Population Genetic Characterization of the Pear Pest, Cacopsylla jukyungi (Kwon, 1983) (Hemiptera: Psyllidae), Using Novel Microsatellite Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling and DNA Extraction
2.2. Next-Generation Sequencing
2.3. Development of Microsatellite Markers and Genotyping
2.4. Microsatellite Data Analysis
3. Results
3.1. Characteristics of Microsatellite Loci
3.2. Genetic Diversity
3.3. Bottleneck Test
3.4. Population Genetic Analyses
4. Discussion
4.1. Higher HE and Positive FIS in All Populations
4.2. Overall Absence of Population Structure
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kim, W.T.; Choi, K.R.; Lee, H.I.; Kim, J.H.; Kim, J.Y. Agricultural Outlook 2023 Korea, Chapter 14: Trends and Prospects of Fruit Supply and Demand; Korea Rural Economic Institute Press: Naju, Republic of Korea, 2023; pp. 533–618. [Google Scholar]
- Kwon, Y.J. Psylloidea of Korea (Homoptera: Sternorrhyncha); Editorial Committee of Insecta Koreana: Seoul, Republic of Korea, 1983; pp. 1–181. [Google Scholar]
- Kim, D.S.; Yang, C.Y.; Jeon, H.Y. An empirical model for the prediction of the onset of upward-movement of overwintered Cacopsylla pyricola (Homoptera: Psyllidae) in pear orchards. Korean J. Agric. For. Meteorol. 2007, 9, 228–233. [Google Scholar] [CrossRef]
- Park, J.S.; Park, J.W.; Kang, A.R.; Lee, S.H.; Yang, K.-Y.; Kim, W.S.; Kim, I. Analysis of occurrence pattern of the pear psylla; Cacopsylla pyricola; in the pear exporting complex. Trends Agric. Life Sci. 2014, 48, 1–8. [Google Scholar]
- Foerster, A. Uebersicht der Gattungen und Arten in der Familie der Psylloden. Verhandlungen des Naturhistorischen. Ver. Preuss. Rheinl. 1848, 5, 65–98. [Google Scholar]
- Kang, A.R.; Baek, J.Y.; Lee, S.H.; Cho, Y.S.; Kim, W.S.; Han, Y.S.; Kim, I. Geographic homogeneity and high gene flow of the pear psylla; Cacopsylla pyricola (Hemiptera: Psyllidae); detected by mitochondrial COI gene and nuclear ribosomal internal transcribed spacer 2. Anim. Cells Syst. 2012, 16, 145–153. [Google Scholar] [CrossRef]
- Cho, G.; Burckhardt, D.; Inoue, H.; Luo, X.; Lee, S. Systematics of the east Palaearctic pear psyllids (Hemiptera: Psylloidea) with particular focus on the Japanese and Korean fauna. Zootaxa 2017, 4362, 75–98. [Google Scholar] [CrossRef]
- An, J.H.; Yiem, M.S.; Kim, D.S. Effects of photoperiod and temperature on formation and fecundity of two seasonal forms of Psylla pyricola (Homoptera: Psyllidae). Korean J. Appl. Entomol. 1996, 35, 205–208. [Google Scholar]
- Park, J.W.; Park, J.S.; Kang, A.R.; Na, I.S.; Cha, G.H.; Oh, H.J.; Lee, S.H.; Yang, K.Y.; Kim, W.S.; Kim, I. Establishment of pest forecasting management system for the improvement of pass ratio of Korean exporting pears. Int. J. Ind. Entomol. 2012, 25, 163–169. [Google Scholar] [CrossRef]
- Rural Development Administration. Nongsaro: Agricultural Technology Information. 2015. Available online: http://www.nongsaro.go.kr (accessed on 20 August 2023).
- Rural Development Administration. Agriculture Technique Guide 013: Pear; Rural Development Administration; Seungil Media Group: Daejeon City, Republic of Korea, 2020. [Google Scholar]
- Malagnini, V.; Pedrazzoli, F.; Forno, F.; Komjanc, M.; Ioriatti, C. Characterization of microsatellite loci in Cacopsylla melanoneura Förster (Homoptera: Psyllidae). Mol. Ecol. Notes 2007, 7, 495–497. [Google Scholar] [CrossRef]
- Sun, J.R.; Li, Y.; Yan, S.; Zhang, Q.; Xu, H. Microsatellite marker analysis of genetic diversity of Cacopsylla chinensis (Yang et Li)(Hemiptera: Psyllidae) populations in China. Acta Entomol. Sin. 2011, 54, 820–827. [Google Scholar]
- Malagnini, V.; Pedrazzoli, F.; Papetti, C.; Cainelli, C.; Zasso, R.; Gualandri, V.; Pozzebon, A.; Ioriatti, C. Ecological and genetic differences between Cacopsylla melanoneura (Hemiptera; Psyllidae) populations reveal species host plant preference. PLoS ONE 2013, 8, e69663. [Google Scholar] [CrossRef][Green Version]
- Sauvion, N.; Lachenaud, O.; Genson, G.; Rasplus, J.; Labonne, G. Are there several biotypes of Cacopsylla pruni? Bull. Insectology 2007, 60, 185–186. [Google Scholar]
- Sauvion, N.; Lachenaud, O.; Mondor-Genson, G.; Easplus, J.Y.; Labonne, G. Nine polymorphic microsatellite loci from the psyllid Cacopsylla pruni (Scopoli); the vector of European stone fruit yellows. Mol. Ecol. Resour. 2009, 9, 1196–1199. [Google Scholar] [CrossRef]
- Kimura, M. A simple method for estimating evolutionary rate of base substitution through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Felsenstein, J. Confidence limits on phylogenics: An approach using the bootstrap. Evolution 1985, 29, 783–791. [Google Scholar] [CrossRef]
- Kang, A.R.; Kim, M.J.; Park, J.S.; Seo, H.J.; Song, J.H.; Won, K.H.; Choi, E.D.; Kim, I. Comparative analysis of two pear pests, Cacopsylla jukyungi and Cacopsylla burckhardti (Hemiptera: Psyllidae), based on complete mitochondrial genomes and comparison to confamilial species. Agronomy 2022, 12, 2037. [Google Scholar] [CrossRef]
- Gnerre, S.; MacCallum, I.; Przybylski, D.; Ribeiro, F.J.; Burton, J.N.; Walker, B.J.; Sharpe, T.; Hall, G.; Shea, T.P.; Sykes, S.; et al. High-quality draft assemblies of mammalian genomes from massively parallel sequence data. Proc. Natl. Acad. Sci. USA 2011, 108, 1513–1518. [Google Scholar] [CrossRef]
- Peng, Y.; Leung, H.C.; Yiu, S.M.; Chin, F.Y. IDBA-UD: A de novo assembler for single-cell and metagenomic sequencing data with highly uneven depth. Bioinformatics 2012, 28, 1420–1428. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar]
- Faircloth, B.C. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol. Ecol. Resour. 2008, 8, 92–94. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Bioinform. Methods Protoc. 2000, 132, 365–386. [Google Scholar]
- Yue, G.H.; Chen, F.; Orban, L. Rapid isolation and characterization of microsatellites from the genome of Asian arowana (Scleropages formosus, Osteoglossidae, Pisces). Mol. Ecol. 2000, 9, 1007–1009. [Google Scholar] [CrossRef]
- Weir, B.S. Genetic Data Analysis II; Sinauer Associates, Inc.: Sunderland, MA, USA, 1990; pp. 1–445. [Google Scholar]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Hartl, D.L.; Clark, A.G. Principles of Population Genetics, 3rd ed.; Sinauer Associates: Sunderland, MA, USA, 1997; pp. 1–568. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar] [PubMed]
- Goudet, J. FSTAT, a Program to Estimate and Test Gene Diversities and Fixation Indices. Version 2.9.3. 2001. Available online: http://www2.unil.ch/popgen/softwares/fstat.htm (accessed on 15 January 2023).
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Microchecker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
- Chapuis, M.-P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol. 2007, 24, 621–631. [Google Scholar] [PubMed]
- Dempster, A.P.; Laird, N.M.; Rubin, D.B. Maximum likelihood from incomplete data via the EM algorithm. J. R. Stat. Soc. Ser. B Methodol. 1977, 39, 1–22. [Google Scholar] [CrossRef]
- Raymond, M.; Rousset, F. GENEPOP (ver. 1.2): Population genetics software for exact tests and ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar] [CrossRef]
- Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef]
- Guo, S.W.; Thompson, E.A. Performing the exact test of Hardy-Weinberg proportions for multiple alleles. Biometrics 1992, 48, 361–372. [Google Scholar] [CrossRef]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar] [CrossRef] [PubMed]
- Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar] [PubMed]
- Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Mantel, N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967, 27, 209–220. [Google Scholar]
- Bohonak, A.J. IBD (Isolation by Distance): A program for analyses of isolation by distance. J. Hered. 2002, 93, 153–154. [Google Scholar] [CrossRef]
- Cornuet, J.M.; Luikart, G. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 1996, 144, 2001–2014. [Google Scholar] [CrossRef]
- Piry, S.; Luikart, G.; Cournet, J.M. BOTTLENECK: A computer program for detecting recent reductions in the effective population size using allele frequency data. J. Hered. 1999, 90, 502–503. [Google Scholar] [CrossRef]
- Luikart, G.; Allendorf, F.W.; Cornuet, J.M.; Sherwin, W.B. Distortion of allele frequency distributions provides a test for recent population bottlenecks. J. Hered. 1998, 89, 238–247. [Google Scholar] [CrossRef]
- Hoffmann, A.A.; White, V.L.; Jasper, M.; Yagui, H.; Sinclair, S.J.; Kearney, M.R. An endangered flightless grasshopper with strong genetic structure maintains population genetic variation despite extensive habitat loss. Ecol. Evol. 2021, 11, 5364–5380. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.K.; Li, F. The Pear psylla (Homoptera) of China with descriptions of seven new species. Entomotaxonomia 1981, 3, 35–47. [Google Scholar]
- Zhao, N.N.; Zhang, H.; Zhang, X.C.; Luan, X.B.; Zhou, C.; Liu, Q.Z.; Shi, W.P.; Liu, Z.L. Evaluation of acute toxicity of essential oil of garlic (Allium sativum) and its selected major constituent compounds against overwintering Cacopsylla chinensis (Hemiptera: Psyllidae). J. Econ. Entomol. 2013, 106, 1349–1354. [Google Scholar] [CrossRef] [PubMed]
- Tedeschi, R.; Bosco, D.; Alma, A. Population dynamics of Cacopsylla melanoneura (Homoptera: Psyllidae); a vector of apple proliferation phytoplasma in Northwestern Italy. J. Econ. Entomol. 2002, 95, 544–551. [Google Scholar] [CrossRef]
- Ossiannilsson, F. The Psylloidea (Homoptera) of Fennoscandia and Denmark; Brill: Leiden, The Netherlands, 1992; Volume 26, pp. 144–145. [Google Scholar]
- Thébaud, G.; Yvon, M.; Alary, R.; Sauvion, N.; Labonne, G. Efficient transmission of ‘Candidatus Phytoplasma prunorum’ is delayed by eight months due to a long latency in its hostalternating vector. Phytopathology 2009, 99, 265–273. [Google Scholar] [CrossRef]
- Mohd Rodzik, F.F.; Sudirman, N.A.; Teh, C.K.; Ong, A.L.; Heng, H.Y.; Yaakop, S.; Mohd-Assaad, N.; Ong-Abdullah, M.; Ata, N.; Amit, S.; et al. Development of nuclear DNA markers for applications in genetic diversity study of oil palm-pollinating weevil populations. Insects 2023, 14, 157. [Google Scholar] [CrossRef]
- Woo, J.; Heo, J.S.; Kim, K.-Y.; Kim, K.-S.; Hwang, H.-J.; Yoon, M.; An, H.; Kang, K.H.; Park, J.S.; Nam, K.-W.; et al. Population genetic analysis of the wild hard-shelled mussel, Mytilus unguiculatus (Valenciennes 1858) in South Korea using a microsatellite multiplex assay. Thalassas 2023, 1–12. [Google Scholar] [CrossRef]
- Charlesworth, D.; Charlesworth, B. Inbreeding depression and its evolutionary consequences. Ann. Rev. Ecol. System. 1987, 18, 237–268. [Google Scholar] [CrossRef]
- Lande, R. Genetic variation and phenotypic evolution during allopatric speciation. Am. Nat. 1980, 116, 463–479. [Google Scholar] [CrossRef]
- Caughley, G. Directions in conservation biology. J. Anim. Ecol. 1994, 63, 215–244. [Google Scholar] [CrossRef]
- Wright, S. Evolution and the Genetic of Population, Variability Within and among Natural Populations; University of Chicago Press: Chicago, IL, USA, 1978; pp. 213–220. [Google Scholar]
- Statistics Korea. Agriculture; Forestry & Fishery Census Report; Statistics Korea: Daejeon, Republic of Korea, 2015; Volume 4. [Google Scholar]
- Jeon, H.; Kim, D.; Cho, M.; Yiem, M.; Chang, Y. Recent status of major fruit tree pest occurrences in Korea. J. Korean Soc. Hortic. Sci. 2000, 41, 607–612. [Google Scholar]
- Rural Development Administration. Map of Pear Plantation Changes; Rural Development Administration: Suwon, Republic of Korea, 2010. [Google Scholar]
- Lee, H.C.; Yang, M.M.; Yeh, W.B. Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon. J. Econ. Entomol. 2008, 101, 1152–1157. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.C.; Wang, C.L. Integrated control of pear psylla Cacopsylla chinensis and pear decline. In Proceedings of the Symposium on Integrated Management Technology of Insect Vectors and Insect-Borne Diseases, July 2011; Taiwan Agricultural Research Institute: Taichung City, Taiwan, 2011; pp. 91–105. [Google Scholar]
- Cho, G.; Malenovský, I.; Burckhardt, D.; Inoue, H.; Lee, S. DNA barcoding of pear psyllids (Hemiptera: Psylloidea: Psyllidae), a tale of continued misidentifications. Bull. Entomol. Res. 2020, 110, 521–534. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Cen, Y.; He, Y.; Wu, Y.; Huang, S.; Lu, J. The first complete mitochondrial genome sequence of Cacopsylla citrisuga (Yang & Li), a new insect vector of Huanglongbing in Yunnan Province, China. Mitochondrial DNA Part B 2021, 6, 575–577. [Google Scholar] [PubMed]
- Kuznetsova, V.G.; Labina, E.S.; Shapoval, N.A.; Maryańska-Nadachowska, A.N.N.A.; Lukhtanov, V.A. Cacopsylla fraudatrix sp. n.(Hemiptera: Psylloidea) recognised from testis structure and mitochondrial gene COI. Zootaxa 2012, 3547, 55–63. [Google Scholar] [CrossRef]
- Gwiazdowski, R.A.; Foottit, R.G.; Maw, H.E.L.; Hebert, P.D. The Hemiptera (Insecta) of Canada: Constructing a reference library of DNA barcodes. PLoS ONE 2015, 10, e0125635. [Google Scholar] [CrossRef] [PubMed]






| Locality (Sample Size) | Abbreviation | Collection Date | Coordinate | Sample Number |
|---|---|---|---|---|
| 1. Chuncheon, Gangwondo Province (12) | CC | 31 March 2022 | 37°56′52″ N 127°45′35″ E | CJCC01, CJCC03, CJCC05, CJCC06, CJCC07, CJCC08, CJCC09, CJCC10, CJCC11, CJCC12, CJCC13, CJCC14 |
| 2. Namyangju, Gyeonggido Province (12) | NYJ | 30 March 2022 | 37°41′49″ N 127°07′32″ E | CJNYJ01, CJNYJ02, CJNYJ03, CJNYJ04, CJNYJ05, CJNYJ06, CJNYJ07, CJNYJ08, CJNYJ10, CJNYJ11, CJNYJ12, CJNYJ14 |
| 3. Pyeongtaek, Gyeonggido Province (12) | PT | 14 October 2021 | 37°02′51″ N 126°56′55″ E | CJPT01, CJPT02, CJPT04, CJPT05, CJPT06, CJPT07, CJPT08, CJPT11, CJPT12, CJPT13, CJPT14, CJPT15 |
| 4. Yesan, Chungcheongnamdo Province (12) | YS | 8 March 2022 | 36°42′54″ N 126°41′07″ E | CJYS01, CJYS02, CJYS03, CJYS04, CJYS06, CJYS08, CJYS09, CJYS10, CJYS11, CJYS13, CJYS14, CJYS15 |
| 5. Cheongju, Chungcheongbukdo Province (12) | CJ | 20 December 2021 | 36°39′06″ N 127°36′00″ E | CJCJ01, CJCJ02, CJCJ04, CJCJ05, CJCJ06, CJCJ07, CJCJ08, CJCJ10, CJCJ11, CJCJ12, CJCJ14, CJCJ15 |
| 6. Sangju, Gyeongsangbukdo Province (12) | SJ | 23 March 2022 | 36°29′39″ N 128°10′34″ E | CJSJ04, CJSJ05, CJSJ06, CJSJ07, CJSJ08, CJSJ09, CJSJ10, CJSJ11, CJSJ12, CJSJ13, CJSJ14, CJSJ15 |
| 7. Iksan, Jeollabukdo Province (12) | IS | 7 March 2022 | 36°04′16″ N 127°01′52″ E | CJIS02, CJIS03, CJIS04, CJIS05, CJIS06, CJIS07, CJIS08, CJIS10, CJIS11, CJIS12, CJIS14, CJIS15 |
| 8. Yeongcheon, Gyeongsangbukdo Province (12) | YC | 16 October 2021 | 35°55′14″ N 128°51′56″ E | CJYC04, CJYC05, CJYC06, CJYC07, CJYC08, CJYC09, CJYC10, CJYC11, CJYC12, CJYC13, CJYC14, CJYC15 |
| 9. Ulsan (12) | US | 14 October 2021 | 35°31′38″ N 129°05′27″ E | CJUS01, CJUS03, CJUS04, CJUS05, CJUS07, CJUS09, CJUS10, CJUS11, CJUS12, CJUS14, CJUS15, CJUS16 |
| 10. Jinju, Gyeongsangnamdo Province (12) | JJ | 16 March 2022 | 35°08′45″ N 128°09′22″ E | CJJJ01, CJJJ04, CJJJ05, CJJJ06, CJJJ07, CJJJ08, CJJJ09, CJJJ10, CJJJ11, CJJJ12, CJJJ13, CJJJ14 |
| 11. Naju, Jeollanamdo Province (12) | NJ | 9 February 2022 | 35°01′30″ N 126°44′47″ E | CJNJ04, CJNJ05, JNJ06, CJNJ07, CJNJ08, CJNJ09, CJNJ10, CJNJ11, CJNJ12, CJNJ13, CJNJ14, CJNJ15 |
| Marker Name | Primer Sequence (5′–3′) | Annealing Temp. (°C) | Motifs | Repeat No. | Expected Size * | Minimum Size * |
|---|---|---|---|---|---|---|
| ID-753 | CTCTCCTCTAAAAAGTTACC | 47 | TC | 16 | 137 | 129 |
| CAACTACTCACATTTAGTCG | ||||||
| ID-2165 | CAAAATCCATGTCATGTCC | 48 | TC | 18 | 172 | 158 |
| GGATGAATATTTTCGAGACC | ||||||
| ID-3900 | TAGGTTAGATGTGAGATGG | 48 | TAA | 12 | 188 | 176 |
| GATCTTAGCTAGAAAATGGC | ||||||
| ID-4663 | TTATACATCCAGCACACC | 47 | TCT | 11 | 204 | 106 |
| GAAGAAGAAGAAGAAGAACC | ||||||
| ID-5968 | AGACCTACATGTACATACG | 48 | TCT | 12 | 167 | 152 |
| ATGGGATAGAGTATTGTGG | ||||||
| ID-8470 | GGGACATTTAAATATGGACC | 47 | ATA | 10 | 226 | 190 |
| CTATTAAGTCTCATTCGTGC | ||||||
| ID-8889 | AAGAGAGAGGAGATAAAGG | 47 | AG | 18 | 181 | 143 |
| GAAGGATATAGGTACTGAGG | ||||||
| ID-9837 | CCATCCTTTAAATGTCTCC | 47 | GA | 16 | 154 | 100 |
| TATGTCTCTCTGTCTCTCC | ||||||
| ID-10585 | GGTGTTGAATTGTCTTCC | 47 | AG | 16 | 183 | 160 |
| CTCAGTGGGTAAAAATAGG | ||||||
| ID-10656 | GACAGTTAACACTAGAAGC | 47 | GAG | 10 | 162 | 119 |
| GTGATTATTCCTCATTCCC | ||||||
| ID-10751 | CCATATTCCATATCACTACC | 48 | AAT | 10 | 200 | 189 |
| ATACACTAATACGAGACGG |
| Marker | n | a | Availability a | MAF | AR | No. Genotype | HE | HO | PIC | FIS | HWE b (p-Value) | GenBank No. |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID-3900 | 132 | 21.0 | 0.795 | 0.376 | 5.906 | 35.00 | 0.804 | 0.457 | 0.787 | 0.432 | 0.152 | OR487221 |
| ID-4663 | 132 | 18.0 | 0.932 | 0.280 | 6.187 | 31.00 | 0.830 | 0.821 | 0.810 | 0.011 | 0.204 | OR487222 |
| ID-5968 | 132 | 15.0 | 0.977 | 0.686 | 3.661 | 21.00 | 0.504 | 0.264 | 0.481 | 0.476 | 0.191 | OR487223 |
| ID-8470 | 132 | 9.0 | 0.909 | 0.450 | 4.575 | 16.00 | 0.726 | 0.608 | 0.694 | 0.163 | 0.158 | OR487224 |
| ID-9837 | 132 | 30.0 | 0.970 | 0.109 | 7.171 | 70.0 | 0.940 | 0.797 | 0.937 | 0.152 | 0.099 | OR487225 |
| ID-10585 | 132 | 29.0 | 0.902 | 0.206 | 7.139 | 72.0 | 0.912 | 0.882 | 0.906 | 0.033 | 0.448 | OR487226 |
| ID-10656 | 132 | 9.0 | 0.992 | 0.351 | 4.801 | 21.00 | 0.761 | 0.809 | 0.724 | −0.063 | 0.506 | OR487227 |
| ID-10751 | 132 | 9.0 | 0.939 | 0.484 | 4.782 | 24.00 | 0.712 | 0.548 | 0.685 | 0.230 | 0.316 | OR487228 |
| Mean | 132 | 17.5 | 0.927 | 0.368 | 5.528 | 36.25 | 0.774 | 0.648 | 0.753 | 0.179 | 0.259 |
| Population | Sign Test | Wilcoxon Signed-Rank Test | Mode-Shift | ||||
|---|---|---|---|---|---|---|---|
| IAM | SMM | TPM | IAM | SMM | TPM | ||
| 1. Chuncheon | 0.594171 | 0.050892 | 0.402965 | 0.320313 | 0.902344 | 0.679688 | normal L-shaped distribution |
| 2. Namyangju | 0.105642 | 0.047632 | 0.391701 | 0.027344 | 0.808594 | 0.421875 | normal L-shaped distribution |
| 3. Pyeongtaek | 0.061084 | 0.000566 | 0.049133 | 0.843750 | 1.000000 | 0.994141 | normal L-shaped distribution |
| 4. Yesan | 0.583337 | 0.054384 | 0.430325 | 0.421875 | 0.962891 | 0.628906 | normal L-shaped distribution |
| 5. Cheongju | 0.589741 | 0.415170 | 0.391242 | 0.527344 | 0.875000 | 0.726563 | normal L-shaped distribution |
| 6. Sangju | 0.298618 | 0.299220 | 0.324651 | 0.125000 | 0.273438 | 0.125000 | normal L-shaped distribution |
| 7. Iksan | 0.409362 | 0.008122 | 0.171387 | 0.527344 | 0.986328 | 0.902344 | normal L-shaped distribution |
| 8. Yeongcheon | 0.101893 | 0.172219 | 0.599634 | 0.027344 | 0.843750 | 0.320313 | normal L-shaped distribution |
| 9. Ulsan | 0.309899 | 0.182932 | 0.594675 | 0.037109 | 0.902344 | 0.421875 | normal L-shaped distribution |
| 10. Jinju | 0.314007 | 0.160451 | 0.593542 | 0.009766 | 0.679688 | 0.156250 | normal L-shaped distribution |
| 11. Naju | 0.179591 | 0.000727 | 0.176233 | 0.843750 | 1.000000 | 0.980469 | normal L-shaped distribution |
| Population | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1. Chuncheon | 0 | ||||||||||
| 2. Namyangju | 0.02227 | 0 | |||||||||
| 3. Pyeongtaek | 0.03046 | 0.03759 * | 0 | ||||||||
| 4. Yesan | 0.04217 | 0.05330 ** | 0.00286 | 0 | |||||||
| 5. Cheongju | 0.06120 * | 0.05590 * | 0.02020 | 0.00069 | 0 | ||||||
| 6. Sangju | 0.07474 ** | 0.05067 ** | 0.00956 | 0.00482 | 0.02174 | 0 | |||||
| 7. Iksan | 0.03419 | 0.05117 * | −0.00782 | 0.02271 | 0.02654 | 0.01430 | 0 | ||||
| 8. Yeongcheon | 0.04913 * | 0.05586 ** | −0.00008 | 0.01149 | 0.00828 | 0.02349 | 0.01403 | 0 | |||
| 9. Ulsan | 0.07820 ** | 0.06249 ** | 0.02343 | 0.04751 * | 0.08121 ** | 0.03216 | 0.03425 | 0.03930 | 0 | ||
| 10. Jinju | 0.01695 | 0.07333 ** | −0.00011 | 0.00441 | 0.04889 * | 0.03466 | 0.01915 | 0.04082 | 0.05357 * | 0 | |
| 11. Naju | 0.06649 * | 0.04733 * | −0.00638 | 0.00992 | −0.01174 | −0.00914 | −0.00541 | 0.01226 | 0.05761 * | 0.02671 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kang, A.R.; Park, J.S.; Kim, M.J.; Song, J.-H.; Pyo, J.-Y.; Kim, I. Population Genetic Characterization of the Pear Pest, Cacopsylla jukyungi (Kwon, 1983) (Hemiptera: Psyllidae), Using Novel Microsatellite Markers. Agronomy 2023, 13, 2710. https://doi.org/10.3390/agronomy13112710
Kang AR, Park JS, Kim MJ, Song J-H, Pyo J-Y, Kim I. Population Genetic Characterization of the Pear Pest, Cacopsylla jukyungi (Kwon, 1983) (Hemiptera: Psyllidae), Using Novel Microsatellite Markers. Agronomy. 2023; 13(11):2710. https://doi.org/10.3390/agronomy13112710
Chicago/Turabian StyleKang, Ah Rang, Jeong Sun Park, Min Jee Kim, Jang-Hoon Song, Jee-Young Pyo, and Iksoo Kim. 2023. "Population Genetic Characterization of the Pear Pest, Cacopsylla jukyungi (Kwon, 1983) (Hemiptera: Psyllidae), Using Novel Microsatellite Markers" Agronomy 13, no. 11: 2710. https://doi.org/10.3390/agronomy13112710
APA StyleKang, A. R., Park, J. S., Kim, M. J., Song, J.-H., Pyo, J.-Y., & Kim, I. (2023). Population Genetic Characterization of the Pear Pest, Cacopsylla jukyungi (Kwon, 1983) (Hemiptera: Psyllidae), Using Novel Microsatellite Markers. Agronomy, 13(11), 2710. https://doi.org/10.3390/agronomy13112710

