Next Article in Journal
Hyphantria cunea (Drury) Showed a Stronger Oviposition Preference for Native Plants after Invading the Subtropical Region of China
Previous Article in Journal
Integrated Pathogen Management in Stevia Using Anaerobic Soil Disinfestation Combined with Different Fungicide Programs in USA, Mexico, and Paraguay
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of STARP Marker Platform for Flexible SNP Genotyping in Sugarbeet

1
Department of Plant Sciences, North Dakota State University, Fargo, ND 58102, USA
2
USDA-ARS, Edward T. Schafer Agricultural Research Center, Sugarbeet & Potato Research Unit, Fargo, ND 58102, USA
3
USDA-ARS, Edward T. Schafer Agricultural Research Center, Cereal Crops Research Unit, Fargo, ND 58102, USA
4
USDA-ARS, Crop Improvement and Genetics Research Unit, Western Regional Research Center, Albany, CA 94710, USA
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(5), 1359; https://doi.org/10.3390/agronomy13051359
Submission received: 25 April 2023 / Revised: 8 May 2023 / Accepted: 11 May 2023 / Published: 12 May 2023
(This article belongs to the Section Crop Breeding and Genetics)

Abstract

Single nucleotide polymorphisms (SNPs) have been widely used for gene identification. Allelic discrimination for an individual SNP with high reliability and flexibility is critical for the accurate detection of beneficial genes linked to specific SNP sites. Several SNP genotyping platforms have been developed but most exclusively rely on fluorescence signals for allelic differentiation. Genotyping via a fluorescence signal can have a lower accuracy if strong background signal noise is present, a common challenge associated with crop genetics. The semi-thermal asymmetric reverse PCR (STARP) marker system introduces extra SNPs in its forward primers to ensure specificity of the PCR reaction and adds a 4-nucleotide insertion into one universal primer to create fragment length polymorphism among STARP markers, which makes SNP allelic discrimination possible through either fluorescence signals or traditional gel electrophoresis. The STARP marker system is preferable for SNP genotyping in crops such as sugarbeet (Beta vulgaris ssp. Vulgaris L.) that exhibit strong background signal noise during PCR reactions due to an abundant repetitive sequence and high levels of heterozygosity in the genome. In this study, SNPs among sugarbeet lines were detected through genotype-by-sequencing (GBS) and confirmed by sequencing PCR products containing SNP sites. STARP primers were designed, and they generated STARP markers clearly discriminated by SNP alleles among sugarbeet plants either through a fluorescence signal or fragment length polymorphism. In addition, by prolonging 5-nucleotide in an allele-specific forward primer F2 that increased fragment length polymorphism of STARP markers from 4-bp to 9-bp, genotyping individual SNPs can be performed using user-friendly agarose gels. This research resulted in the development of a STARP marker platform for the flexible genotyping of individual SNPs of sugarbeet as well as an improved STARP technique for easy SNP allelic discrimination that also has utilities in other plant species.

1. Introduction

Single nucleotide polymorphisms (SNPs) are distributed in the genome of every organism. Due to their abundance, locus specificity and co-dominant inheritance, SNPs are widely used in genetic diversity analysis, gene mapping, gene discovery, genome-wide association studies, genomic prediction, and selection in breeding [1,2]. Advances in SNP detection techniques such as DNA microarray [3], fluorescent probe hybridization [4], and DNA sequencing [5] accelerated high-throughput SNP detection, and greatly reduced the cost of SNP identification further enabling SNPs to be widely applied in genetic studies, medicinal applications, and plant breeding. The utility, efficiency, and cost effectiveness of SNPs has led to a high demand for the flexible genotyping of individual SNPs with high precision and high throughput at a lower cost in genetic research and breeding.
To date, several platforms for genotyping individual SNPs have been developed, such as TaqMan [6], Kompetitive Allele Specific PCR (KASP) [7,8], RNase H2 enzyme-based amplification (rhAmp) [9,10], and semi-thermal asymmetric reverse PCR (STARP) [11]. TaqMan is the earliest platform widely used for genotyping individual SNPs, small insertions/deletions (INDELs), and presence/absence variants [6], but it is expensive and less flexible in terms of the assay design [12]. KASP aims to reduce cost and improve genotyping efficiency. The allele-specific primer design in KASP is much simpler than in TaqMan, leading to KASP being widely used in individual SNP genotyping across species [7,13]. SNP genotyping with rhAmp involves a target-specific primer activation followed by extension using a novel mutant Taq DNA polymerase that provides improved mismatch recognition [10], reduces primer dimer formation, and improves the specificity of the PCR reaction [14]. Unlike the three genotyping platforms mentioned above that exclusively rely on fluorescence signals to discriminate SNP alleles, the STARP marker system uses either fluorescence or fragment length polymorphism to genotype individual SNPs. This feature allows STARP to be flexibly adapted to different laboratory settings [11]. Moreover, using fragment length polymorphism for allelic discrimination will have a better accuracy since it is less affected by the variation of signal intensity or background signal noise due to PCR products from non-target amplifications. To date, STARP markers have been successfully used for genetic analysis in barley [15], common bean [16], potato [17], sunflower [18], and wheat [19].
The STARP marker system has a unique primer design that uses two universal priming element adjustable (PEA) primers (universal forward primers), two asymmetrically modified allele-specific (AMAS) primers (allelic specific forward primers), and one common reverse primer. The two-step PCR reaction in the STARP system includes the initial reaction using AMAS primers and the common reverse primer using genomic DNA as templates, followed by a second amplification with PEA primers and the common reverse primers using products from initial PCR amplification as the templates. PCR products from the second amplification are STARP markers to be used for allelic discrimination [11]. When designing two allele-specific forward primers for SNP genotyping, two additional SNPs are manually introduced between the two primers at the sites of the 3rd and 4th bases counted from the 3′- termini of the primers. These artificial mismatches increase the binding specificity of allele-specific forward primers to the corresponding SNP alleles during the initial PCR amplification. The two universal PEA primers are labeled with two different fluorescence dyes and thus enable allelic differentiation depending on the fluorescence intensity of STARP markers. For non-fluorescence-based SNP detection, one universal primer PEA2 carries a 4-bp insertion that allows allelic variants to be detected using conventional gel electrophoresis to separate STARP markers [11]. The universal PEA primers can be used for different species without the need to add any other reagents, reducing the cost of STARP-based genotyping for applications interested in multiple species. Therefore, STARP is a flexible, accurate, and cost-effective genotyping assay for individual SNPs in different species.
Sugarbeet (Beta vulgaris ssp. vulgaris L., 2n = 18) is a biennial root crop that flourishes in temperate climates and is grown commercially for sugar production. Sugarbeet has a haploid genome size of 758 Mb [20] with over 40% of the sugarbeet genome sequences being repetitive and high levels of heterozygosity due to the open-pollination nature of sugarbeet [21]. The complexity of the sugarbeet genome often leads to off-target PCR amplification that complicates allelic discrimination accuracy by comparison of fluorescence density due to background signal interference. The ability to differentiate and cross-validate individual SNPs using fragment length polymorphism in the STARP marker system overcomes the genotyping challenges inherent to the sugarbeet genome. In this research, we designed STARP markers based on sugarbeet SNPs and validated their applicability in sugarbeet genetics. Furthermore, we optimized the STARP marker to be more polymorphic enabling allelic discrimination using user-friendly agarose gels, increasing the accessibility of the STARP marker system for low-cost non-florescent based genotyping.

2. Materials and Methods

2.1. Plant Materials

Eleven sugarbeet lines were used in this research including F1024 (resistant to sugarbeet root maggot) [22], F1028 (relatively low amino-nitrogen concentration in root) [23], F1029 (relatively high amino-nitrogen concentration in root) [23], F1056 (low storage respiration rate), and F1057 (high storage respiration rate) [24] which were released by the sugarbeet genetics program in USDA-ARS (US Department of Agriculture–Agriculture Research Service) in Fargo, ND. Additionally, L19 and L29 (high sugar content in both lines) released by the discontinued USDA-ARS sugarbeet breeding program in Logan, UT [25], CR933 (carrying Rz1 for resistance to rhizomania) released by the discontinued USDA-ARS sugarbeet breeding program in Salinas, CA [25], SP8030-0 (resistant to Cercospora leaf spot and Aphanomyces root rot) released by the USDA-ARS sugarbeet program in Beltsville, MD [25], and FC1019 (carrying the Rz1 gene) and FC1740 (carrying both Rz1 and Rz2 genes) from the USDA-ARS sugarbeet genetics program at Fort Collins, CO [25] were utilized. To make crosses, F1024 was manually emasculated by removing anthers before the stage of pollen shading and then fertilized with the pollen of the other ten lines. Additional crosses were made between lines F1056 and F1057, F1057 and L29, and F1028 and F1029. A total of 120 manually pollinated seeds were obtained from all crosses. The derived hybrids, along with their parental lines, were used for testing the efficacy of STARP markers in discriminating SNP alleles among sugarbeet lines.

2.2. Identification and Validation of SNPs among Sugarbeet Lines

Seeds from all crosses and parental lines were germinated using 1% hydrogen peroxide solution [26] and seedlings were transplanted into pots containing potting soil (PRO-MIX, Quakertown, PA, USA) in greenhouse rooms maintained at 20–30 °C and supplemented with artificial light for a 16 h photoperiod. After the four-leaf stage, approximately 0.1 g of fresh leaf tissue from every single plant of crosses and parental lines was collected and freeze-dried in a Virtis Freezemobile 35EL (SP Scientific, Inc., Warminster, PA, USA) for 48 h. Of these eleven sugarbeet parental lines, eight plants of F1024, two of F1057, and one each of the remaining lines that were used as parents of crosses were used for SNP identification through GPS. Dried tissues from each plant were ground separately using a 1600 MiniG SPEX homogenizer (SPEX, Inc., Metuchen, NJ, USA), and DNA from each plant was extracted using a KingFisher Flex DNA purification system (KingFisher, Inc., Falls Church, VA, USA). Restriction enzymes Nsil and Bfal were used to produce DNA fragments followed by ligating barcoded adapters and preparing libraries for GBS (genotype by sequencing) by PCR amplification of barcode-ligated DNA [27]. An Illumina HiSeq 2000 sequencing system (Illumina, Inc., San Diego, CA, USA) was used to sequence 150 bp paired-end libraries, and sequencing reads were aligned to the sugarbeet reference genome assembly EL10.2 [28] to identify SNPs using the reference-based Tassel pipeline [29].
A total of 12 SNPs indicated to be homozygous by the GBS data in all the lines were randomly selected and validated by Sanger sequencing for STARP marker development. For SNP validation, about 300–500 bp from both sides of each SNP were extracted according to the reference genome [28], and 12 pairs of PCR primers were designed using the online primer design tool Primer3web v 4.1.0 [30] to amplify regions spanning around 700 bp in the corresponding sugarbeet lines (Table S1). Sequences of PCR primers were BLAST searched against the sugarbeet genome [31] to make sure they amplify unique single-band PCR products from the target regions.
PCR reactions for amplifying regions containing SNPs were conducted in a total volume of 15 µL with reaction mixtures including 1 µL DNA template [20–50 ng/µL], 0.3 µL dNTPs [25 mM], 0.9 µL MgCl2 [25 mM], 1.5 µL 10× buffer, 0.375 µL for each of the forward and reverse primers at 10 µM, 1 unit of Taq DNA polymerase, and ddH2O to make up to the total volume. PCR conditions started with an initial 95 °C for 5 min, followed by 34 cycles of each including 95 °C for 1 min, 52–56 °C for 1 min, and 72 °C for 1 min, a final extension at 72 °C for 8 min, and then 4 °C forever. PCR products were checked using 1% agarose gel to ensure a single band from each primer combination. PCR products were treated using the Exo-CIP™ Rapid PCR Cleanup Kit (New England Biolabs Inc., Ipswich, MA, USA) to degrade residual primers and dephosphorylate excess dNTPs, and then sequenced by Eurofins Genomics LLC (Louisville, KY, USA). Allelic sequences were compared to confirm the SNPs identified by GBS.

2.3. STARP Primer Design and PCR Reaction

STARP allele-specific primers for each confirmed SNP were designed according to Long et al. (2017) [11], and primer sequences were BLAST searched against the whole genome [31] to test if the primers were specific to target regions. All STARP primers, including universal primers PEA1 labeled with FAM (FAM-AGCTGGTT-Sp9-GCAACAGGAACCAGC-T(Dabsyl)-ATGAC) and PEA2 labeled with HEX (HEX-ACTGCTCA-Sp9-GACGCAAGTGAGCAG-T(Dabsyl)-ATGAC) [11], were synthesized by Integrated DNA Technologies (IDT), Inc. (Ann Arbor, MI, USA). STARP PCR reactions were conducted in a total volume of 10 µL system including 2 µL DNA template [20–50 ng/µL], 0.9 µL NH4+ buffer (16 mM (NH4)2SO4 and 67 mM Tris–HCl, pH 8.3 at 25 °C), 1.6 µL betaine [5 M], 0.4 µL bovine serum albumin (BSA) [0.04%], 0.6 µL MgCl2 [25 mM], 0.2 µL dNTP mix [10 mM], 0.2 µL common reverse primer [10 µM], 0.2 µL of each universal PEA primers [10 µM], 0.04 µL of each allele-specific primers [10 µM], 1 unit of Taq DNA polymerase, and ddH2O to make up to the total volume. The PCR reaction was performed with an initial denaturation at 94 °C for 3 min, followed by 6 cycles of a 2-step touchdown PCR program starting at 94 °C for 20 s and then (55~60) °C (determined as 5 °C below the Tm value of allelic specific primers) for 2 min, with the annealing/extension temperature (Ta/e) being decreased by 1 °C per cycle. Following the touchdown PCR program is another 2-step PCR program of 40 cycles at 94 °C for 20 s and then 62 °C for 2 min, followed by a final extension step at 62 °C for 2 min. For detecting STARP markers, a 6% polyacrylamide gel electrophoresis (PAGE) was run at consistent 30 Watts for 1.5 h in 1× TBE buffer and then scanned using a GE typhoon gel scanner (GE Healthcare, Chicago, IL, USA) for detecting fragment length polymorphisms, and a Bio-Rad CFX96 real-time PCR (Bio-Rad Laboratories, Inc., Hercules, CA, USA) to scan PCR products and then the computer program CFX Maestro v.1.1 for comparing the color intensity of fluorescence signals.

2.4. Improvement of STARP Marker Polymorphism

To improve STARP marker fragment length polymorphism so they are better detectable using agarose gels, the allele-specific primer containing the tail sequence corresponding to that of the PEA2 primer that contained a 4-nucleotide insertion was lengthened by five nucleotides on the 5′-end, which increased the fragment length polymorphism to 9-bp for target STARP markers between sugarbeet lines that carried different SNP alleles. The PCR reaction conditions using a prolonged allele-specific primer were mostly unchanged, except for the annealing temperature in the touchdown PCR program which was increased by 1–3 °C according to the Tm value change in those primers. The STARP PCR products were loaded to 1.5%, 2%, and 3% agarose gels containing 0.005% SYBR® Safe staining dye and ran at consistent 60 Volts for 1.5–2 h, and gel images were obtained using a ChemiDoc MP image system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

3. Results

3.1. SNP Identification in Eleven Sugarbeet Lines through GBS

A total of 137,439 SNPs were identified with the GBS data from 19 plants from 11 sugarbeet lines. After removing SNPs with a missing data rate greater than 20% and those that were segregating only among plants within F1024 or F1057, a set of 60,639 high confidence SNPs were selected for further analysis. Sequence alignment to the sugarbeet reference genome EL10.2 [27] indicated these SNPs were distributed on all nine chromosomes. The maximum number of SNPs were assigned to chromosomes 6 (8604, 14.2%) and 5 (8320, 13.7%), while the minimum number of SNPs were mapped to chromosome 1 (5409, 8.9%) (Table 1). Markers were observed to effectively cover 562.1 Mb of the EL10.2 genome (580 Mb total) with an average SNP density of 9.3 kb/marker. Given the saturation and distribution of markers along each of the chromosomes of the EL10.2 reference genome, the GBS data provided sufficient SNPs for validating and developing STARP markers in sugarbeet.

3.2. Validation of SNPs for STARP Marker Development

From the high confidence SNPs obtained through GBS, 12 SNPs that were homozygous in all sugarbeet lines were selected for validation to develop STARP markers (Table S1). All PCR products amplified from regions containing each selected SNP site showed a single band, indicating that all PCR reactions were highly specific (Figure 1). By comparing the sequences of the PCR products among sugarbeet lines, we found eight SNPs that were consistent with those called from the GBS data. Among these, four SNPs (SNP1, SNP2, SNP9, and SNP10) were polymorphic between F1024 and other sugarbeet lines, three SNPs (SNP4, SNP5, and SNP6) were polymorphic between F1056 and other lines, and one SNP (SNP11) was polymorphic among the lines F1028, F1029, SP8030-0, and FC1740 (Table 2). However, three SNPs (SNP3, SNP7 and SNP12) could not be verified due to the failure of DNA sequencing. Additionally, SNP8 was found to be a false positive in the target region among sugarbeet lines (Table 2).

3.3. Development of STARP Markers for Genotyping Individual SNPs

Six out of eight validated SNPs were selected for STARP marker development. Table 3 lists all allele-specific forward primers and the common reverse primers that were designed based on sequences containing the validated SNPs following the methods described in Long et al. (2017) [11] (Table 3). All six primer sets, along with the universal PEA1 and PEA2, amplified the expected polymorphic products (STARP markers) in sugarbeet lines and their corresponding F1 plants, and the polymorphisms were observed through both PAGE gel electrophoresis and fluorescence density comparison. The co-dominant nature of STARP markers allowed for the easy detection of false F1 hybrids (Figure 2). From 144 seeds harvested from the manual pollinations, we detected 15 false hybrids based on STARP marker analysis (Table S2). However, allelic discrimination using fluorescence signals could potentially lead to misclassification in some samples (Figure 2). For example, when genotyping SNP4 in plants that were germinated from seeds resulting from using F1057 pollen to pollinate F1056 flowers, the fluorescence signal method incorrectly grouped three false F1′s into the hybrid group and failed to genotype one sample (Figure 2c). Moreover, in the case of genotyping SNP2 in plants derived from the cross between F1024 and F1029, two homozygous samples were identified as F1′s (Figure 2d), indicating that PAGE gel electrophoresis is a more accurate method for genotyping.

3.4. Improving Fragment Length Polymorphism of STARP Markers

To increase the fragment length polymorphism of STARP markers for detection using agarose gels, we extended the 5′- end of the allele-specific forward (F2) primers by five nucleotides for five SNPs, creating a total fragment length polymorphism of nine base pairs in STARP markers for SNP1, SNP4, SNP5, SNP6, and SNP10 (Table 4). It was demonstrated that the fragment length difference between STARP markers produced by the prolonged F2 primers was increased on PAGE and agarose gels (Figure 3). The 9-bp difference of STARP markers can be easily detected on a 3% agarose gel (Figure 3c), and they were further tested on the 2% (Figure 3d) and 1.5% (Figure 3e) agarose gels with electrophoresis conducted under a relatively lower voltage. Extending the length of allele-specific F2 primer can increase the length polymorphism, making it detectable through agarose gels.

4. Discussion

Genotyping individual SNPs is crucial for gene identification and marker-assisted selection, often being used in genetic mapping, QTL analysis, and association studies in various species. Of the several marker systems that are commonly used for genotyping individual SNPs such as TaqMan [6], KASP [7,8], rhAmp [9,10], and STARP [11], they all can use fluorescence signals for allele determination, but STARP is the only one that can also use traditional gel electrophoresis for SNP genotyping and gains a high genotyping accuracy. In this research, we demonstrated that STARP markers provide a robust and reliable platform for genotyping individual SNPs in sugarbeet. The strategy of identifying SNPs through GBS, validating SNPs or interest using targeted sequencing, and designing STARP primers from validated SNPs will increase the efficiency of marker development at a relatively lower cost compared to the current methodologies.
Using fluorescence signals for SNP allelic discrimination can eliminate the need for gel electrophoresis. However, specialized equipment is needed for detecting fluorescence and measuring intensities, followed by a statistical analysis to choose the thresholds for allele genotype determination. The accuracy of genotyping based on a fluorescence signal is easily affected by background noise resulting from PCR amplification of off-target genomic regions, as well as a variation in signal intensity due to the variations in DNA integrity, concentration, and purity in DNA samples. From this research, it was demonstrated that using fragment length polymorphism is more accurate than using fluorescence signals for SNP genotyping (Figure 2).
To make the STARP marker assay accessible for use with agarose gels, which are easy to prepare and enable PCR product detection under any gel image system, we increased the fragment length polymorphism of STARP products to 9-bp. The difference in fragment length could be detected in gels with concentrations as low as 1.5%. Another advantage of using agarose gels is that there is no need to label the PEA primers with fluorescence since a gel stain dye, such as SYBR® safe, can easily detect fragment length polymorphism in a gel imaging system. This will significantly reduce the cost of synthesizing PEA primers. Moreover, we tested increasing the size of the insertion in the PEA2 primer from 4-bp (AGAG-3′) to 8-bp (AGAGAGAG-3′) and observed an increase in the fragment length difference. Nonetheless, the increased insertion affected PCR amplification efficiency (data not shown), which is in agreement with Long et al. (2017) that PEA2 is more efficient than PEA1 for amplifying STARP markers [11]. However, extending the length of the allele-specific primer F2 by 5-bp will not affect the amplification efficiency of STARP markers since the primer is only involved in the initial PCR reaction, and STARP markers are products of the 2nd-step PCR that is amplified by the universal PEA and common reverse primers. Therefore, increasing the length of allele-specific primer F2 is better than increasing the insertion size in PEA2 for enhancing the ability of SNP genotyping using agarose gels. Manipulation of the allele-specific primer F2 highlights the flexibility of the STARP marker platform and its potential for further improvement.
The length of a primer also affects the specificity of the PCR amplification, and longer primers may increase the risk of off-target amplification due to the non-specific binding. It should be noted that the annealing temperature used in the 2-step PCR program for STARP marker production is set at 62 °C, which is unlikely to block all non-specific binding between an allele-specific primer and genomic DNA template. However, in this study, the longer primers showed increased specificity for target region amplification. The non-target amplification products were easily detected using allele-specific primers with a normal length (see gel image of amplification in F1024 under 4-bp difference in Figure 3a, and amplification in F1057 under 4-bp difference in Figure 3b), but they became almost undetectable when allele-specific primer F2 was extended by 5 bp towards the 5′-end (see gel image of amplification in F1024 under 9-bp difference in Figure 3a, and amplification in F1057 under 9-bp difference in Figure 3b). Therefore, increasing the primer length is preferable for SNP genotyping through fragment length analysis, but it may not be helpful for allelic discrimination using fluorescence signals.

5. Conclusions

We have demonstrated that the STARP marker platform is suitable for genotyping individual SNPs in sugarbeet, and its feature of using fragment length polymorphism for SNP genotyping results in a higher accuracy compared to allelic discrimination through a fluorescence signal. Furthermore, by extending the length of allelic-specific primer F2, the fragmental polymorphism of STARP markers can be detected using agarose gels, indicating that the STARP marker system is flexible and can be further modified to adapt to different laboratory settings.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy13051359/s1, Table S1: DNA sequences containing 12 randomly selected SNPs identified by GBS to be validated for STARP marker design. Table S2: Validation of F1 plants using STARP markers developed from the validated SNPs among parental sugarbeet lines.

Author Contributions

Conceptualization, C.C. and S.S.X.; methodology, M.M.T., N.A.W., S.Y. and Y.Z.; validation, C.C. and M.M.T.; formal analysis, M.M.T.; investigation, C.C. and M.M.T.; data curation, M.M.T., S.Y. and C.C.; writing—original draft preparation, C.C. and M.M.T.; writing—review and editing, S.Y., S.S.X., M.D.B., N.A.W. and X.L.; visualization, M.M.T.; supervision, C.C.; project administration, M.D.B.; funding acquisition, M.D.B., C.C. and X.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the USDA-ARS CRIS project No. 3060-21000-044-000D, the Sugarbeet Research and Education Board of Minnesota and North Dakota (SBREB), and the Beet Sugar Development Foundation (BSDF).

Data Availability Statement

All data supporting the findings of this study are included in the article.

Acknowledgments

We thank Rachael Claire Poore for her assistance with DNA extraction and ordering primers, Yunming Long from the Plant Sciences Department, NDSU for helping STARP primer design, and Qijun Zhang from the Plant Sciences Department, NDSU for technical help on running the PAGE gels. The mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. The U.S. Department of Agriculture is an equal opportunity provider and employer.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

SNPssingle nucleotide polymorphisms
STARPsemi-thermal asymmetric reverse PCR
KASPKompetitive Allele Specific PCR
rhAmpRNase H2 enzyme-based amplification
INDELsinsertions/deletions
PEApriming element adjustable
AMASasymmetrically modified allele-specific
USDA-ARSUS Department of Agriculture-Agriculture Research Service
GBSgenotype by sequencing
IDTIntegrated DNA Technologies
BSAbovine serum albumin
PAGEpolyacrylamide gel electrophoresis
QTLquantitative trait loci
UVultraviolet

References

  1. Rafalski, A. Applications of single nucleotide polymorphisms in crop genetics. Curr. Opin. Plant Biol. 2002, 5, 94–100. [Google Scholar] [CrossRef] [PubMed]
  2. Thomson, M.J. High-throughput SNP genotyping to accelerate crop improvement. Plant Breed. Biotech. 2014, 2, 195–212. [Google Scholar] [CrossRef]
  3. Taub, F. Laboratory methods: Sequential comparative hybridizations analyzed by computerized image processing can identify and quantitate regulated RNAs. DNA 1983, 2, 309–327. [Google Scholar] [CrossRef] [PubMed]
  4. Shalon, D.; Smith, S.J.; Brown, P.O. A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization. Genome Res. 1996, 6, 639–645. [Google Scholar] [CrossRef] [PubMed]
  5. Heather, J.M.; Chain, B. The sequence of sequencers: The history of sequencing DNA. Genomics 2016, 107, 1–8. [Google Scholar] [CrossRef]
  6. Woodward, J. Bi-allelic SNP genotyping using the TaqMan assay. Methods Mol. Biol. 2014, 1145, 67–74. [Google Scholar]
  7. Semagn, K.; Babu, R.; Hearne, S.; Olsen, M. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): Overview of the technology and its application in crop improvement. Mol. Breed. 2014, 33, 1–14. [Google Scholar] [CrossRef]
  8. Ertiro, B.T.; Ogugo, V.; Worku, M.; Das, B.; Olsen, M.; Labuschagne, M.; Semagn, K. Comparison of Kompetitive Allele Specific PCR (KASP) and genotyping by sequencing (GBS) for quality control analysis in maize. BMC Genom. 2015, 16, 908. [Google Scholar] [CrossRef]
  9. IDT. rhAmp™ SNP Genotyping: Genotyping with rhAmp SNP Assays and rhAmp Reagent Mixes. 2017. Available online: https://sfvideo.blob.core.windows.net/sitefinity/docs/default-source/protocol/rhamp-snp-genotyping-protocol.pdf?sfvrsn=171f3407_12 (accessed on 22 February 2023).
  10. Dobosy, J.R.; Rose, S.D.; Beltz, K.R.; Rupp, S.M.; Powers, K.M.; Behlke, M.A.; Walder, J.A. RNase H-dependent PCR (rhPCR): Improved specificity and single nucleotide polymorphism detection using blocked cleavable primers. BMC Biotechnol. 2011, 11, 80. [Google Scholar] [CrossRef]
  11. Long, Y.M.; Chao, W.S.; Ma, G.J.; Xu, S.S.; Qi, L.L. An innovative SNP genotyping method adapting to multiple platforms and throughputs. Theor. Appl. Genet. 2017, 130, 597–607. [Google Scholar] [CrossRef]
  12. Ayalew, H.; Tsang, P.W.; Chu, C.; Wang, J.; Liu, S.; Chen, C.; Ma, X. Comparison of TaqMan, KASP and rhAmp SNP genotyping platforms in hexaploid wheat. PLoS ONE 2019, 14, e0217222. [Google Scholar] [CrossRef] [PubMed]
  13. Alvarez-Fernandez, A.; Bernal, M.J.; Fradejas, I.; Ramírez, A.M.; Md Yusuf, N.A.; Lanza, M.; Hisam, S.; de Ayala, A.P.; Rubio, J.M. KASP: A genotyping method to rapid identification of resistance in Plasmodium falciparum. Malar. J. 2021, 20, 16. [Google Scholar] [CrossRef]
  14. Broccanello, C.; Chiodi, C.; Funk, A.; McGrath, J.M.; Panella, L.; Stevanato, P. Comparison of three PCR-based assays for SNP genotyping in plants. Plant Methods 2018, 14, 28. [Google Scholar] [CrossRef] [PubMed]
  15. Alhashel, A.F.; Sharma Poudel, R.; Fiedler, J.; Carlson, C.H.; Rasmussen, J.; Baldwin, T.; Friesen, T.L.; Brueggeman, R.S.; Yang, S. Genetic mapping of host resistance to the Pyrenophora teres f. maculata isolate 13IM8.3. G3 2021, 11, 12. [Google Scholar] [CrossRef] [PubMed]
  16. Soler-Garzón, A.; Oladzad, A.; Beaver, J.; Beebe, S.; Lee, R.; Lobaton, J.D.; Macea, E.; McClean, P.; Raatz, B.; Rosas, J.C.; et al. NAC candidate gene marker for bgm-1 and interaction with QTL for resistance to bean golden yellow mosaic virus in common bean. Front. Plant Sci. 2021, 12, 628443. [Google Scholar] [CrossRef]
  17. Zia, M.A.B.; Demirel, U.; Nadeem, M.A.; Çaliskan, M.E. Genome-wide association study identifies various loci underlying agronomic and morphological traits in diversified potato panel. Physiol. Mol. Biol. Plants 2020, 26, 1003–1020. [Google Scholar] [CrossRef]
  18. Ma, G.; Song, Q.; Li, X.; Qi, L. Genetic Insight into Disease Resistance Gene Clusters by Using Sequencing-Based Fine Mapping in Sunflower (Helianthus annuus L.). Int. J. Mol. Sci. 2022, 23, 9516. [Google Scholar] [CrossRef]
  19. Wu, Y.; Li, M.; He, Z.; Dreisigacker, S.; Wen, W.; Jin, H.; Zhai, S.; Li, F.; Gao, F.; Liu, J.; et al. Development and validation of high-throughput and low-cost STARP assays for genes underpinning economically important traits in wheat. Theor. Appl. Genet. 2020, 133, 2431–2450. [Google Scholar] [CrossRef]
  20. Arumuganathan, K.; Earle, E.D. Nuclear DNA content of some important plant species. Plant Mol. Biol. Rep. 1991, 9, 208–218. [Google Scholar] [CrossRef]
  21. Dohm, J.C.; Minoche, A.E.; Holtgräwe, D.; Capella-Gutiérrez, S.; Zakrzewski, F.; Tafer, H.; Rupp, O.; Sörensen, T.R.; Stracke, R.; Reinhardt, R.; et al. The genome of the recently domesticated crop plant sugar beet (Beta vulgaris). Nature 2014, 505, 546–549. [Google Scholar] [CrossRef]
  22. Campbell, L.G.; Panella, L.; Smigocki, A.C. Registration of F1024 sugarbeet germplasm with resistance to sugarbeet root maggot. J. Plant Regist. 2011, 5, 241–247. [Google Scholar] [CrossRef]
  23. Campbell, L.G.; Fugate, K. Relationships among impurity components, sucrose, and sugarbeet processing quality. J. Sugar Beet Res. 2015, 52, 4–21. [Google Scholar] [CrossRef]
  24. Fugate, K.K.; Campbell, L.G.; Lafta, A.M.; Eide, J.D.; Khan, M.F.R.; Chu, C.; Finger, F.L. Newly developed sugarbeet lines with altered postharvest respiration rates differ in transcription factor and glycolytic enzyme expression. Crop Sci. 2022, 62, 1251–1263. [Google Scholar] [CrossRef]
  25. Panella, L.; Campbell, L.G.; Eujayl, I.A.; Lewellen, R.T.; McGrath, J.M. USDA-ARS sugarbeet releases and breeding over the past 20 years. J. Sugar Beet Res. 2015, 52, 22–67. [Google Scholar] [CrossRef]
  26. Chu, C.; Poore, R.C.; Bolton, M.D.; Fugate, K.K. Mechanism of sugarbeet seed germination enhanced by hydrogen peroxide. Front. Plant Sci. 2022, 13, 888519. [Google Scholar] [CrossRef]
  27. Hilario, E.; Barron, L.; Deng, C.H.; Datson, P.M.; De Silva, N.; Davy, M.W.; Storey, R.D. Random tagging genotyping by sequencing (rtGBS), an unbiased approach to locate restriction enzyme sites cross the target genome. PLoS ONE 2015, 10, e0143193. [Google Scholar] [CrossRef]
  28. McGrath, J.M.; Funk, A.; Galewski, P.; Ou, S.; Townsend, B.; Davenport, K.; Daligault, H.; Johnson, S.; Lee, J.; Hastie, A.; et al. A contiguous de novo genome assembly of sugar beet EL10 (Beta vulgaris L.). DNA Res. 2023, 30, dsac033. [Google Scholar] [CrossRef]
  29. Glaubitz, J.C.; Casstevens, T.M.; Lu, F.; Harriman, J.; Elshire, R.J.; Sun, Q.; Buckler, E.S. TASSEL-GBS: A high capacity genotyping by sequencing analysis pipeline. PLoS ONE 2014, 9, e90346. [Google Scholar] [CrossRef]
  30. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. Available online: https://primer3.ut.ee/ (accessed on 22 February 2023). [CrossRef]
  31. The Sugar Beet Genome Website, a Comprehensive Website for Beta vulgaris Genome Sequence and Annotations. Available online: http://sugarbeets.msu.edu/home.html (accessed on 22 February 2023).
Figure 1. Gel image of PCR products for sequencing to validate eight SNPs used for STARP assay. MW Marker means the size standard molecular weight with size (bp) labeled on the left. The sequence containing each SNP is listed in Table S1. PCR primers designed to target these SNP-containing regions are listed in Table 2.
Figure 1. Gel image of PCR products for sequencing to validate eight SNPs used for STARP assay. MW Marker means the size standard molecular weight with size (bp) labeled on the left. The sequence containing each SNP is listed in Table S1. PCR primers designed to target these SNP-containing regions are listed in Table 2.
Agronomy 13 01359 g001
Figure 2. STARP assay for SNP allele discrimination using fragment length polymorphisms through PAGE gels or color intensity of fluorescence signals. (a). PAGE gel image of genotyping SNP4 among F1s from the cross between F1056 and F1057 with lanes 1: F1056, 2: F1057, and 3–15 are F1 plants harvested from F1056 pollinated with pollen of F1057. Among F1s, lanes 5, 8, 12, and 15 are false hybrids. (b). PAGE gel image of genotyping SNP2 among F1s from the cross between F1024 and F1029 with lanes 1: F1024, 2: F1029, and 3–14 are F1 plants harvested from F1024 pollinated with the pollen of F1029. Among F1s, lanes 5, 10, and 13 are false hybrids. (c). Allelic discrimination of SNP4 using fluorescence signals among F1s from the cross between F1056 and F1057. (d). Allelic discrimination of SNP2 using fluorescence signals among F1s from the cross between F1024 and F1029. In (c,d), orange dots and blue squares represent genotypes of the homozygous allele 1 and 2, respectively, and green triangles indicate heterozygous genotypes. Orange cross indicates failure of allelic discrimination, and genotypes in red ovals are erroneously classified evidenced by the PAGE gel result.
Figure 2. STARP assay for SNP allele discrimination using fragment length polymorphisms through PAGE gels or color intensity of fluorescence signals. (a). PAGE gel image of genotyping SNP4 among F1s from the cross between F1056 and F1057 with lanes 1: F1056, 2: F1057, and 3–15 are F1 plants harvested from F1056 pollinated with pollen of F1057. Among F1s, lanes 5, 8, 12, and 15 are false hybrids. (b). PAGE gel image of genotyping SNP2 among F1s from the cross between F1024 and F1029 with lanes 1: F1024, 2: F1029, and 3–14 are F1 plants harvested from F1024 pollinated with the pollen of F1029. Among F1s, lanes 5, 10, and 13 are false hybrids. (c). Allelic discrimination of SNP4 using fluorescence signals among F1s from the cross between F1056 and F1057. (d). Allelic discrimination of SNP2 using fluorescence signals among F1s from the cross between F1024 and F1029. In (c,d), orange dots and blue squares represent genotypes of the homozygous allele 1 and 2, respectively, and green triangles indicate heterozygous genotypes. Orange cross indicates failure of allelic discrimination, and genotypes in red ovals are erroneously classified evidenced by the PAGE gel result.
Agronomy 13 01359 g002
Figure 3. Images of PAGE and agarose gels to detect STARP markers with fragment length difference of 4-bp and 9-bp. (a). PAGE gel image in F1024 and F1029. (b). PAGE gel image in F1056 and F1057. (c). Agarose gel (3%, w/v) image in F1024 and F1029. (d). Agarose gel (2%, w/v) image in F1024 and F1029. (e). Agarose gel (1.5%, w/v) image in F1056 and F1057. (w/v) Red and yellow arrows indicate bands with different size with red indicating bands with 9-bp increase and yellow indicating bands without length increase. In each of replicated three lanes for each sample, DNA template volumes in STARP PCR is 1.0, 1.5, and 2.0 µL (from left to right), accordingly.
Figure 3. Images of PAGE and agarose gels to detect STARP markers with fragment length difference of 4-bp and 9-bp. (a). PAGE gel image in F1024 and F1029. (b). PAGE gel image in F1056 and F1057. (c). Agarose gel (3%, w/v) image in F1024 and F1029. (d). Agarose gel (2%, w/v) image in F1024 and F1029. (e). Agarose gel (1.5%, w/v) image in F1056 and F1057. (w/v) Red and yellow arrows indicate bands with different size with red indicating bands with 9-bp increase and yellow indicating bands without length increase. In each of replicated three lanes for each sample, DNA template volumes in STARP PCR is 1.0, 1.5, and 2.0 µL (from left to right), accordingly.
Agronomy 13 01359 g003
Table 1. SNPs generated through genotype-by-sequencing (GBS) in eleven sugarbeet lines and marker coverage on each chromosome. Genomic positions of SNPs were determined through sequence alignment using genome assembly EL10.2 [28].
Table 1. SNPs generated through genotype-by-sequencing (GBS) in eleven sugarbeet lines and marker coverage on each chromosome. Genomic positions of SNPs were determined through sequence alignment using genome assembly EL10.2 [28].
ChromosomeNumber of SNPsPercentageGenome Coverage (Mb)Marker Density (kb/SNP)
154098.964.111.8
2631110.456.89.0
3643810.657.18.9
4731412.166.19.0
5832013.767.78.1
6860414.272.28.4
7620410.260.99.8
8654310.861.69.4
954969.155.610.1
Total60,639100.0562.1Average: 9.3
Table 2. SNPs validated through sequencing PCR products amplified by primers designed from the target regions containing SNP sites among sugarbeet lines.
Table 2. SNPs validated through sequencing PCR products amplified by primers designed from the target regions containing SNP sites among sugarbeet lines.
SNP to ValidateForward PCR Primer (5′ → 3′) *Reverse PCR Primer (5′ → 3′) *PCR Product (bp) *SNP Validation **SNP Allele
SNP1GTCCCTTTCAACCATGCCTGAAATGAAAGCCTCGCCACAG822TrueA: F1024
G: F1029, FC1019
SNP2ACACTGGGAGAACTCTGACCCCATATCCGTGCATCTCCCA792TrueC: F1029
T: F1024
SNP3CAAGTCTGTAGGCGGTGGTAAGAGCTCTGACCTTTATGCCA840Unable to verify-
SNP4CGGGAGTTAATGGCTTCACATCGCACTTGAAATGTTGACCT833TrueC: F1056
T: F1057
SNP5ACCGGCTGCTTTTAAAGTGGACGTTTTGTGTTTCTCTTTGGC774TrueA: F1056, L29)
G: F1057
SNP6TTGGGCACGATCGGTCATAATCAACCCAACCCGAATCAGA920TrueA: L19, L29
G: F1056, CR933
SNP7CGCAACTGTCCGAAGTCTTTGAGTTAGGGGTGCTCATCGA754Unable to verify-
SNP8GATTTTGAAGCGCAGGGGATGTTCTTCTGAGCCAAGCCAC708FalseNot a SNP
SNP9CGAGCAGGAATGTCAGGTTGTGGCGTTGACTTATAAGGGGA713TrueC: F1024, FC1019
T: F1028
SNP10AGGGTGGATAGTGATGCTGGCTATTGCACCATGAGACCGC733TrueC: F1024
T: CR933, SP8030-0
SNP11TGGTGAAGTAACTGCTGATTGTTCGCGATCTTAAGCAGCTTG712TrueA: FC1740
T: F1028, F1029, SP8030-0
SNP12CACCTTACCCACAGCCTGTAGCAGTTTGTGGTGCAGCTAG784Unable to verify-
* PCR primers were designed using Primer3web v 4.1.0 [30] according to DNA sequences extracted from genomic sequence assembly EL10.2 [28] in target regions, and the size of PCR product was estimated accordingly. ** True means a validated SNP, false means SNP called from GBS data is not correct, and unable to verify means the SNP was unable to validate due to the sequence from PCR products in some sugarbeet lines being too short and does not cover the SNP site.
Table 3. STARP primers designed from six randomly selected validated SNPs.
Table 3. STARP primers designed from six randomly selected validated SNPs.
SNP NameSNP AlleleSTARP Primers (5′ → 3′) *Tm (°C) **GC (%)
SNP1A/GSNP1-F1-G: GCAACAGGAACCAGCTATGACgcagccaaatctgtacac57.250.0
SNP1-F2-A: GACGCAAGTGAGCAGTATGACgcagccaaatctgtatgt56.744.4
SNP1-CR: cttggcacgattcacagtcaa66.547.6
SNP4C/TSNP4-F1-C: GCAACAGGAACCAGCTATGACagatggaatgtccacatcatcc 65.245.5
SNP4-F2-T: GACGCAAGTGAGCAGTATGACagatggaatgtccacatcactt62.640.9
SNP4-CR: acacagtccgtgcaatgca67.252.6
SNP5A/GSNP5-F1-G: GCAACAGGAACCAGCTATGACaaacacccaattattagggtcc61.940.9
SNP5-F2-A: GACGCAAGTGAGCAGTATGACaaacacccaattattagggctt61.736.4
SNP5-CR: accggctgcttttaaagtgg65.450.0
SNP6A/GSNP6-F1-G: GCAACAGGAACCAGCTATGACgaggtttgaggacctagagcg64.557.1
SNP6-F2-A: GACGCAAGTGAGCAGTATGACgaggtttgaggacctagcgaa64.852.4
SNP6-CR: gggtgatgaaccacttgtcaa65.247.6
SNP9C/TSNP9-F1-C: GCAACAGGAACCAGCTATGACaacagatagaacgctgtctc56.645.0
SNP9-F2-T: GACGCAAGTGAGCAGTATGACaacagatagaacgctgttct56.240.0
SNP9-CR: tggcgttgacttataagggga65.647.6
SNP10C/TSNP10-F1-C: GCAACAGGAACCAGCTATGACatttcgacatttgtgaattattgcc65.732.0
SNP10-F2-T: GACGCAAGTGAGCAGTATGACatttcgacatttgtgaattatcgat63.528.0
SNP10-CR: aatgcggtctcatggtgcaat68.947.6
* Primer names containing “F1” and “F2” are allelic specific forward primers, and the sequences GCAACAGGAACCAGCTATGAC and GACGCAAGTGAGCAGTATGAC included in each allelic-specific primer are two-tail sequences that were contained in universal primers PEA1 and PEA2, respectively. STARP PCR products amplified by PEA2 that uses templates from initial PCR by Allelic F2 primer will be 4 bp longer than those amplified by PEA1. The last letter in each of the allelic specific primers indicates the SNP allele it detects. “CR” in primer names indicates the common reverse primer. ** Annealing temperature was calculated with salt concentration set as 50 mM and primer concentration as 0.5 µM.
Table 4. Sequences of five prolonged allele-specific primers with 5-bp extended on 5′-end.
Table 4. Sequences of five prolonged allele-specific primers with 5-bp extended on 5′-end.
SNP NameSNP AlleleSTARP Primers (5′ → 3′)Tm (°C) *GC (%)
SNP1A/GSNP1-F2-5-bp-A: GCAACAGGAACCAGCTATGACtaattgcagccaaatctgtacac63.139.1
SNP4C/TSNP4-F2-5-bp-T: GCAACAGGAACCAGCTATGACcagtcagatggaatgtccacatcatcc72.348.1
SNP5A/GSNP5-F2-5-bp-A: GACGCAAGTGAGCAGTATGACatcccaaacacccaattattagggctt70.040.7
SNP6A/GSNP6-F2-5-bp-A: GACGCAAGTGAGCAGTATGACctagtgaggtttgaggacctagcgaa68.450.0
SNP10C/TSNP10-F2-5-bp-T: GACGCAAGTGAGCAGTATGACtttgcatttcgacatttgtgaattatcgat71.330.0
* Annealing temperature was calculated with salt concentration set as 50 mM and primer concentration as 0.5 µM.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tehseen, M.M.; Zheng, Y.; Wyatt, N.A.; Bolton, M.D.; Yang, S.; Xu, S.S.; Li, X.; Chu, C. Development of STARP Marker Platform for Flexible SNP Genotyping in Sugarbeet. Agronomy 2023, 13, 1359. https://doi.org/10.3390/agronomy13051359

AMA Style

Tehseen MM, Zheng Y, Wyatt NA, Bolton MD, Yang S, Xu SS, Li X, Chu C. Development of STARP Marker Platform for Flexible SNP Genotyping in Sugarbeet. Agronomy. 2023; 13(5):1359. https://doi.org/10.3390/agronomy13051359

Chicago/Turabian Style

Tehseen, Muhammad Massub, Yaojie Zheng, Nathan A. Wyatt, Melvin D. Bolton, Shengming Yang, Steven S. Xu, Xuehui Li, and Chenggen Chu. 2023. "Development of STARP Marker Platform for Flexible SNP Genotyping in Sugarbeet" Agronomy 13, no. 5: 1359. https://doi.org/10.3390/agronomy13051359

APA Style

Tehseen, M. M., Zheng, Y., Wyatt, N. A., Bolton, M. D., Yang, S., Xu, S. S., Li, X., & Chu, C. (2023). Development of STARP Marker Platform for Flexible SNP Genotyping in Sugarbeet. Agronomy, 13(5), 1359. https://doi.org/10.3390/agronomy13051359

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop