Next Article in Journal
Enhancement of Rose Scented Geranium Plant Growth, Secondary Metabolites, and Essential Oil Components through Foliar Applications of Iron (Nano, Sulfur and Chelate) in Alkaline Soils
Previous Article in Journal
Design of the Mechanical Structure of a Field-Based Crop Phenotyping Platform and Tests of the Platform
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects and Molecular Mechanism of Mycorrhiza on the Growth, Nutrient Absorption, Quality of Fresh Leaves, and Antioxidant System of Tea Seedlings Suffering from Salt Stress

1
Henan Key Laboratory of Tea Plant Comprehensive Utilization in South Henan, Xinyang Agriculture and Forestry University, Xinyang 464000, China
2
Jingzhou Institute of Technology, Jingzhou 434025, China
*
Author to whom correspondence should be addressed.
Agronomy 2022, 12(9), 2163; https://doi.org/10.3390/agronomy12092163
Submission received: 12 August 2022 / Revised: 8 September 2022 / Accepted: 8 September 2022 / Published: 11 September 2022

Abstract

We studied changes in plant growth, nutrient absorption, quality of fresh leaves, and the antioxidant enzyme systems of leaves treated with AMF (Glomus etunicatum) in tea (tea cultivar “Xinyang 10”) seedlings exposed to 0 and 100 mmol/L sodium chloride (NaCl). The AMF colonization in the tea roots decreased observably by 50.1% after a 5-week soil NaCl (100 mmol/L) treatment. The growth, leaf nutrient levels, and leaf quality parameter contents significantly declined by 18–39% in the 100 mmol/L NaCl treatments. In contrast, these variables exhibited observably higher responses in the mycorrhizal seedlings than in the nonmycorrhizal seedlings. Furthermore, AMF improved the leaves’ total amino acid concentrations dramatically, accompanied by the upregulation of the genes of the amino acid synthetic enzymes, such as glutamate dehydrogenase (CsGDH), glutamate synthase (CsGOGAT), and glutamine synthetase (CsGS), while 100 mmol/L NaCl seedlings represented a negative performance. In addition, the 100 mmol/L NaCl treatments dramatically downregulated the expression level of the tea caffeine synthase 1 gene (CsTCS1), the ascorbate peroxidase gene (CsAPX), and the 3-hydroxy-3-methylglutaryl coenzyme gene (CsHMGR) in the leaves, while the AMF seedlings represented positive performances. These results suggest that AMF may play an active role in fresh leaf quality via the partial upregulation of the relevant genes’ expression. In contrast, salt stress represented the opposite result in tea. The seedlings inoculated with AMF showed significantly increased antioxidant enzyme activities, by 13.3–19.6%, including peroxidase (POD), catalase (CAT), and superoxide dismutase (SOD), over the non-AMF inoculated tea seedlings. Still, they did not affect glutathione reductase (GR), irrespective of the NaCl condition. Further studies indicated that AMF observably upregulated the genes’ expressions (i.e., CsCAT and CsSOD) in both the 0 and 100 mmol/L NaCl seedlings. Meanwhile, the 100 mmol/L NaCl seedlings represented markedly lower antioxidant enzyme activities (i.e., SOD, CAT, and POD) and gene expressions (i.e., CsSOD and CsCAT) than the non-NaCl seedlings, irrespective of AMF inoculation. These results imply that AMF has a positive role in strengthening salt tolerance and on the quality of fresh tea leaves.

1. Introduction

As an important economic plant, tea (Camellia sinensis (L.) O. Kuntze) is consumed in 160 countries [1,2]. The tea plant is an ombrophyte, principally grown in subtropical and tropical areas of Asia, such as China, India, and Japan, and it is often influenced by temperature, soil, rain, stresses, and other natural environmental factors [3,4]. The most common soil encountered is saline–alkali soil (salt stress), an adverse natural environmental factor that severely impairs the tea plant’s normal growth and limits the food quality of its leaves in many areas [5,6]. In particular, the frequency and intensity of salt stress are becoming more serious every day [5,7]. Thus, it is essential to understand the effects and mechanisms of salt stress tolerance in tea through several strategies to enhance its resistance and adaptability.
As a symbiotic association is formed between arbuscular mycorrhizal fungi (AMF) and plant roots, arbuscular mycorrhiza (AM) can mitigate the negative effects of biotic and abiotic stresses on plant growth [8,9]. As reported by Wu et al. [10], who carried out a study to characterize the AMF diversity in the roots and rhizosphere of 20-year-old tea, AMF could increase tea plant growth. Therefore, AMF has the potential to improve the stress tolerance (such as salt tolerance) of tea plants. However, the effects and mechanism of AMF on seedling growth and the quality of fresh tea leaves under salt stress are still unknown.
Salt stress is perceived by plants through a series of protection mechanisms including the reactive oxygen (ROS) signaling pathway, mitogen-activated protein kinase (MAPK) cascades, the Ca2+ mediated signaling pathway, and the K+ and Na+ mediated signaling pathway [5,11,12]. As a secondary messenger, the Ca2+ signaling network plays an important role in managing salt stress in plants. In the plant kingdom, Ca2+ is essential for maintaining favorable ion ratios (such as the K+/Na+ ratio) in the cell to handle salt stress [13]. The improvement effects of mycorrhiza on salt stress could be explained by relevant mechanisms including improved water and nutrient absorption by the host plants, an enhanced Ca2+ signaling pathway, better osmotic adjustment, a higher K+/Na+ ratio, an enhanced antioxidant system (superoxide dismutase, peroxidase, catalase, ascorbate peroxidase, etc.), and molecular changes [14,15]. Furthermore, AMF could extend their extraradical hyphae for nutrient and water acquisition by the roots in the soil, which could alleviate the effects of salt stress [16,17,18,19]. Zou et al. [20] reported a strategy used by AMF to increase the root hair length and density under abiotic stress to strengthen the absorption of water and nutrients. Mathur et al. [21] proved that arbuscular mycorrhizal fungi enhanced plants’ photosynthetic efficiency in resisting abiotic stress. Hence, AMF can regulate a plant’s root system configuration and photosynthesis, which is an essential factor affecting water and nutrient absorption and the assimilation product level, in addition to enhancing a plant’s stress resistance such as salt resistance.
The effect of AMF on enhancing plant growth and stress resistance has generally been considered within the realm of the plant kingdom, including tea plants [22]. However, the effects and mechanism of AMF in improving tea plant growth and enhancing resistance, such as salt resistance, are still not fully known. The information regarding the antioxidant enzyme activities of tea plants by AMF inoculation under salt stress is not sufficiently clear, and the physiological and molecular mechanisms of AMF in improving tea salt resistance needs to be further explored [22]. Thus, the purpose of this research was to assess the role of AMF in tea plant growth, nutrient absorption, leaf food quality, and the antioxidant system under salt stress. Furthermore, the molecular mechanism was analyzed by detecting related gene expressions. In this way, the results may set a new strategy for future AMF application in production, to cope with salt stress and improve leaf quality and yield in the tea industry.

2. Materials and Methods

2.1. Experimental Design

This experiment consisted of 4 treatments: inoculation without AMF + 0 mmol/L NaCl (Control + 0 mmol/L NaCl); inoculation with AMF (Glomus etunicatum) + 0 mmol/L NaCl (AMF + 0 mmol/L NaCl); inoculation without AMF + 100 mmol/L NaCl (Control + 100 mmol/L NaCl); and inoculation with AMF (Glomus etunicatum) + 100 mmol/L NaCl (AMF + 100 mmol/L NaCl). Each treatment had four replicates of 12 pots of seedlings with 3 seedlings in each pot.

2.2. AMF Processing and Plant Culture

The AMF (Glomus etunicatum) was provided by China Agricultural University, Beijing, China. The Glomus etunicatum showed a positive effect on the growth of tea based on the results of Sun et al. [23].
Clone seedlings of C. sinensis cv. Xinyang 10 were provided by Xinyang Agriculture and Forestry University, Xinyang, China. The seedlings were transplanted into 3.5 L pots with a uniform size and grown in a glasshouse at the Xinyang Agriculture and Forestry University, Xinyang, China. Each pot contained 3.5 kg of autoclaved sand (0.12 MPa, 121 °C, 1 h), and 350 g (including approximately 2000 spores) of mycorrhizal inoculum was applied to the inoculated pots during the transplanting stage.
All pots were put in the glasshouse (Shanghai Zhiyu Greenhouse Engineering Co., Ltd., Shanghai, China) for 14 weeks. After treatment for 9 weeks, salt stress was begun (5 weeks). Each pot was irrigated with 100 mL Hoagland solution (pH 5.2) each day. The basic culture of Hoagland solution refers to the strategy of Zhang et al. [24] (i.e., 4.00 mmol/L Ca (NO3)2·4H2O, 6.02 mmol/L KNO3, 2.02 mmol/L MgSO4·7H2O, 1.00 mmol/L NH4H2PO4, 46.00 μmol/L H3BO3, 9.02 μmol/L MnCl2·4H2O, 0.82 μmol/L ZnSO4·7H2O, 0.32 μmol/L CuSO4·3H2O, 0.13 μmol/L H2MoO4, and 50 mmol/L EDTA-Fe, pH 5.85–6.25).

2.3. Variable Determinations

Plant height and taproot length were determined using a ruler, while the leaf area was determined by Image soft (National Institutes of Health, Washington, DC, USA; http://rsb.info.nih.gov/ij, accessed on 8 June 2022). The biomasses of the shoot and root were measured using an electronic scale. The leaves of the tea seedlings were immediately frozen at −80 °C for analysis of the physiological and molecular indicators (i.e., nutrient contents, quality parameter contents, activities of the antioxidant system, and the expression of genes), based on studies by Shao et al. [22] and Sun et al. [23].
Tea root mycorrhizas were calculated based on a study by Liu et al. [2]. Two-centimeter-long root segments per seedling were cleaned with 10% KOH solution at 95 °C for 1.4 h and then stained with 0.05% trypan blue in lactophenol for 6 min. The root mycorrhizal colonization rate was calculated as the percentage of mycorrhizal-infected root length against the total observed root length.
The relative expression of genes in the tea leaves was analyzed using real-time quantitative PCR (qRT-PCR). Frozen leaf samples were put in liquid nitrogen. The leaves’ total RNA was extracted using Trizol reagent (Invitrogen, Fairfield, OH, USA). After DNase treatment, total RNA was reverse-transcribed to cDNA using the PrimeScript RT reagent kit (TaKaRa, Tokyo, Japan). DNase I (TaKaRa, Tokyo, Japan) was added to remove genomic DNA. Relative expression was determined by qRT-PCR in an ABI Q7 Real-time PCR system (Applied Biosystems, Fairfield, OH, USA), using the intercalation dye SYBR Green as a fluorescent reporter. The qRT-PCR was performed with the following protocol: one cycle at 95 °C for 10 min, followed by 38 amplification cycles at 95 °C for 16 s, 57 °C for 30 s, and 72 °C for 30 s [25]. The primers for the selected genes were designed based on Camellia sinensis cDNA sequences (http://tpdb.shengxin.ren, accessed on 18 June 2022) by Primer Premier 6.25, which are shown in Table 1. The GADPH (housekeeping gene) acted as the control, and quantification of the gene expression was performed using the 2−ΔΔCt method [26].

2.4. Statistical Analysis

The data were statistically analyzed by ANOVA (SAS Software, version 9.1.3, Chicago, IL, USA), and the significant differences between treatments were compared with Duncan’s multiple range tests at p < 0.05.

3. Results

3.1. Plant Growth Performance and Root Mycorrhizal Colonization

NaCl blocked the growth of tea plants, while AMF represented an observable positive effect (Figure 1). Plant height, leaf area, taproot length, and biomass of the shoot and root decreased in the 100 mmol/L NaCl treatments dramatically compared to the 0 mmol/L NaCl treatments, irrespective of AMF inoculation (Table 2). Compared with the non-AMF seedlings, AMF significantly increased plant height by 22.6% and 24.9%, leaf area by 18.6% and 16.9%, taproot length by 17.4% and 5.6%, root biomass by 21.2% and 12.6%, and shoot biomass by 18.9% and 16.5% under non-salt stress and salt stress, respectively (Table 2). Based on the data in Table 2, the seedlings inoculated with AMF had 40.56% and 20.23% root mycorrhizal colonization under non-salt stress and salt stress (Figure 2). The hyphae and spores were clear and distinct under non-salt stress and salt stress, as shown in Figure 2.

3.2. Changes in the Leaves’ Nutrients

Compared to the non-AMF leaves, the N, P, K, Ca, and Mg contents of the tea leaves increased dramatically by 33.3% and 22.9%, 32.8% and 20.3%, 12.1% and 17.6%, 26.4% and 43.3%, and 19.5% and 24.7%, with inoculation by Glomus etunicatum under the non-salt stress and salt stress conditions, respectively (Table 3). However, AMF had no significant effect on the Fe content of the tea leaves. Furthermore, except for Fe, the levels of N, P, K, Ca, and Mg decreased obviously in the 100 mmol/L NaCl treatment, compared to the non-NaCl treatment in the non-AMF-inoculated tea leaves (Table 3). However, only the levels of N, P, and K in leaves decreased in the 100 mmol/L NaCl treatment, compared to the 0 mmol/L NaCl treatment under an AMF-inoculated status.

3.3. Changes in the Leaves’ Food Quality

Leaf fructose, glucose, tea polyphenol, and total amino acid contents were considerably lower in 100 mmol/L NaCl seedlings than in 0 mmol/L NaCl seedlings, regardless of AMF inoculation, except for sucrose, catechin, and flavonoid contents (Figure 3). AMF inoculation conferred significantly favorable effects on leaf quality parameter contents in the “Xinyang 10” seedlings, especially for the sucrose, catechin, and flavonoid contents. Compared with the non-AMF seedlings, the AMF plants represented 22.2–27.0% significantly higher leaf sucrose contents, 34.3–35.9% higher leaf catechin contents, and 71.4–75.2% higher leaf flavonoid contents (Figure 3).
Compared with the non-AM plants, the AM plants (i.e., 0 and 100 mmol/L NaCl treatments) exhibited significantly higher contents of sucrose (12.7% and 22.2%), fructose (20.7% and 30.1%), glucose (15.1% and 27.3%), tea polyphenols (16.4% and 41.5%), total amino acids (25.1% and 22.6%), catechin (16.8% and 34.3%), and flavonoid (35.2% and 71.4%), respectively (Figure 3). This suggests that mycorrhizal symbiosis can improve the quality of tea leaves, while salt stress represents the opposite effect.

3.4. Changes in the Antioxidant Enzyme Activities

Figure 4 shows the leaf activities of SOD, POD, CAT, and GR in this study. Compared to the non-salt treatment, 100 mmol/L NaCl markedly decreased the activities of the leaves’ CAT, POD, and SOD activity but had no significant effect on the leaves’ GR activity, both in the non-AM and AM plants (Figure 4). In detail, arbuscular mycorrhizal fungi triggered notably higher leaf SOD, POD, and CAT activity, by 15.3%, 23.4%, and 12.4% under a 0 mmol/L NaCl condition and by 19.9%, 17.8%, and 16.6% under a 100 mmol/L NaCl condition, respectively (Figure 4). However, there were no significant differences in GR activity among the four treatments in the seedlings’ leaves.

3.5. Changes in Leaf CsHMGR, CsAPX, CsGS, CsGDH, CsGOGAT, and CsTCS1 Expression Levels

Compared to the non-AMF treatments, the expression of the relative genes (i.e., CsGDH, CsGOGAT, and CsGS) was markedly upregulated by 1.51, 2.41, and 2.02 times in the tea seedlings after treatment with AMF in the 0 mmol/L NaCl condition and by 1.71, 2.81, and 2.25 times with AMF in the 100 mmol/L NaCl condition, respectively (Figure 5). In regard to the salt stress, 100 mmol/L NaCl markedly downregulated the genes’ expression (CsGDH, CsGOGAT, and CsGS) by 25.1%, 40.2%, and 35.9% in the non-AMF-inoculated status and by 20.1%, 46.7%, and 30.5% in the AMF-inoculated status, respectively (Figure 5).
Salt stress also inhibited the expression of CsTCS1, CsAPX, and CsHMGR in the tea leaves to different degrees, while AMF induced in them a notably high expression. Compared with the expression after the non-AMF treatments, the expression of the relative genes (i.e., CsTCS1, CsAPX, and CsHMGR) was markedly upregulated by 2.48, 2.12 m, and 1.36 times after treatment by AMF in the 0 mmol/L NaCl condition and by 1.02, 0.85, and 1.01 times with AMF under salt stress, respectively (Figure 5). Furthermore, 100 mmol/L NaCl downregulated the genes’ relative expression (i.e., CsHMGR, CsAPX, and CsTCS1) by 48.1%, 45.2%, and 35.8% in the non-AMF-inoculated status and by 50.6%, 47.6%, and 11.2% in the AMF-inoculated status, respectively (Figure 5).

3.6. Changes in Leaf CsCAT and CsSOD Expression Levels

Comparing the non-salt stress seedlings, the salt stress markedly downregulated the genes’ relative expression (i.e., CsSOD and CsCAT) by 73.2% and 60.2% and 49.3% and 25.6% in the non-AMF and AMF inoculated seedlings, respectively (Figure 6). Furthermore, the genes’ expressions (i.e., CsSOD and CsCAT) were upregulated by 1.52 and 2.41 times under the 0 mmol/L NaCl condition and by 2.42 and 3.82 times under the 100 mmol/L NaCl condition after AMF inoculation, respectively (Figure 6).

4. Discussion

Salt stress, a major agricultural problem worldwide, has adverse effects on plants’ development, growth, and yields. The inhibitory effect of salt stress on the development and growth of tea plants was observed in this study. Both root and shoot biomass decreased dramatically in the salt groups compared to the normal groups (non-saline). Similar results have also been observed in wheat, maize, and rice under salt conditions [27,28]. Arbuscular mycorrhizal fungi (AMF) could have a symbiotic association formed with 80% of terrestrial plant roots, helping them develop tolerance against stress factors such as salt [29]. In this study, tea plant growth increased with AMF, indicating that AMF plays a positive role in the host plant, enhancing its salinity tolerance. This enhancing effect of AMF could be explained by relevant mechanisms including increasing plant biomass, a higher K+/Na+ ratio, improved nutrition of plants root, better stomatal conductance and osmotic adjustment, enhancement of the antioxidant protected systems, and transcription factor regulation [30]. Furthermore, salt stress decreased root AMF colonization over the non-saline group in the tea plants, which is in line with the earlier results reported by He et al. [31], who observed a significant decrease in mycorrhizal colonization in citrus under salt conditions. Salt stress can cause a water deficit in plants, which could block AMF spore germination and restrict its colonization and extension.
The negative effects of salinity on nutrient uptake in plants has been proven in many studies [32,33]. The reason for this adverse effect is due to the increased osmotic potential and the toxicity of sodium (Na+) and chloride (Cl) ions [34]. High concentrations of Na+ and Cl in the soil suppress nutrient ion activities and mess up the nutrient ratios by producing extreme ratios, which ultimately results in the inhibition of the absorption and transport of nutrients [35]. This study not only confirmed that salt stress decreased the levels of N, K, Ca, P, and Mg in the tea leaves but clarified that AMF increased them observably. This increasing effect is in accordance with an earlier study by Sun et al. [23], who considered that AMF inoculation heavily the increased the leaf nutrient content in tea. In the public eye, AMF could generate the hyphae network. It can help the host plant’s roots absorb nutrients and improve their range, not only in leaves but also in other tissues in the plant [36,37].
The contents of sucrose, fructose, and glucose are of great value for tea food quality [38]. In this study, salinity tea seedlings had lower leaf sucrose, fructose, and glucose contents, while the mycorrhization plant manifested higher effects. A similar result was proven by Wu et al. [39] in citrus and by Shao et al. [25] in tea, for sucrose and glucose contents. An earlier study showed that mycorrhizal colonization was positively correlated with glucose, fructose, and sucrose levels in the leaves of tea seedlings [25]. Such an increase in sugar (i.e., glucose, fructose, and sucrose) under AMF inoculation may be on account of the improved nutrition and mycorrhiza-requested carbon [25,40].
Tea leaves’ food quality is connected with several biochemical substances such as flavor, aroma characteristic, and liquor [41]. In this study, salt stress significantly reduced the levels of tea polyphenols, total amino acids, catechin, and flavonoid, while these levels were observably improved with the inoculation by AMF. Tea catechin, polyphenols, and flavonoid have potent antioxidant activities, which have multiple health benefits including enhanced antineoplastic effects and general wellbeing [42,43]. Polyphenols in tea, as the main secondary metabolism, protect against the cellular damage caused by oxidative stress and immunity enhancement [42]. Zhao et al. [44] showed that inoculation with AMF (G. mosseae) increased the total polyphenols in tea, which is consistent with this study. Amino acids, as essential factors in tea food quality, were reduced by the salt treatment and induced by AMF in this study. In cocoa (Theobroma cacao), mycorrhizal seedlings represented higher amino acid contents in leaves [45]. Tomato and tea roots had higher levels of total amino acids when inoculated with AMF [25,46]. A previous study showed that germinating spores of AMF can use nitrogen sources for the de novo biosynthesis of amino acids, which could increase its level [47]. As an AM signaling compound [48], flavonoid could be induced by AM symbiosis in this study in tea seedlings, which is in agreement with the results reported by Zubek et al. [46], in Viola tricolor plants, indicating that AMF increased root flavonoid content. Therefore, this concludes that salt stress seriously hindered the accumulation of secondary metabolites, but AMF heavily accelerated them in tea plants. The relevant mechanisms may be revealed by molecular biology and metabolomics in future works.
One study showed that the expressions of GDH, GOGAT, and GS are related to amino acid concentrations [25]. In this study, salt stress downregulated the expression level of leaf CsGDH, CsGOGAT, and CsGS dramatically, while mycorrhizal inoculation upregulated them observably. This is consistent with the results presented by Shao et al. [25]. In tea plants, the expression of CsGDH was positively related to the content of theanine [49]. Therefore, higher expression of CsGDH, CsGOGAT, and CsGS may accelerate amino acids generation in tea seedlings in this work. Thus, salt stress downregulated CsGDH, CsGOGAT, and CsGS expression levels, while AMF upregulated them to accommodate amino acid biosynthesis and its levels.
As the first rate-limiting enzyme in the mevalonate pathway, HMGR mainly impacts terpene’s metabolism in plants [25]. APX, as the primary enzyme for removing ROS, could enhance plant stress resistance [50]. Natural allelic variations of TCS1 have been reported to play a crucial part in the regulation of caffeine biosynthesis and metabolism [51]. In the present study, saline treatment significantly downregulated the relative expression of leaf CsTCS1, CsAPX, and CsHMGR, while mycorrhizal inoculation upregulated them dramatically in tea seedlings, which agrees with the results reported by Shao et al. [25] in tea plants, indicating that salt stress and AM symbiosis regulated related genes’ expression and affected terpene and caffeine levels and the adverse resistance of plants.
In terms of the antioxidant system, salt stress could regulate ROS homeostasis, lipid peroxidation, and the antioxidant mechanisms induced, which destroys the balance between ROS quenching and generation [52]. In this work, AMF induced the activities of POD, SOD, and CAT accompanied by a strengthening of the antioxidant enzymes system, but salt stress weakened them in the leaves of tea. These views are consistent with the results reported by Zhu et al. [53] in Zea mays and by He et al. [54] in citrus and [52] Pinus pinaster, indicating that AMF could maintain a dynamic balance between ROS production and elimination, thus reducing the damage from membrane lipid peroxidation when salt stress breaks this balance, inducing damage. He et al. [54] considered that mycorrhiza prioritization provoked the overexpression of the antioxidant enzymes under abiotic stress and led to a low level of ROS in plants.
AM may respond to abiotic stress by regulating various genes of antioxidant enzymes [55]. In this research, salt stress markedly downregulated the expressions of CsCAT and CsSOD, while AMF induced them dramatically in the leaves of tea plants. This is in line with a study on citrus, indicating that salt stress may reduce the expression of the SOD isoenzyme and CAT genes, thereby inducing oxidative stress and membrane lipid peroxidation damage, while AMF plays a positive role [54,56]. In carrot, AMF (Glomus intraradices) upregulated the expression of GintSOD, which regulates SOD biosynthesis to maintain its function in the ROS scavenging system [57]. In the tea plant, whether fungal antioxidant enzyme genes have similar functions needs to be further investigated by molecular biology, as even the dialogue network between plants and AMF in alleviating ROS burst under salt stress is complex.

5. Conclusions

The present study demonstrated that tea root AMF colonization was significantly reduced by NaCl. Plant growth, leaf nutrients, and the quality of fresh leaves dramatically decreased when exposed to salinity. In contrast, these variables exhibited observably higher responses in mycorrhizal seedlings than in non-AMF seedlings. Furthermore, AMF obviously increased the leaf total amino acid concentrations, accompanied by the upregulation of amino acid synthetic enzymes genes. In addition, the NaCl treatments dramatically downregulated the expression levels of CsTCS1, CsAPX, and CsHMGR in the leaves, while AMF seedlings represented positive performances. Therefore, AMF plays a positive role in the quality of fresh leaves, partly utilizing the upregulation of relevant gene expressions, while salt stress represents the opposite result. The AMF seedlings presented significantly higher antioxidant enzyme activities than the non-AMF seedlings. Still, they did not affect GR, irrespective of the NaCl condition. This indicates that AMF observably upregulated the relative expression of CsCAT and CsSOD. Meanwhile, the NaCl seedlings markedly lowered the antioxidant enzyme activities and relative genes’ expressions than the non-NaCl seedlings, irrespective of AMF inoculation. Thus, AMF plays a positive role in strengthening salt tolerance and the quality of fresh tea leaves.

Author Contributions

Conceptualization, Y.-W.L.; data curation, C.-L.T.; formal analysis, Y.-W.L.; funding acquisition, M.-F.S.; investigation, C.-L.T.; project administration, M.-F.S.; supervision, M.-F.S.; writing, Y.-W.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Key R&D and Promotion (Scientific and Technological Breakthrough) Special Project of Henan Province (212102110117, Xinyang Agriculture and Forestry University) and the Science and Technology Innovation Team Project of Xinyang Agriculture and Forestry University (KJCXTD-202003, Xinyang Agriculture and Forestry University).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ding, Z.T.; Jia, S.S.; Wang, Y.; Xiao, J.; Zhang, Y.F. Phosphate stresses affect ionome and metabolome in tea plants. Plant Physiol. Biochem. 2017, 120, 30–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Liu, C.Y.; Wang, Y.J.; Wu, Q.S.; Yang, T.Y.; Kuča, K. Arbuscular mycorrhizal fungi improve the antioxidant capacity of tea (Camellia sinensis) Seedlings Under Drought Stress. Not. Bot. Horti Agrobot. Cluj-Napoca 2020, 48, 1993–2005. [Google Scholar] [CrossRef] [Scilit]
  3. Wang, Y.; Fan, K.; Wang, J.; Ding, Z.T.; Wang, H.; Bi, C.H.; Zhang, Y.W.; Sun, H.W. Proteomic analysis of Camellia sinensis (L.) reveals a aynergistic network in the response to drought stress and recovery. J. Plant Physiol. 2017, 219, 91–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Sharma, D.; Kayang, H. Effects of arbuscular mycorrhizal fungi (AMF) on Camellia sinensis (L.) O. Kuntze under greenhouse conditions. J. Exp. Biol. 2017, 5, 235–241. [Google Scholar] [CrossRef] [Scilit]
  5. Wan, S.Q.; Wang, W.D.; Zhou, T.S.; Zhang, Y.H.; Chen, J.F.; Xiao, B.; Yang, Y.J.; Yu, Y.B. Transcriptomic analysis reveals the molecular mechanisms of Camellia sinensis in response to salt stress. Plant Growth Regul. 2018, 84, 481–492. [Google Scholar] [CrossRef] [Scilit]
  6. Hu, C.H.; Zheng, Y.; Tong, C.L.; Zhang, D.J. Effects of exogenous melatonin on plant growth, root hormones and photosynthetic characteristics of trifoliate orange subjected to salt stress. Plant Growth Regul. 2022, 97, 551–558. [Google Scholar] [CrossRef] [Scilit]
  7. Upadhyaya, H.; Panda, S.K. Abiotic stress responses in tea [Camellia sinensis L (O) Kuntze]: An overview. Rev. Agric. Sci. 2013, 1, 1–10. [Google Scholar] [CrossRef] [Scilit]
  8. Bothe, H. Arbuscular mycorrhiza and salt tolerance of plants. Symbiosis 2012, 58, 7–16. [Google Scholar]
  9. Malik, J.A.; Alqarawi, A.; Dar, B.A.; Hashem, A.; Alshahrani, T.S.; AlZain, M.N.; Habib, M.M.; Javed, M.M.; Abd_Allah, E.F. Arbuscular mycorrhizal fungi isolated from highly saline “Sabkha Habitat” soil alleviated the nacl-induced stress and improved Lasiurus scindicus Henr. growth. Agriculture 2022, 12, 337. [Google Scholar] [CrossRef] [Scilit]
  10. Wu, Q.S.; Shao, Y.D.; Gao, X.B.; Xia, T.J.; Kuca, K. Characterization of AMF-diversity of endosphere versus rhizosphere of tea (Camellia sinensis) crops. Indian J. Agric. Sci. 2019, 89, 348–352. [Google Scholar]
  11. Qiao, S.; Feng, Y.; Yan, J.; Li, K.; Xu, H. Overexpression of tomato SlTpx improves salt stress tolerance in transgenic tobacco plants by scavenging H2O2. Plant Cell Tissue Organ Cult. 2022, 1–13. [Google Scholar] [CrossRef] [Scilit]
  12. Nguyen, H.; Bhowmik, S.D.; Long, H.; Cheng, Y.; Mundree, S.; Hoang, L. Rapid accumulation of proline enhances salinity tolerance in Australian wild rice Oryza australiensis Domin. Plants 2021, 10, 2044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Ji, H.T.; Pardo, J.M.; Batelli, G.; Van, O.M.J.; Bressan, R.A.; Li, X. The Salt Overly Sensitive (SOS) Pathway: Established and Emerging Roles. Mol. Plant 2013, 6, 275–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Wu, Q.S.; Zou, Y.N.; He, X.H. Mycorrhizal Symbiosis Enhances Tolerance to NaCl Stress Through Selective Absorption but not Selective Transport of K+ Over Na+ in Trifoliate Orange. Sci. Hortic. 2013, 160, 366–374. [Google Scholar] [CrossRef] [Scilit]
  15. Iwaniuk, P.; Lozowicka, B. Biochemical compounds and stress markers in lettuce upon exposure to pathogenic Botrytis cinerea and fungicides inhibiting oxidative phosphorylation. Planta 2022, 255, 61. [Google Scholar] [CrossRef] [Scilit]
  16. Hashem, A.; Alqarawi, A.A.; Al-Huqail, A.A.; AbdAllah, E.F. Biodiversity of Arbuscular Mycorrhizal Fungi Associated with Acacia Gerrardii Benth in Different Habitats of Saudi Arabia. Pak. J. Bot. 2018, 50, 1211–1217. Available online: https://www.cabdirect.org/cabdirect/abstract/20183259381 (accessed on 2 July 2020).
  17. Zou, Y.N.; Wu, H.H.; Giri, B.; Wu, Q.S.; Kuca, K. Mycorrhizal Symbiosis Down-Regulates or Does not Change Root Aquaporin Expression in Trifoliate Orange under Drought Stress. Plant Physiol. Biochem. 2019, 144, 292–299. [Google Scholar] [CrossRef] [Scilit]
  18. Cheng, X.-F.; Wu, H.-H.; Zou, Y.-N.; Wu, Q.-S.; Kuča, K. Mycorrhizal Response Strategies of Trifoliate Orange under Well-Watered, Salt Stress, and Waterlogging Stress by Regulating Leaf Aquaporin Expression. Plant Physiol. Biochem. 2021, 162, 27–35. [Google Scholar] [CrossRef] [Scilit]
  19. Mathur, S.; Tomar, R.S.; Jajoo, A. Arbuscular Mycorrhizal Fungi (AMF) Protects Photosynthetic Apparatus of Wheat under Drought Stress. Photosynth. Res. 2019, 139, 227–238. [Google Scholar] [CrossRef] [Scilit]
  20. Zou, Y.N.; Wang, P.; Liu, C.Y.; Ni, Q.D.; Zhang, D.J.; Wu, Q.S. Mycorrhizal Trifoliate Orange has Greater Root Adaptation of Morphology and Phytohormones in Response to Drought Stress. Sci. Rep. 2017, 7, 41134. [Google Scholar] [CrossRef] [Scilit]
  21. Mathur, S.; Sharma, M.P.; Jajoo, A. Improved Photosynthetic Efficacy of Maize (Zea mays) Plants with Arbuscular Mycorrhizal Fungi (AMF) under High Temperature Stress. J. Photochem. Photobiol. B Biol. 2018, 180, 149–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Shao, Y.D.; Zhang, D.J.; Hu, X.C.; Wu, Q.S.; Jiang, C.J.; Xia, T.J.; Gao, X.B.; Kuča, K. Mycorrhiza-Tnduced Changes in Root Growth and Nutrient Absorption of Tea Plants. Plant Soil Environ. 2018, 64, 283–289. [Google Scholar] [CrossRef] [Scilit]
  23. Sun, M.F.; Yuan, D.; Hu, X.C.; Zhang, D.J.; Li, Y.Y. Effects of Mycorrhizal Fungi on Plant Growth, Nutrient Absorption and Phytohormones Levels in Tea Under Shading Condition. Not. Bot. Horti Agrobot. Cluj-Napoca 2020, 48, 2006–2020. [Google Scholar] [CrossRef] [Scilit]
  24. Zhang, D.J.; Yang, Y.J.; Liu, C.Y.; Zhang, F.; Hu, W.; Gong, S.B.; Wu, Q.S. Auxin modulates root-hair growth through its signaling pathway in Citrus. Sci. Hortic. 2018, 236, 73–78. [Google Scholar] [CrossRef] [Scilit]
  25. Shao, Y.-D.; Zhang, D.-J.; Hu, X.-C.; Wu, Q.-S.; Jiang, C.-J.; Gao, X.-B.; Kuča, K. Arbuscular Mycorrhiza Improves Leaf Food Quality of Tea Plants. Not. Bot. Horti Agrobot. Cluj-Napoca 2019, 47, 608–614. [Google Scholar] [CrossRef] [Scilit]
  26. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-time Quantitative PCR and 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  27. Adillah, A.; Widada, J.; Kurniasih, B. Root Growth and Yield of Rice Plant Associated with Arbuscular Mycorrhizal Symbiosis under Salt Stress. In Proceedings of the 4th International Conference on Sustainable Agriculture (ICoSA 2021), Yogyakarta, Indonesia, 25–26 August 2021. [Google Scholar] [CrossRef] [Scilit]
  28. Kusale, S.P.; Attar, Y.C.; Sayyed, R.Z.; En, S.H.E.; Hanapi, S.Z.; Ilyas, N.; Ilyas, N.; Elgorban, A.; Bahkali, A.; Marraiki, N. Inoculation of Klebsiella Variicola Alleviated Salt Stress and Improved Growth and Nutrients in Wheat and Maize. Agronomy 2021, 11, 927. [Google Scholar] [CrossRef] [Scilit]
  29. Shahvali, R.; Shiran, B.; Ravash, R.; Fallahi, H.; Eri, B.B. Effect of Symbiosis with Arbuscular Mycorrhizal Fungi on Salt Stress Tolerance in gf677 (Peach × Almond) Rootstock. Sci. Hortic. 2020, 272, 109535. [Google Scholar] [CrossRef] [Scilit]
  30. Mokhtar, M.; Baslam, M.; Ben-Laouane, R.; Anli, M.; Abdelilah, M. Alleviation of Detrimental Effects of Salt Stress on Date Palm (Phoenix dactylifera L.) by the Application of Arbuscular Mycorrhizal Fungi and/or Compost. Front. Sustain. Food Syst. 2020, 4, 131. [Google Scholar] [CrossRef] [Scilit]
  31. He, J.D.; Li, J.L.; Wu, Q.S. Effects of Rhizoglomus Intraradices on plant growth and root endogenous hormones of trifoliate orange under salt stress. J. Anim. Sci. 2020, 29, 245–250. [Google Scholar]
  32. Alavi, S.A.; Ghehsareh, A.M.; Soleymani, A.; Panahpour, E. Enhanced nutrient uptake in salt-stressed mentha piperita using magnetically treated water. Protoplasma 2021, 258, 403–414. [Google Scholar] [CrossRef] [Scilit]
  33. Bellingrath-Kimura, S.D. Biochar amendments improve licorice (Glycyrrhiza uralensis Fisch.) growth and nutrient uptake under salt stress. Plants 2021, 10, 2135. [Google Scholar] [CrossRef] [Scilit]
  34. Khare, T.; Kumar, V.; Kishor, P. Na+ and Cl ions show additive effects under NaCl stress on induction of oxidative stress and the responsive antioxidative defense in rice. Protoplasma 2015, 252, 1149–1165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Singh, M.; Kumar, J.; Singh, V.P.; Prasad, S.M. Plant tolerance mechanism against salt stress: The nutrient management approach. Biochem. Pharmacol. 2014, 3, 165. [Google Scholar] [CrossRef]
  36. Zou, Y.N.; Zhang, F.; Srivastava, A.K.; Wu, Q.S.; Kuča, K. Arbuscular mycorrhizal fungi regulate polyamine homeostasis in roots of trifoliate orange for improved adaptation to soil moisture deficit stress. Front. Plant Sci. 2021, 11, 600792. [Google Scholar] [CrossRef] [Scilit]
  37. Wu, Q.S.; Srivastava, A.K.; Zou, Y.N. AMF-induced tolerance to drought stress in citrus: A review. Sci. Hortic. 2013, 164, 77–87. [Google Scholar] [CrossRef] [Scilit]
  38. Piyasena, K.G.N.P.; Hettiarachchi, L.S.K.; Jayawardhane, S.A.D.P.S.; Edirisinghe, E.N.U.; Jayasinghe, W.S. Evaluation of inherent fructose, glucose and sucrose concentrations in tea leaves (Camellia sinensis L.) and in black tea. Appl. Food Res. 2022, 2, 100100. [Google Scholar] [CrossRef] [Scilit]
  39. Wu, Q.S.; Lou, Y.G.; Li, Y. Plant growth and tissue sucrose metabolism in the system of trifoliate orange and arbuscular mycorrhizal fungi. Sci. Hortic. 2015, 181, 189–193. [Google Scholar] [CrossRef] [Scilit]
  40. Cely, M.V.T.; Oliveira, A.G.; Freitas, V.F.; Luca, M.B.; Barazetti, A.R.; Santos, I.M.O.; Gionco, B.; Garcia, G.V.; Prete, C.E.C.; Andrade, G. Inoculant of Arbuscular Mycorrhizal Fungi (Rhizophagus clarus) Increase Yield of Soybean and Cotton under Field Conditions. Front. Microbiol. 2016, 7, 720. [Google Scholar] [CrossRef] [Scilit]
  41. Singh, S.; Pandey, A.; Kumar, B.; Palni, L.M.S. Enhancement in Growth and Quality Parameters of Tea [Camellia sinensis (L.) O. Kuntze] through Inoculation with Arbuscular Mycorrhizal Fungi in an Acid Soil. Biol. Fertil. Soils 2010, 46, 427–433. [Google Scholar] [CrossRef] [Scilit]
  42. Vijay, S.T.; Karishma, G.; Sanjay, G. The Chemopreventive and Chemotherapeutic Potentials of Tea Polyphenols. Curr. Pharm. Biotechnol. 2012, 13, 191–199. [Google Scholar] [CrossRef] [Scilit]
  43. Kerio, L.C.; Wachira, F.N.; Wanyoko, J.K.; Rotich, M.K. Total Polyphenols, Catechin Profiles and Antioxidant Activity of Tea Products from Purple Leaf Coloured Tea Cultivars. Food Chem. 2013, 136, 1405–1413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Zhao, Q.H.; Sun, L.T.; Wang, Y.; Ding, Z.T.; Li, M. Effects of Arbuscular Mycorrhizal Fungi and Nitrogen Regimes on Plant Growth, Nutrient Uptake and Tea Quality in Camellia sinensis (L.) O. Kuntze. Plant Physiol. J. 2014, 50, 164–170, (In Chinese with English abstract). [Google Scholar]
  45. Tchameni, S.N.; Nwaga, D.; Wakam, L.N.; Ngonkeu, E.L.M.; Etoa, F.X. Growth Enhancement, Amino Acid Synthesis and Reduction in Susceptibility Towards Phytophthora Megakarya by Arbuscular Mycorrhizal Fungi Inoculation in Cocoa Plants. J. Phytopathol. 2012, 160, 220–228. [Google Scholar] [CrossRef] [Scilit]
  46. Zubek, S.; Rola, K.; Szewczyk, A.; Majewska, M.L.; Turnau, K. Enhanced concentrations of elements and secondary metabolites in Viola tricolor L. induced by arbuscular mycorrhizal fungi. Plant Soil 2015, 390, 129–142. [Google Scholar] [CrossRef] [Scilit]
  47. Gachomo, E.; Allen, J.W.; Pfeffer, P.E.; Govindarajulu, M.; Bücking, H. Germinating Spores of Glomus Intraradices can use Internal and Exogenous Nitrogen Sources for de Novo Biosynthesis of Amino Acids. New Phytol. 2009, 184, 399–411. [Google Scholar] [CrossRef] [Scilit]
  48. Pei, Y.; Evan, S.; Tian, B.; Ding, J. Root flavonoids are related to enhanced amf colonization of an invasive tree. AoB Plants 2020, 12, plaa002. [Google Scholar] [CrossRef] [Scilit]
  49. Lin, Z.H.; Zhong, Q.S.; Chen, C.S. Molecular Cloning and Quantitative Analysis of GDH, GS and GOGAT Genes from Leave of Tea Plant. J. Tea Sci. 2012, 32, 523–529. Available online: https://www.cabdirect.org/cabdirect/abstract/20133097775 (accessed on 4 July 2020).
  50. Elbasan, F.; Ozfidan-Konakci, C.; Yildiztugay, E.; Kucukoduk, M. Rare-earth element scandium improves stomatal regulation and enhances salt and drought stress tolerance by up-regulating antioxidant responses of Oryza sativa. Plant Physiol. Biochem. 2020, 152, 157–169. [Google Scholar] [CrossRef] [Scilit]
  51. Jin, J.Q.; Yao, M.Z.; Ma, C.L.; Ma, J.Q.; Chen, L. Natural Allelic Variations of TCS1 Play a Crucial Role in Caffeine Biosynthesis of Tea Plant and its Related Species. Plant Physiol. Biochem. 2016, 100, 18–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Ellouzi, H.; Oueslati, S.; Hessini, K.; Rabhi, M.; Abdelly, C. Seed-priming with H2O2 alleviates subsequent salt stress by preventing ROS production and amplifying antioxidant defense in cauliflower seeds and seedlings. Sci. Hortic. 2021, 288, 110360. [Google Scholar] [CrossRef] [Scilit]
  53. Zhu, X.; Song, F.; Liu, S. Arbuscular Mycorrhiza Impacts on Drought Stress of Maize Plants by Lipid Peroxidation, Proline Content and Activity of Antioxidant System. J. Food Agric. Environ. 2011, 9, 583–587. Available online: https://www.researchgate.net/publication/260055159 (accessed on 4 July 2020).
  54. He, J.D.; Zou, Y.N.; Wu, Q.S.; Kuča, K. Mycorrhizas Enhance Drought Tolerance of Trifoliate Orange by Enhancing Activities and Gene Expression of Antioxidant Enzymes. Sci. Hortic. 2020, 262, 108745. [Google Scholar] [CrossRef] [Scilit]
  55. Zou, Y.N.; Wu, Q.S.; Kuča, K. Unraveling the role of arbuscular mycorrhizal fungi in mitigating the oxidative burst of plants under drought stress. Plant Biol. 2021, 1, 50–57. [Google Scholar] [CrossRef] [Scilit]
  56. Zhang, F.; Zou, Y.N.; Wu, Q.S.; Kuča, K. Arbuscular mycorrhizas modulate root polyamine metabolism to enhance drought tolerance of trifoliate orange. Environ. Exp. Bot. 2020, 171, 103962. [Google Scholar] [CrossRef] [Scilit]
  57. González-Guerrero, M.; Oger, E.; Benabdellah, K.; Azcón-Aguilar, C.; Lanfranco, L.; Ferro, N. Characterization of a CuZn superoxide dismutase gene in the arbuscular mycorrhizal fungus Glomus intraradices. Curr. Genet. 2010, 56, 265–274. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Whole plant morphology in Camellia sinensis “Xinyang 10” seedlings treated with AMF under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
Figure 1. Whole plant morphology in Camellia sinensis “Xinyang 10” seedlings treated with AMF under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
Agronomy 12 02163 g001
Figure 2. Root mycorrhizal colonization in Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
Figure 2. Root mycorrhizal colonization in Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
Agronomy 12 02163 g002
Figure 3. Effects of AMF on the leaf quality parameter contents (mg/plant DW) of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Figure 3. Effects of AMF on the leaf quality parameter contents (mg/plant DW) of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Agronomy 12 02163 g003
Figure 4. Effects of AMF on leaf activities of SOD, POD, CAT, and APX in the leaves of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Figure 4. Effects of AMF on leaf activities of SOD, POD, CAT, and APX in the leaves of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Agronomy 12 02163 g004
Figure 5. Effects of AMF on the relative expression of leaf CsHMGR, CsAPX, CsGS, CsGDH, CsGOGAT, and CsTCS1 in Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Figure 5. Effects of AMF on the relative expression of leaf CsHMGR, CsAPX, CsGS, CsGDH, CsGOGAT, and CsTCS1 in Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Agronomy 12 02163 g005
Figure 6. Effects of AMF on the relative expression of leaf CsSOD and CsCAT in Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Figure 6. Effects of AMF on the relative expression of leaf CsSOD and CsCAT in Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions. The different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test).
Agronomy 12 02163 g006
Table 1. The specific primers of the relevant genes designed for the real-time quantitative PCR amplification.
Table 1. The specific primers of the relevant genes designed for the real-time quantitative PCR amplification.
Gene NameAccessionSequence (5′-3′)-ForwardSequence (5′-3′)-Reverse
CsHMGRKJ946250CTCTTCCTCCTCCTCCTCCTTTGTGCCCTTGGATAG
CsAPXEU547804TTCTATCAGTTGGCTGGAGTATGGTCACATCCCTTATCG
CsGSJN602372CTCAGAAGCAAAGCAAGGACACATCAGGGTGGCTGAAAAT
CsGDHJN602371AGCGGCAAATCATCCTACTTCGTCCCACATGAAACCTT
CsGOGATJN602373GCTTCAGGACGTTTTGGTGCATGATGTGGAGGTGGGGAT
CsTCS1AB031280TCCGTGTTATGTGATGGGAGATGATGTGGAGGTGGGGATA
CsCATKR819178.1TTTGATCTGGTGGGAAACAATCCAATTCTCCTGGATGTGA
CsSODAY694187.1TTTCAATCCTGCTGGCAAAGAATGGACAACAACGGCCCTACC
CsGADPHTEA003029TGGCATCGTTGAGGGTCCAGTGGGAACACGGAAAG
Table 2. Effects of AMF on the mycorrhizal colonization rate and plant growth of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
Table 2. Effects of AMF on the mycorrhizal colonization rate and plant growth of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
TreatmentMycorrhizal
Colonization Rate
(%)
Plant
Height
(cm)
Leaf Area
(cm2)
Taproot
Length
(cm)
Root Biomass (g FW/Plant)Shoot Biomass (g FW/Plant)
Control + 0 mmol/L NaCl/15.11 ± 1.23 b20.21 ± 1.49 b14.12 ± 1.08 b1.56 ± 0.12 b2.11 ± 0.18 b
AMF + 0 mmol/L NaCl40.56 ± 2.39 a18.52 ± 0.98 a23.96 ± 2.08 a16.58 ± 1.19 a1.89 ± 0.14 a2.51 ± 0.19 a
Control + 100 mmol/L NaCl/13.32 ± 1.14 c17.98 ± 1.18 c13.24 ± 1.11 bc1.35 ± 0.11 c1.88 ± 0.15 c
AMF + 100 mmol/L NaCl20.23 ± 1.18 b16.63 ± 1.41 b21.02 ± 1.85 b13.98 ± 1.12 b1.52 ± 0.11 b2.19 ± 0.21 b
ANOVANaCl***************
AMF**************
NaCl × AMF***nsnsnsns
Note: “/” Not detected; Data (mean ± SD; n = 6) followed by different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test). ** p < 0.05, *** p < 0.001, the same as below.
Table 3. Effects of AMF on leaf nutrient contents (mg/plant dry weight) of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
Table 3. Effects of AMF on leaf nutrient contents (mg/plant dry weight) of Camellia sinensis “Xinyang 10” seedlings under non-salt (0 mmol/L) and salt stress (100 mmol/L) conditions.
TreatmentNPKCaMFe
Control + 0 mmol/L NaCl14.65 ± 1.12 b0.67 ± 0.04 b5.81 ± 0.28 b2.35 ± 0.21 b0.82 ± 0.06 b0.16 ± 0.01 a
AMF + 0 mmol/L NaCl19.53 ± 1.81 a0.89 ± 0.07 a6.51 ± 0.42 a2.97 ± 0.22 a0.98 ± 0.07 a0.17 ± 0.01 a
Control + 100 mmol/L NaCl12.18 ± 1.08 c0.59 ± 0.03 c5.01 ± 0.25 c2.01 ± 0.15 c0.73 ± 0.05 c0.15 ± 0.01 a
AMF + 100 mmol/L NaCl14.97 ± 1.22 b0.71 ± 0.03 b5.89 ± 0.29 b2.88 ± 0.24 a0.91 ± 0.08 a0.16 ± 0.01 a
ANOVENaCl*************
AMF***************
NaCl × AMFns**nsnsns
Note: Data (mean ± SD; n = 6) followed by different letters in the same column were significantly different at p < 0.05 (ANOVA, Duncan test). ** p < 0.05, *** p < 0.001.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Li, Y.-W.; Tong, C.-L.; Sun, M.-F. Effects and Molecular Mechanism of Mycorrhiza on the Growth, Nutrient Absorption, Quality of Fresh Leaves, and Antioxidant System of Tea Seedlings Suffering from Salt Stress. Agronomy 2022, 12, 2163. https://doi.org/10.3390/agronomy12092163

AMA Style

Li Y-W, Tong C-L, Sun M-F. Effects and Molecular Mechanism of Mycorrhiza on the Growth, Nutrient Absorption, Quality of Fresh Leaves, and Antioxidant System of Tea Seedlings Suffering from Salt Stress. Agronomy. 2022; 12(9):2163. https://doi.org/10.3390/agronomy12092163

Chicago/Turabian Style

Li, Yue-Wei, Cui-Ling Tong, and Mu-Fang Sun. 2022. "Effects and Molecular Mechanism of Mycorrhiza on the Growth, Nutrient Absorption, Quality of Fresh Leaves, and Antioxidant System of Tea Seedlings Suffering from Salt Stress" Agronomy 12, no. 9: 2163. https://doi.org/10.3390/agronomy12092163

APA Style

Li, Y.-W., Tong, C.-L., & Sun, M.-F. (2022). Effects and Molecular Mechanism of Mycorrhiza on the Growth, Nutrient Absorption, Quality of Fresh Leaves, and Antioxidant System of Tea Seedlings Suffering from Salt Stress. Agronomy, 12(9), 2163. https://doi.org/10.3390/agronomy12092163

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop