector (Biomed, Beijing, China), then transformed into E. coli competent cells. Ten colonies were selected from each transformants’ DNA for sequencing at Sangon Biotech. Geneious 4.8.3 software was used to analysis the sequences.

2.6.3. Homozygous StSP6A Null-Mutants Were Obtained

Potato explants were infected by A. tumefaciens containing the constructed CRISPR/ Cas9 vector described above. A total of 125 transgenic plants were obtained. The target sites of each transgenic plant were sequenced with 10 clones per plant, and a total of 3 homozygous StSP6A null-mutants that displayed the same mutation type (sp6a85, sp6a107, and sp6a113) were obtained. The types of mutations are shown in Figure 2b.

2.7. H2O2 Treatments of the StSP6A Null-Mutants sp6a85, sp6a107 and sp6a113

To investigate the effect of exogenous H2O2 on potato tuberization of StSP6A null-mutants, the single-node cuttings of CIP-149 (control) and StSP6A null-mutants (sp6a85, sp6a107, and sp6a113) were incubated on solid ½ MS medium containing 3% (w/v) sucrose supplemented with 0, 5, 20, and 50 mM H2O2 in TD at 18 ± 2 °C for 14 d, and tuberization frequency was investigated.

2.8. Statistical Analysis

The statistical analyses were performed using SPSS Statistics 22. Data were analyzed by one-way analysis of variance (ANOVA) and are shown as the means ± SD of at least three replicates. Data comparisons of means were analyzed using the least significant difference (LSD) test at * p < 0.05 and ** p < 0.01 probability levels.

3. Results

3.1. Accumulation of O2−, H2O2, and Total ROS in Stolons/Tubers during Tuber Formation

NBT, DAB staining, and the H2DCFDA fluorescence probe were used to detect the accumulation of O2−, H2O2, and total ROS, respectively, in stolons/tubers during four stages of tuber formation of two potato landraces, CIP-178 and CIP-149. As shown in Figure 3a,b, the potato CIP-178 and CIP-149 clearly demonstrated four stages of tuber formation (1–4). When stolons/tubers were stained by NBT, the stolon of CIP-178 was relatively dark blue at stage 2 (hook-like shape of the subapical region, the site of tuberization); by contrast, the growing stolon, swelling tuber, and growing tubers of the other three stages (1, 3, and 4) showed less color (Figure 3a), suggesting that the accumulation of O2− occurred prior to tuber formation. The DAB staining results were similar to those obtained with NBT, and the brownish-red precipitate was slightly more abundant in the bending part of the stolon (stage 2) than the other stages (Figure 3a), suggesting H2O2 accumulation before tuber formation.
The H2DCFDA fluorescent probe can detect total ROS accumulation in plant tissues [14]. The present results showed that the brightest H2DCFDA fluorescence was observed at stage 2 of tuber formation in CIP-178 and CIP-149 (Figure 3a,b), indicating that there is total ROS accumulation in the hook-like subapical part of stolons.
In addition, as compared with CIP-178, the growing stolons and tubers of CIP-149 demonstrated a naturally dark red (Figure 3b), which interfered with the staining effect of NBT and DAB, but the overall staining results were still consistent with those in CIP-178 (Figure 3a,b). These results indicated that the accumulation of O2−, H2O2, and total ROS occurred mainly in the hook-like subapical region of stolons, and less so in the other three stages of tuber formation, indicating that transient ROS accumulation occurred before tuber formation.
Since the color of stolons and tubers in CIP-178 is close to white, and suitable for observation of histochemical staining, it is the better material for the above-mentioned staining experiment. By comparison, CIP-149 has a higher tuberization frequency than CIP-178 and was used for the following research.
To further confirm ROS accumulation during tuber formation, O2− production rate and H2O2 content in stolons/tubers were also quantitatively analyzed during the four stages of tuber formation. As shown in Figure 4a,b, a significant increase in O2− production rate and H2O2 content was found at stage 2 of tuber formation, indeed revealing that spatiotemporal specific endogenous ROS accumulation occurred during the tuber formation.

3.2. Effects of Exogenous H2O2 and the ROS Inhibitor DPI or H2O2 Scavenger CAT Treatments on Tuber Formation

Since the endogenous ROS accumulation was qualitatively and quantitatively detected in the growing stolons at stage 2 before tuber formation, H2O2, a main and more stable form of ROS, was applied to investigate its effect on tuber formation. As shown in Figure 5a,b, with the increase in exogenous H2O2 concentrations from 1 to 50 mM in the culture medium, tuberization frequency of potato plantlets increased significantly, and reached a peak at 50 mM H2O2, which was 4.21-fold higher as compared with the control without exogenous H2O2 treatment (Figure 5a). In addition, the results from phenotypic observation (Figure 5b) clearly showed that higher exogenous H2O2 concentrations of more than 5 mM could significantly inhibit the growth and height of potato plantlets, although concentrations from 10 to 50 mM H2O2 could more significantly promote tube formation (Figure 5a,b). When H2O2 concentration reached 100 mM, this treatment led to a sharp decline in tuberization frequency (Figure 5a) and severe inhibition of the growth of potato plantlets (Figure 5b). The measurements of stolon length showed that both the length and number of stolons gradually decreased with the increase in H2O2 concentration until no stolons were left at all (Figure 5c). Stolon growth was optimal in 0, 1, and 5 mM H2O2 treatments, with the proportion of stolons exceeding 6 cm accounting for more than half (64.50%, 79.44%, and 57%, respectively). The proportion of short stolons (1.0–1.5 cm, 0.5–1 cm, and <0.5 cm) gradually increased under the treatment of 10–100 mM H2O2 (Figure 5c). This may be due to the high concentration of H2O2 causing significant inhibition of the growth of potato plants.
Diphenylene iodonium (DPI) is an inhibitor of NADPH oxidase and can decrease O2−, and then finally H2O2 production, in plant cells [24,25]. When the single-node cuttings of CIP-149 were incubated on solid ½ MS medium containing 3% (w/v) sucrose supplemented with 0 (control), 10, and 20 µM DPI in TD at 18 ± 2 °C for 14 d, as shown in Figure 6, both 10 and 20 µM DPI treatments significantly inhibited tuber formation of potato CIP-149 as compared with the control without DPI treatment, and the higher concentration of DPI was associated with a greater inhibition of tuber formation (Figure 6).
CAT can break H2O2 down into H2O and O2 [26]. In the present experiment, various concentrations of CAT were added into the incubation medium to observe their effect on tuber formation of the potato CIP-149. The results indicated that 150 and 200 U mL−1 CAT can significantly decrease the percentage of tuber formation compared with the control without CAT treatment (Figure 7), and the treatments with lower CAT concentrations of 50 and 100 U mL−1 showed little effect on the tuber formation.

3.3. Expression Analysis of Key Tuberization-Related Genes during H2O2-Induced Tuber Formation

Tuber formation is a complex biological phenomenon regulated by various environmental cues, plant nutrition, and genetic characteristics. Numerous changes in gene expression are associated with morphological and physiological changes occurring during potato tuberization [3,4,17,18]. The above-mentioned results indicated that H2O2 treatment could significantly induce tuber formation (Figure 5), implying that H2O2 may lead to expression of some key tuberization-related genes acting as positive/negative regulators for tuber induction and formation. According to recent research on tuber formation [2,3,17,18], nine key tuberization-related genes were selected that were considered as inducers or repressors in potato tuber formation (Table 2), and their expression was analyzed during H2O2-treatment-induced tuber formation using RT-qPCR (Figure 8). Since the treatment with 5 mM H2O2 could significantly enhance tuberization frequency (Figure 5a) but had little effect on the growth and height of potato plantlets (Figure 5b,c), this concentration was used to detect the effect of H2O2 treatment on expression of the nine key tuberization-related genes.
The StSP6A gene is considered a key player in controlling potato tuberization [17,27,28]. During different stages of potato tuber formation (Figure 1), StSP6A expression increased dramatically (Figure 8a), especially when cultured for 12 and 16 d under tuber-inducing conditions. Furthermore, the 5 mM H2O2 treatment could significantly enhance the StSP6A expression level, especially during early stages of tuberization at 3 (slightly larger axillary buds) and 9 d (growing stolons) (Figure 1 and Figure 8a), and the expression levels were 16.14- and 149.66- fold higher than that in axillary buds (0 d), respectively, indicated that StSP6A expression plays a key role in potato tuberization and is involved in H2O2-induced tuber formation.
StCO can negatively control the expression of StSP6A by transcriptionally activating the StSP6A antagonist StSP5G and is stabilized by StPHYB and StPHYF under long days (LDs) [3]. At 3 and 12 d of H2O2 treatment, StCO expression was significantly decreased (47.68% and 32.46% of the control, respectively), suggesting that H2O2 might inhibit the expression of the StCO gene (Figure 8b).
StPHYB is a key molecule in the sensing of external cues to inhibit tuberization in LDs [5]. The level of StPHYB expression remained constant in both control and the H2O2 treatment during the 16-d period, probably because the potato plantlets were incubated in darkness (Figure 8c).
StSUT4 inhibits tuberization in potato by affecting the expression of circadian-regulated genes (e.g., StSP6A and StCO), together with inhibiting sucrose export from leaves [29]. StSUT4 expression generally continued to increase during the period monitored, but the expression was significantly decreased (42.77% of the treatment) under control conditions at day 16 (Figure 8d).
StCDPK1 is a calcium-dependent protein kinase (CDPK) in potato. In the initial stage of tuber formation, StCDPK was highly expressed in the swelling part of the stolon, where a large amount of sucrose also accumulated, indicating that sucrose may promote tuber formation by specifically inducing the expression of StCDPK [33]. The expression of StCDPK was significantly increased in both the H2O2 treatment and control during tuber initiation (at days 3 and 9) compared to 0 d. Moreover, StCDPK expression decreased after 12 and 16 d compared to days 3 and 9 regardless of the H2O2 treatment (Figure 8e).
In plants, NADPH oxidases (respiratory burst oxidase homologues, Rbohs) play a key role in ROS production [24]. It is worth mentioning that the StRboh expression increased dramatically at 9, 12, and 16 d (Figure 8f), suggesting that NADPH oxidase-mediated H2O2 production could act as an upstream signal to induce tuberization in potato.
Gibberellins (GAs) have an inhibitory effect on potato tuber formation [3]. Ga20oxidase (GA20ox1) is a key regulatory enzyme in the GA-biosynthetic pathway and is negatively correlated to tuberization [31]. The expression of the GA20oxidase gene decreased markedly in the H2O2 treatment at day 9 prior to tuber formation (Figure 8g), indicating the GA-synthesis pathway was inhibited prior to tuber formation in the H2O2 treatment.
The StBEL5-POTH1 heterodimer suppresses GA20ox1 promoter activity and lowers GA levels [32]. The StBEL5 expression showed an upward trend regardless of the H2O2 treatment over 16 days (Figure 8h). The level of POTH expression changed relatively little over time (Figure 8i).
Our gene expression results suggested that H2O2 might be a contributing factor in regulating the tuberization-related genes in potato.

3.4. Effects of H2O2 Treatment on Tuber Formation of StSP6A Null-Mutants

The above-mentioned results showed that StSP6A expression was dramatically up-regulated during induction and formation of potato tubers, and H2O2 treatment could significantly enhance the tuberization frequency (Figure 5) and StSP6A expression level (Figure 8a). To clarify the role of StSP6A in the H2O2-induced tuber formation, the StSP6A gene was knocked out by CRISPR-Cas9-mediated genome editing, and three homozygous StSP6A null-mutants (sp6a85, sp6a107, and sp6a113) were obtained. As shown in Figure 9, although exogenous H2O2 treatments significantly enhances tuber formation in the wild type (WT), the tuberization of the StSP6A null-mutants sp6a85, sp6a107, and sp6a113 was sharply inhibited regardless of the H2O2 treatment concentrations at 0, 5, 20, and 50 mM H2O2, suggesting the involvement of StSP6A in the regulation of natural tuber formation and H2O2-induced tuberization.

4. Discussion

4.1. ROS Accumulation Is Involved in Induction and Formation of Potato Tubers

ROS, especially H2O2, take part in almost all aspects of plant growth, development, and responses to various stresses [8], and exposure of plants to various environmental stresses such as drought, low temperature, and salt induces the overproduction of ROS (e.g., O2−), which are subsequently converted to H2O2 [26]. H2O2 is considered the primary ROS that acts as a second messenger involved in signaling responses to various stresses in plants [34], and H2O2 functions as a major signaling molecule that mediates the expression of some downstream target genes by modifying transcription factors [26,34]. Little is known, however, about whether and how ROS, especially H2O2, are involved in the induction and formation of potato tubers. Nonetheless, tuber formation in potato is a survival strategy to deal with an adverse growth environment [4]. In fact, some environmental factors that induce tuber formation are detrimental to plant growth, and may result in ROS accumulation.
In the present study, NBT and DAB staining and H2DCFDA fluorescence showed that there was a higher concentration of ROS in the curved part of stolons at stage 2 than that at the other three stages of tuber formation (Figure 3). Determination of O2− production rate and H2O2 levels indicated that ROS accumulation indeed occurred at stage 2 of tuber formation (Figure 4). These results demonstrated there was a transient accumulation of ROS in the subapical region of stolons prior to tuber formation. Furthermore, exogenous H2O2 treatments could significantly induce potato micro-tuberization (Figure 5), and both ROS inhibitor DPI and H2O2 scavenger CAT treatments showed a strong inhibitory effect on the tuberization (Figure 6 and Figure 7). All these results imply that ROS, especially H2O2, could act as important participants in the control of tuber induction in potato plants.

4.2. H2O2-Induced Tuberization Could Be Associated with H2O2-Controlled Regulation of These Tuberization- and Signaling-Pathway-Related Genes

Tuber induction and formation in potato are pivotal events in potato growth and development, and in the determination of its yield. These processes are influenced by the interaction among multiple environmental cues, plant hormones, and signal molecules, as well as by the regulation of a large number of key genes and signal transduction and metabolic pathways [2,3]. Furthermore, ROS, especially H2O2, can function as major signaling molecules to mediate the expression of numerous downstream genes. However, there is little documented evidence showing that H2O2 takes part in the regulation of the tuberization- and signaling-pathway-related genes during the induction and formation of potato tubers.
The StSP6A gene and the coding protein are pivotal players in the induction and formation of potato tubers. Potato tuberization has photoperiodic dependence, with short days promoting StSP6A expression and thus tuber formation [35]. Tuberization is controlled by StSP6A, which induces tuber formation under high sucrose availability [28,36]. The present results indicated that the StSP6A expression dramatically enhanced during the induction and formation of potato tubers (Figure 8a), which was in accordance with the ROS accumulation at stage 2 of tuber formation (Figure 3 and Figure 4). In addition, H2O2 treatment could significantly enhance the StSP6A expression level, especially at early stages of tuberization at 3 (slightly larger axillary buds) and 9 d (growing stolons) (Figure 1 and Figure 8a), in which H2O2 accumulation occurred (Figure 3 and Figure 4). Furthermore, knockout of the StSP6A gene by CRISPR-Cas9-mediated genome editing led to elimination of the effect of exogenous H2O2-induced tuberization in the StSP6A null-mutants sp6a85, sp6a107, and sp6a113 (Figure 9). All these results strongly suggested that StSP6A expression is deeply involved in H2O2-induced tuber formation. It is worth mentioning that there seems to be little difference in the effects of point mutations and large deletion mutations on tuber formation. However, the impact of a mutation, whether a point mutation or large deletion, depends more on its effect on the protein’s function rather than the size of the mutation itself. In fact, both types of mutations can result in similar phenotypic effects if they affect the same critical genes or pathways [37]. Regarding a specific trait such as the number of tubers, it is important to note that StSP6A is considered a key player in controlling potato tuberization [2,3,17,27,28]. In the present experiment, the three mutants, both point and large deletion mutations, could cause frameshift mutations, potentially yielding truncated, non-functional StSP6A peptides, leading to a failure of tuber formation (Figure 9). The specific mechanisms underlying these effects require further study.
Acting as a repressor of tuberization in LDs [35], StCO expression was decreased at 3 d in the early stages of tuberization in treatment compared with the control (Figure 8b).
Tuber formation is one of the multiple outputs of the photoreceptor StPHYB sensory system in potato, involving a number of regulatory factors [38]. StPHYB controls the photoperiod-dependent tuberization [3]. The present results showed that StPHYB expression remained little changed under the H2O2 treatment (Figure 8c), suggesting that potato could develop various non-photoperiod-dependent regulatory pathways to control tuber formation, in which the H2O2-mediated signaling pathway might be included.
As a key regulatory enzyme of GA biosynthesis, the StGA20oxidase expression decreased markedly under the H2O2 treatment at day 9 prior to tuber formation (Figure 1 and Figure 8g), indicating that H2O2-induced tuber formation could be regulated by inhibiting StGA20oxidase expression together with reducing the inhibitory effect of GA on tuber formation.
StRbohA and StRbohB could regulate oxidative burst in response to various stresses in potato [24]. StCDPKs were found to activate StRboh-dependent ROS production in potato [30]. The present results showed that the expression of StCDPK significantly increased during tuber initiation (at 3 and 9 d) compared to 0 d (Figure 1 and Figure 8e) and StRboh expression increased remarkably at 9 d prior to tuber formation (Figure 1 and Figure 8f), implying that the interaction between StCDPK and StRboh was positively involved in the H2O2-induced tuber formation of potato.
ROS signaling is integrated with many different signaling networks such as calcium signaling and a range of redox responses in plants. The mechanisms of interaction between gene expression and their signaling pathways during tuberization have been demonstrated [4,38,39]. In plant cells, H2O2 triggers an influx of Ca2+ ions, which is thought to be involved in H2O2 sensing and signaling [40]. CDPK is a Ser/Thr protein kinase that is activated by Ca2+ binding to EF-hand motifs of the C-terminal calmodulin-like domain and functions in biotic/abiotic stress responses [30]. Here, we suggest that the crosstalk between the oxidative burst-mediated signaling pathways and various signal transduction pathways triggered by different tuberization stimuli (darkness, low temperature, high sucrose, and phytohormones) could regulate tuberization in potato.
The above-mentioned results showed that the expression of various tuberization-related genes in stolons/tubers was enhanced or repressed in different stages of tuberization by the treatment with 5 mM H2O2, indicating H2O2 is located upstream of the tuberization-related genes and may induce tuber formation by regulating the expression of these genes. Based on the above results, we propose a possible model to illustrate changes in the expression of tuberization-related genes involved in regulating potato tuberization by treatment with 5 mM H2O2 (Figure 10).

5. Conclusions

There was a significant accumulation of ROS (including H2O2, O2−, and total ROS) during tuber induction and formation in stolons/tubers, especially in the hook-like subapical part of stolons prior to tuberization. Exogenous H2O2 treatment significantly enhanced percentage of tuber formation. The H2O2-induced tuberization could be associated with H2O2-controlled regulation of those tuberization- and signaling-pathway-related genes, especially StSP6A, which was dramatically up-regulated during early stages of tuber formation and H2O2 treatment. StSP6A knockout resulted in elimination of the effect of exogenous H2O2 -induced tuberizations. These findings indicate that H2O2 accumulation in stolons might play an important role by acting as a signaling molecule to initiate tuber induction, H2O2-induced tuber formation is triggered by regulating the tuberization-related gene expression and activating signal transduction pathways, and StSP6A is a pivotal player in H2O2-induced tuber formation in potato.

Author Contributions

M.G. conceived and supervised the study; C.L. (Chunxia Lei) and M.Y. designed and performed experiments and analyzed data; C.L. (Chunxia Lei), M.G. and M.Y. wrote the manuscript; M.G. and C.L. (Canhui Li) helped to revise the draft. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Natural Science Foundation of China (No. 32260459) and the open research program (No. YNPKF202202) of Yunnan Key Laboratory of Potato Biology, Yunnan Normal University.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Jing Yi for providing the experimental materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ye, M.; Li, C.; Gong, M. Applications and prospect of genome editing techniques in precise potato molecular breeding. Biotechnol. Bull. 2020, 36, 9–17. [Google Scholar]
  2. Lei, C.; Li, C.; Chen, Y.; Gong, M. Physiological and biochemical basis and molecular mechanism of solanum tuberosum tuberization. Biotechnol. Bull. 2022, 38, 44–57. [Google Scholar]
  3. Zierer, W.; Rüscher, D.; Sonnewald, U.; Sonnewald, S. Tuber and tuberous root development. Annu. Rev. Plant Biol. 2021, 72, 551–580. [Google Scholar] [CrossRef] [PubMed]
  4. Aksenova, N.; Konstantinova, T.; Golyanovskaya, S.; Sergeeva, L.; Romanov, G. Hormonal regulation of tuber formation in potato plants. Russ. J. Plant Physiol. 2012, 59, 451–466. [Google Scholar] [CrossRef]
  5. Dutt, S.; Manjul, A.; Raigond, P.; Singh, B.; Siddappa, S.; Bhardwaj, V.; Kawar, P.; Patil, V.; Kardile, H. Key players associated with tuberization in potato: Potential candidates for genetic engineering. Crit. Rev. Biotechnol. 2017, 37, 942–957. [Google Scholar] [CrossRef]
  6. Teo, C.; Takahashi, K.; Shimizu, K.; Shimamoto, K.; Taoka, K. Potato tuber induction is regulated by interactions between components of a tuberigen complex. Plant Cell Physiol. 2017, 58, 365–374. [Google Scholar] [CrossRef]
  7. Ševčíková, H.; Mašková, P.; Tarkowská, D.; Mašek, T.; Lipavská, H. Carbohydrates and gibberellins relationship in potato tuberization. J. Plant Physiol. 2017, 214, 53–63. [Google Scholar] [CrossRef]
  8. Castro, B.; Citterico, M.; Kimura, S.; Stevens, D.; Wrzaczek, M.; Coaker, G. Stress-induced reactive oxygen species compartmentalization, perception and signalling. Nat. Plants 2021, 7, 403–412. [Google Scholar] [CrossRef]
  9. Niu, L.; Liao, W. Hydrogen peroxide signaling in plant development and abiotic responses: Crosstalk with nitric oxide and calcium. Front. Plant Sci. 2016, 7, 230. [Google Scholar] [CrossRef]
  10. Sies, H.; Berndt, C.; Jones, D.P. Oxidative stress. Annu. Rev. Biochem. 2017, 86, 745–748. [Google Scholar] [CrossRef]
  11. Waszczak, C.; Carmody, M.; Kangasjärvi, J. Reactive oxygen species in plant signaling. Annu. Rev. Plant Biol. 2018, 69, 209–236. [Google Scholar] [CrossRef]
  12. Kim, M.; Kim, H.; Kim, Y.; Baek, K.; Oh, H.; Hahn, K.; Bae, R.; Lee, I.; Joung, H.; Jeon, J. Superoxide anion regulates plant growth and tuber development of potato. Plant Cell Rep. 2007, 26, 1717–1725. [Google Scholar] [CrossRef] [PubMed]
  13. Kumar, D.; Yusuf, M.A.; Singh, P.; Sardar, M.; Sarin, N. Histochemical detection of superoxide and H2O2 accumulation in Brassica juncea seedlings. Bio-Protocol 2014, 4, e1108. [Google Scholar] [CrossRef]
  14. Guan, B.; Lin, Z.; Liu, D.; Li, C.; Zhou, Z.; Mei, F.; Li, J.; Deng, X. Effect of waterlogging-induced autophagy on programmed cell death in Arabidopsis roots. Front. Plant Sci. 2019, 10, 1091–1103. [Google Scholar] [CrossRef] [PubMed]
  15. Li, Z.; Gong, M. Observation on heat tolerance of maize seedlings induced by heat shock and its physiological and biochemical mechanisms. In Comprehensive and Designed Experimental Course in Plant Physiology; Huazhong University of Science and Technology Publishing: Wuhan, China, 2014; pp. 81–82, 85–86. [Google Scholar]
  16. Wei, J.; Li, D.; Zhang, J.; Shan, C.; Rengel, Z.; Song, Z.; Chen, Q. Phytomelatonin receptor PMTR1—Mediated signaling regulates stomatal closure in Arabidopsis thaliana. J. Pineal Res. 2018, 65, e12500. [Google Scholar] [CrossRef]
  17. Nicolas, M.; Torres-Pérez, R.; Wahl, V.; Cruz-Oró, E.; Rodríguez-Buey, M.; Zamarreño, A.; Martín-Jouve, B.; García-Mina, J.; Oliveros, J.; Prat, S.; et al. Spatial control of potato tuberization by the TCP transcription factor BRANCHED1b. Nat. Plants 2022, 8, 281–294. [Google Scholar] [CrossRef]
  18. Park, J.; Park, S.; Kwon, S.; Shin, A.; Moon, K.; Park, J.; Cho, H.; Park, S.; Jeon, J.; Kim, H.; et al. Temporally distinct regulatory pathways coordinate thermo-responsive storage organ formation in potato. Cell Rep. 2022, 38, 110579. [Google Scholar] [CrossRef]
  19. Nicot, N.; Hausman, J.; Hoffmann, L.; Evers, D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot. 2005, 56, 2907–2914. [Google Scholar] [CrossRef] [PubMed]
  20. Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  21. Ye, M.; Peng, Z.; Tang, D.; Yang, Z.; Li, D.; Xu, Y.; Zhang, C.; Huang, S. Generation of self-compatible diploid potato by knockout of S-RNase. Nat. Plants 2018, 4, 651–654. [Google Scholar] [CrossRef]
  22. Xing, H.; Dong, L.; Wang, Z.; Zhang, H.; Han, C.; Liu, B.; Wang, X.; Chen, Q. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014, 14, 327. [Google Scholar] [CrossRef]
  23. Yang, Z.; Feng, S.; Tang, D.; Zhang, L.; Zhang, C. The mutation of a PECTATE LYASE-LIKE gene is responsible for the Yellow Margin phenotype in potato. Theor. Appl. Genet. 2020, 133, 1123–1131. [Google Scholar] [CrossRef] [PubMed]
  24. Kobayashi, M.; Kawakita, K.; Maeshima, M.; Doke, N.; Yoshioka. Hirofumi. Subcellular localization of Strboh proteins and NADPH-dependent O2−-generating activity in potato tuber tissues. J. Exp. Bot. 2006, 57, 1373–1379. [Google Scholar] [CrossRef] [PubMed]
  25. Rejeb, K.B.; Vos, D.L.-D.; Disquet, I.L.; Leprince, A.-S.; Bordenave, M.; Maldiney, R.; Jdey, A.; Abdelly, C.; Savouré, A. Hydrogen peroxide produced by NADPH oxidases increases proline accumulation during salt or mannitol stress in Arabidopsis thaliana. New Phytol. 2015, 208, 1138–1148. [Google Scholar] [CrossRef] [PubMed]
  26. Hung, S.H.; Yu, C.W.; Lin, C.H. Hydrogen peroxide functions as a stress signal in plants. Bot. Bull. Acad. Sin. 2005, 46, 1–10. [Google Scholar]
  27. Navarro, C.; Cruz-Oró, E.; Prat, S. Conserved function of FLOWERING LOCUS T (FT) homologues as signals for storage organ differentiation. Curr. Opin. Plant Biol. 2015, 23, 45–53. [Google Scholar] [CrossRef] [PubMed]
  28. Navarro, C.; Abelenda, J.A.; Cruz-Oró, E.; Cuéllar, C.A.; Tamaki, S.; Silva, J.; Shimamoto, K.; Prat, S. Control of flowering and storage organ formation in potato by FLOWERING LOCUS T. Nature 2011, 478, 119–122. [Google Scholar] [CrossRef] [PubMed]
  29. Chincinska, I.; Gier, K.; Krügel, U.; Liesche, J.; He, H.; Grimm, B.; Harren, F.; Cristescu, S.; Kühn, C. Photoperiodic regulation of the sucrose transporter StSUT4 affects the expression of circadian-regulated genes and ethylene production. Front. Plant Sci. 2013, 4, 26. [Google Scholar] [CrossRef]
  30. Kobayashi, M.; Ohura, I.; Kawakita, K.; Yokota, N.; Fujiwara, M.; Shimamoto, K.; Doke, N.; Yoshioka, H. Calcium-dependent protein kinases regulate the production of reactive oxygen species by potato NADPH oxidase. Plant Cell 2007, 19, 1065–1080. [Google Scholar] [CrossRef]
  31. Kloosterman, B.; Navarro, C.; Bijsterbosch, G.; Lange, T.; Prat, S.; Visser, R.; Bachem, C. StGA2ox1 is induced prior to stolon swelling and controls GA levels during potato tuber development. Plant J. 2007, 52, 362–373. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, H.; Banerjee, A.K.; Hannapel, D.J. The tandem complex of BEL and KNOX partners is required for transcriptional repression of ga20ox1. Plant J. 2004, 38, 276–284. [Google Scholar] [CrossRef]
  33. Raices, M.; Ulloa, R.; Macintosh, G.; Crespi, M.; Téllez-Iñón, M. StCDPK1 is expressed in potato stolon tips and is induced by high sucrose concentration. J. Exp. Bot. 2003, 54, 2589–2591. [Google Scholar] [CrossRef] [PubMed]
  34. Choudhury, S.; Panda, P.; Sahoo, L.; Panda, S. Reactive oxygen species signaling in plants under abiotic stress. Plant Signal. Behav. 2013, 8, e23681. [Google Scholar] [CrossRef] [PubMed]
  35. Abelenda, J.; Cruz-Oró, E.; Franco-Zorrilla, J.; Prat, S. Potato StCONSTANS-like1 suppresses storage organ formation by directly activating the FT-like StSP5G repressor. Curr. Biol. 2016, 26, 872–881. [Google Scholar] [CrossRef]
  36. Abelenda, J.A.; Bergonzi, S.; Oortwijn, M.; Sonnewald, S.; Du, M.; Visser, R.G.F.; Sonnewald, U.; Bachem, C.W.B. Source-sink regulation is mediated by interaction of an FT homolog with a sweet protein in potato. Curr. Biol. 2019, 29, 1178–1186. [Google Scholar] [CrossRef]
  37. Schreiber, M.; Stein, N.; Mascher, M. Genomic approaches for studying cropevolution. Genome Biol. 2018, 19, 140. [Google Scholar] [CrossRef] [PubMed]
  38. Sarkar, D. The signal transduction pathways controlling in planta tuberization in potato: An emerging synthesis. Plant Cell Rep. 2008, 27, 1–8. [Google Scholar] [CrossRef]
  39. Kloosterman, B.; Vorst, O.; Hall, R.; Visser, R.; Bachem, C. Tuber on a chip: Differential gene expression during potato tuber development. Plant Biotechnol. J. 2005, 3, 505–519. [Google Scholar] [CrossRef]
  40. Wu, F.; Chi, Y.; Jiang, Z.; Xu, Y.; Xie, L.; Huang, F.; Wan, D.; Ni, J.; Yuan, F.; Wu, X.; et al. Hydrogen peroxide sensor HPCA1 is an LRR receptor kinase in Arabidopsis. Nature 2020, 578, 577–581. [Google Scholar] [CrossRef]
Agronomy 13 01398 g001 550
Figure 1. Plant materials at different stages of potato tuber formation were harvested for RNA extraction at 5 time points, ranging from axillary buds (0 d), slightly larger axillary buds (3 d), about 1 cm long stolon tips (9 d), swelling stolon tips (12 d), and the growing tubers (16 d). On the left: CIP-149 seedling from tissue culture.
Figure 1. Plant materials at different stages of potato tuber formation were harvested for RNA extraction at 5 time points, ranging from axillary buds (0 d), slightly larger axillary buds (3 d), about 1 cm long stolon tips (9 d), swelling stolon tips (12 d), and the growing tubers (16 d). On the left: CIP-149 seedling from tissue culture.
Agronomy 13 01398 g001
Agronomy 13 01398 g002 550
Figure 2. The schematic diagram of StSP6A mutation patterns in transgenic lines. (a) The schematic diagram of StSP6A with target sites. Two gRNAs sequence are underlined by black lines, and PAMs are marked by red lines. (b) The StSP6A mutation patterns in transgenic lines. All transgenic lines are followed by a description for the mutation type: i = insertion and d = deletion. The number associated with i and d indicates the number of base pair changes. Insertion is shown in green letters (G, A, C, T), and deletion is indicated by a green “-”.
Figure 2. The schematic diagram of StSP6A mutation patterns in transgenic lines. (a) The schematic diagram of StSP6A with target sites. Two gRNAs sequence are underlined by black lines, and PAMs are marked by red lines. (b) The StSP6A mutation patterns in transgenic lines. All transgenic lines are followed by a description for the mutation type: i = insertion and d = deletion. The number associated with i and d indicates the number of base pair changes. Insertion is shown in green letters (G, A, C, T), and deletion is indicated by a green “-”.
Agronomy 13 01398 g002
Agronomy 13 01398 g003 550
Figure 3. Observation of O2−, H2O2, and total ROS accumulation in four stages of tuber formation (1–4) of two potato landraces, CIP-178 (a) and CIP-149 (b). Growing stolon tips and tubers were stained by NBT or DAB, and the H2DCFDA fluorescent probe. The navy-blue precipitate denotes the relative amount of O2− in the NBT-stained group, the brownish-red precipitate indicates the relative amount of H2O2 in the DAB-stained group, and the fluorescence intensity of H2DCFDA shows the total ROS accumulation in the H2DCFDA-treated group. The images of unstained, NBT, and DAB rows were obtained with a dissecting microscope. The images of H2DCFDA rows were obtained with an inverted fluorescence microscope, and these images were incorporated to generate these whole-stolon/tuber images. Arrows indicate the most heavily stained areas in stage 2.
Figure 3. Observation of O2−, H2O2, and total ROS accumulation in four stages of tuber formation (1–4) of two potato landraces, CIP-178 (a) and CIP-149 (b). Growing stolon tips and tubers were stained by NBT or DAB, and the H2DCFDA fluorescent probe. The navy-blue precipitate denotes the relative amount of O2− in the NBT-stained group, the brownish-red precipitate indicates the relative amount of H2O2 in the DAB-stained group, and the fluorescence intensity of H2DCFDA shows the total ROS accumulation in the H2DCFDA-treated group. The images of unstained, NBT, and DAB rows were obtained with a dissecting microscope. The images of H2DCFDA rows were obtained with an inverted fluorescence microscope, and these images were incorporated to generate these whole-stolon/tuber images. Arrows indicate the most heavily stained areas in stage 2.
Agronomy 13 01398 g003
Agronomy 13 01398 g004 550
Figure 4. O2− production rate (a) and H2O2 content (b) in stolons/tubers during four stages (1–4) of tuber formation of the potato CIP-178. Different letters indicate significant differences according to the LSD test at p < 0.05.
Figure 4. O2− production rate (a) and H2O2 content (b) in stolons/tubers during four stages (1–4) of tuber formation of the potato CIP-178. Different letters indicate significant differences according to the LSD test at p < 0.05.
Agronomy 13 01398 g004
Agronomy 13 01398 g005 550
Figure 5. Effects of exogenous H2O2 treatments on tuberization frequency (a), growth phenotype (b), and variation in stolon length (c) of CIP-149 potato plantlets. Different letters indicate significant differences according to the LSD test at p < 0.05.
Figure 5. Effects of exogenous H2O2 treatments on tuberization frequency (a), growth phenotype (b), and variation in stolon length (c) of CIP-149 potato plantlets. Different letters indicate significant differences according to the LSD test at p < 0.05.
Agronomy 13 01398 g005
Agronomy 13 01398 g006 550
Figure 6. Effects of different concentrations of DPI (0, 10, and 20 µM) on tuber formation of the potato CIP-149. ** represent statistical differences between the control and treatment at the p < 0.01 probability levels.
Figure 6. Effects of different concentrations of DPI (0, 10, and 20 µM) on tuber formation of the potato CIP-149. ** represent statistical differences between the control and treatment at the p < 0.01 probability levels.
Agronomy 13 01398 g006
Agronomy 13 01398 g007 550
Figure 7. Effects of different concentrations of CAT (0, 50, 100, 150, and 200 U mL−1) on tuber formation of the potato CIP-149. * and ** represent statistical differences between the control and treatment at the p < 0.05 and p < 0.01 probability levels, respectively.
Figure 7. Effects of different concentrations of CAT (0, 50, 100, 150, and 200 U mL−1) on tuber formation of the potato CIP-149. * and ** represent statistical differences between the control and treatment at the p < 0.05 and p < 0.01 probability levels, respectively.
Agronomy 13 01398 g007
Agronomy 13 01398 g008 550
Figure 8. Expression analysis of 9 tuberization-related genes (a–i) using RT-qPCR during tuber induction and formation in potato explants grown in the medium with 0 (control) or 5 mM H2O2 at 0, 3, 9, 12, and 16 d of incubation in darkness. (a) StSP6A; (b) StCO; (c) StPHYB; (d) StSUT4; (e) StCDPK; (f) StRboh; (g) StGA20ox1; (h) StBEL5; (i) POTH. * and ** represent statistical differences between the control and treatment at the p < 0.05 and p < 0.01 probability levels, respectively.
Figure 8. Expression analysis of 9 tuberization-related genes (a–i) using RT-qPCR during tuber induction and formation in potato explants grown in the medium with 0 (control) or 5 mM H2O2 at 0, 3, 9, 12, and 16 d of incubation in darkness. (a) StSP6A; (b) StCO; (c) StPHYB; (d) StSUT4; (e) StCDPK; (f) StRboh; (g) StGA20ox1; (h) StBEL5; (i) POTH. * and ** represent statistical differences between the control and treatment at the p < 0.05 and p < 0.01 probability levels, respectively.
Agronomy 13 01398 g008
Agronomy 13 01398 g009 550
Figure 9. Effects of different concentrations of H2O2 (0, 5, 20, and 50 mM) on tuber formation in WT and StSP6A null-mutants of the potato CIP-149. (a) Tuberization frequency of WT and the StSP6A null-mutants (sp6a85, sp6a107, and sp6a113) under different concentrations of H2O2 treatments. (b) Phenotypical observation of effects of different concentrations of H2O2 treatment on tuber formation in WT and the StSP6A null-mutant sp6a85. ** represent statistical differences between WT and the StSP6A null-mutants (sp6a85, sp6a107, and sp6a113) at the p < 0.01 probability levels.
Figure 9. Effects of different concentrations of H2O2 (0, 5, 20, and 50 mM) on tuber formation in WT and StSP6A null-mutants of the potato CIP-149. (a) Tuberization frequency of WT and the StSP6A null-mutants (sp6a85, sp6a107, and sp6a113) under different concentrations of H2O2 treatments. (b) Phenotypical observation of effects of different concentrations of H2O2 treatment on tuber formation in WT and the StSP6A null-mutant sp6a85. ** represent statistical differences between WT and the StSP6A null-mutants (sp6a85, sp6a107, and sp6a113) at the p < 0.01 probability levels.
Agronomy 13 01398 g009
Agronomy 13 01398 g010 550
Figure 10. A possible model for the H2O2-induced tuber formation in potato by activating the tuberization-related signal transduction pathways. Red marks indicate the genes with up-regulated expression, whereas blue marks represent the genes that are down-regulated or whose expression remained unchanged during induction and formation of potato tubers.
Figure 10. A possible model for the H2O2-induced tuber formation in potato by activating the tuberization-related signal transduction pathways. Red marks indicate the genes with up-regulated expression, whereas blue marks represent the genes that are down-regulated or whose expression remained unchanged during induction and formation of potato tubers.
Agronomy 13 01398 g010
Table
Table 1. Primer sequences of target genes and reference gene for RT-qPCR.
Table 1. Primer sequences of target genes and reference gene for RT-qPCR.
Gene NameGene IDForward Primer (5′→3′)Reverse Primer (5′→3′)
StSP6ASoltu.DM.05G026370.1AGGGTTCATATTGGAGGGGACTGCTGGGATATCTGTGACCA
StSUT4Soltu.DM.04G031670.2TGCTGCGCTGGTTGTATTTTGGGAACACAATTGCCAGGTT
POTHSoltu.DM.05G009240.1AGCTTTGATGTCACCGGAGACGGATCCAAACATCATCGGA
StCDPK1Soltu.DM.03G021780.1GCTTTGAAGGCAACAGATTTGAGCAGCAGAAATACG
StPHYBSoltu.DM.01G019510.1CCCAATCCTCTGATCCCTCCTCTCCCCTCTAGACCAACCA
StBEL5Soltu.DM.06G029500.1TGGTGGTGGTGAAAGTAGCAACCTTTGCTCCACCTCTTCA
StCOSoltu.DM.02G030260.1CCAACCGCAACAACAACAACACACTGACATCCATCGACGA
Stga20ox1Soltu.DM.03G016400.1CACCATGTCAGAAACCGGAGAACTTGAAGTCCGCCAACAC
StrbohSoltu.DM.08G028440.1TGGCTTAGAATATGGGAGGGGCCATGATTGTCTGTCCTTT
L239816659GGCGAAATGGGTCGTGTTATCATTTCTCTCGCCGAAATCG
Table
Table 2. The tuberization-related genes selected for expression analysis using RT-qPCR.
Table 2. The tuberization-related genes selected for expression analysis using RT-qPCR.
Gene NameFunctionEffect on TuberizationReferences
StSP6ATriggering tuberizationInduction[27]
StCORepresses StSP6A gene expression in LDsRepression[28]
StPHYBPerception of external cuesRepression[5]
StSUT4Inhibits sucrose export from leavesRepression[29]
StCDPKHighly expressed in the swelling part of stolonInduction[30]
StRbohRegulates intracellular ROS productionUnknown[24]
StGA20ox1Encodes a key enzyme in the GA biosynthetic pathwayRepression[31]
StBEL5StBEL5-POTH1 heterodimer can lower endogenous GAs in potatoInduction[32]
POTHInduction[32]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lei, C.; Ye, M.; Li, C.; Gong, M. H2O2 Participates in the Induction and Formation of Potato Tubers by Activating Tuberization-Related Signal Transduction Pathways. Agronomy 2023, 13, 1398. https://doi.org/10.3390/agronomy13051398

AMA Style

Lei C, Ye M, Li C, Gong M. H2O2 Participates in the Induction and Formation of Potato Tubers by Activating Tuberization-Related Signal Transduction Pathways. Agronomy. 2023; 13(5):1398. https://doi.org/10.3390/agronomy13051398

Chicago/Turabian Style

Lei, Chunxia, Mingwang Ye, Canhui Li, and Ming Gong. 2023. "H2O2 Participates in the Induction and Formation of Potato Tubers by Activating Tuberization-Related Signal Transduction Pathways" Agronomy 13, no. 5: 1398. https://doi.org/10.3390/agronomy13051398

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop