Next Article in Journal
The Increase in the Karstification–Photosynthesis Coupled Carbon Sink and Its Implication for Carbon Neutrality
Previous Article in Journal
Variation in Physical-Chemical Parameters and Phenolic Compounds in Fruits of Four Calafate Clones
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Genetic Improvement in Sesame (Sesamum indicum L.): Progress and Outlook: A Review

by
Desawi Hdru Teklu
1,2,*,
Hussein Shimelis
1 and
Seltene Abady
1,3
1
African Centre for Crop Improvement, University of KwaZulu Natal, Private Bag X01, Scottsville, Pietermaritzburg 3209, South Africa
2
Ethiopian Agricultural Transformation Institute, Addis Ababa P.O. Box 708, Ethiopia
3
School of Plant Sciences, Haramaya University, Dire Dawa P.O. Box 138, Ethiopia
*
Author to whom correspondence should be addressed.
Agronomy 2022, 12(9), 2144; https://doi.org/10.3390/agronomy12092144
Submission received: 10 August 2022 / Revised: 3 September 2022 / Accepted: 6 September 2022 / Published: 9 September 2022
(This article belongs to the Section Crop Breeding and Genetics)

Abstract

Sesame production and productivity are severely constrained by a lack of high-yielding and locally adapted varieties, susceptibility to capsule shattering and low seed retention, biotic and abiotic stresses, and a lack of modern production and pre- and post-harvest technologies. Unimproved landraces are widely cultivated in sub-Saharan Africa, including Ethiopia. The landrace varieties are low yielders (<0.6 tons·ha−1), but they possess intrinsic seed oil quality characteristics, such as unique aroma and taste. Therefore, current and future sesame genetic improvement programs should integrate yield- and quality-promoting traits, local adaptation, amenability to machine harvesting, and other industrially essential food and feed attributes for multiple utilities. This can be achieved by integrating the conventional breeding methods, as well as genetic and genomic techniques such as mutation breeding and genomics-assisted breeding. Therefore, the objective of this review is to document the breeding progress, opportunities, and challenges of sesame with regard to genetic improvement, variety release, and deployment with enhanced seed yield and related agronomic traits, as well as oil content and fatty acid compositions. The review highlights sesame’s economic values, production status, major production constraints, conventional breeding methods, and genomics-assisted breeding, as well as their integration, for accelerated breeding and cultivar development with market-preferred traits.

1. Introduction

Sesame (Sesamum indicum L.; 2n = 2x = 26) belongs to the family Pedaliaceae. It is a predominantly self-pollinating crop [1]. Sesame cultivation dates back some 5500 years ago in the Harappa valley of India [2]. Sesame seed oil and derived products serve the food, feed, and cosmetics industry globally. Sesame has higher seed oil content ranging from 40% to 60% when compared to soybean (~20%), rapeseed (~40%), sunflower (~45%), and groundnut (45–56%) [3,4,5,6,7]. Sesame oil comprises about 85% unsaturated and 15% saturated fatty acids [6]. The unsaturated fatty acids include linoleic acid (~46%) and oleic acid (~38%), while the saturated fatty acids are palmitic acid (~12%) and stearic acid (~4%) [6,8,9]. The higher quantity of unsaturated fatty acids present in sesame oil has human health benefits believed to minimize the risks of cardiovascular diseases, cancer, brain, and liver damage [10,11].
Sesame is widely traded in local, regional, and international markets [12]. A global total of 2.4 million tons of sesame grain was traded in 2020 with a monetary value of 3.2 trillion USD [13]. Likewise, sesame consumption is steadily increasing due to high demands related to its unique nutritional values such as higher contents of vitamins (e.g., A and E), minerals, fiber, desirable fatty acids, carbohydrate (~13.5%), and protein (~24%) [12]. Furthermore, population pressure, urbanization, and the changing lifestyle have increased the global demand for sesame products [12].
About 70% of the world’s sesame seed is processed to produce food oil, while the seedcake left after oil processing is used to prepare livestock meals [12]. The global annual human consumption of sesame is about 65% and 35% in the form of processed food oil and grain, respectively [14]. In 2020, world sesame grain production was 7.25 million tons [13]. Sudan is the largest sesame grain-producing country with 1.52 million tons per annum, followed by China (0.89 million tons), Myanmar (0.74 million tons), the United Republic of Tanzania (0.71 million tons), India (0.65 million tons), Nigeria (0.49 million tons), Burkina Faso (0.27 million tons), and Ethiopia (0.26 million tons) [13].
The actual mean seed yield of sesame in sub-Saharan Africa is <0.6 ton·ha−1, which is far below the attainable yield of the crop, reaching up to 4.00 tons·ha−1 [13]. Relatively higher sesame seed yield productivity is reported in Lebanon (3.29 tons·ha−1), Jordan (2.38 tons·ha−1), Israel (2.04 tons·ha−1), China (1.62 tons·ha−1), Tajikistan (1.59 tons·ha−1), and Uzbekistan (1.52 tons·ha−1) [13]. The low yield level in sub-Saharan Africa is attributable to the use of unimproved traditional varieties or landraces. Moreover, sesame yields are hindered by the indeterminate growth habit of some varieties, capsule shattering, and excessive seed loss pre- and post-harvest [12,15,16,17]. Nearly all the global sesame varieties are prone to capsule shattering, and they are not suitable for machine harvesting [12,18,19]. Langham and Wiemers [18] reported a pre-harvest yield loss of 50% in some sesame varieties due to capsule shattering. Hence, manual sesame harvesting is the method of choice globally, which significantly increases the production and market costs of the produce [12,18,19].
Ethiopia is the center of genetic diversity of sesame [20,21]. The Ethiopian Biodiversity Institute (EBI) maintains about 5000 accessions of sesame germplasm collections [22]. The production and productivity of the crop in East Africa, including Ethiopia, are severely constrained by the lack of high-yielding and locally adapted varieties, susceptibility to capsule shattering and poor seed retention, the prevalence of several biotic and abiotic stresses, and a lack of modern production and pre- and post-harvest technologies [8]. In the region, sesame production relies on unimproved traditional varieties or landraces [22]. The landrace varieties are highly preferred by growers, consumers, and markets due to unique aroma and taste. These attributes make the traditional varieties attractive to growers, breeders, and local, regional, and international markets. Hence, landrace varieties are an excellent source of genetic variation for sesame pre-breeding and breeding programs globally.
Current and future sesame genetic improvement programs should integrate yield- and quality-promoting traits, local adaptation, amenability to machine harvesting, and other industrially essential oil and fatty-acid profiles for multiple utilities. This can be achieved by integrating the conventional breeding methods, genetic and genomic techniques such as mutation breeding, genomics-assisted breeding, and genome editing. Therefore, the objective of this review is to document the breeding progress, opportunities, and challenges of sesame with regard to genetic improvement and variety release and deployment. The review highlights sesame’s economic values, production status, major production constraints, conventional breeding methods, and genomics-assisted breeding and their integration for accelerated breeding and cultivar development with enhanced seed yield and related agronomic traits, as well as oil content and fatty acid compositions. Information presented in the paper serves as a guide for current and future sesame research and development programs.

2. Global Sesame Production

Sesame is widely cultivated in tropical and subtropical agro-ecologies of the world. The major production regions are Africa, Asia, Latin America, and Europe, with production share of 59.05%, 36.47%, 4.22%, and 0.26%, respectively, during 2020 (Table 1). The global production area increased from 7.72 to 14.24 million ha during the last 21 years [13]. The increased sesame production was mainly attributed to the expansion of farmlands and the market values of sesame products [13]. The leading sesame-producing countries with total production area, share of production, and yield are summarized in Table 2. Sudan is the leading sesame producer, followed by China, Myanmar, the United Republic of Tanzania, India, Nigeria, Burkina Faso, and Ethiopia, with global shares of 21.02%, 12.36%, 10.20%, 9.78%, 9.07%, 6.76%, 3.72%, and 3.59%, respectively, in 2020 [13].
There has been steady development in the total global sesame production in the past 21 years (1999 to 2020). For instance, Sudan witnessed the most significant outputs that increased from 0.33 million tons (1999) to 1.53 million tons (2020), followed by Burkina Faso (0.012 to 0.27 million tons) and the United Republic of Tanzania (40,000.00 to 0.71 million tons) [13]. During the same period, the total sesame of production in Ethiopia, Nigeria, Myanmar, and India increased from 0.02 to 0.26, 0.07 to 0.49, 0.25 to 0.74, and 0.48 to 0.66 million tons, respectively [13].
Reportedly, Afghanistan, Sudan, Egypt, India, Myanmar, Paraguay, the United Republic of Tanzania, Nigeria, Burkina Faso, and Ethiopia recorded a rapid increase in both cultivated area and total production between 1999 and 2020 [13]. Contrastingly, sesame production declined in the Central African Republic, El Salvador, Iraq, Kenya, Morocco, and South Korea between 1999 and 2020 [13].
In the past 21 years, variable sesame yields per unit production area have been recorded globally [13]. For example, the yield records in Lebanon increased from 2.08 tons·ha−1 (1999) to 3.30 tons·ha−1 (2020), while those in Jordan increased from 0.92 tons·ha−1 (1999) to 2.38 tons·ha−1 (2020). According to FAOSTAT [13], sesame yields in Mozambique and Venezuela declined between 1999 and 2020 from 0.64 to 0.46 and 0.61 to 0.38 tons·ha−1, respectively, due to limitation of access to improved technologies and extension services. The lowest average sesame yields were reported in Côte d’Ivoire, Guinea, Central African Republic, and Angola at 0.19, 0.23, 0.24, and 0.26 tons·ha−1, respectively, from 1999 to 2020. Lebanon, Jordan, Israel, and China recorded the highest average yields (>1.0 tons·ha−1) during the same years [13]. In the past 10 years, the total annual global sesame production increased from 5.32 million tons (2011) to 7.30 million tons (2020), while the corresponding seed yield varied from 0.78 to 0.79 tons·ha−1 (Figure 1) [13]. Therefore, the average sesame yield is low and stagnant globally. The increasing trend in total sesame production emanated mainly from the expansion of farmlands rather than seed yield productivity per unit area. The low yield gains of the crop suggest the need for a concerted effort for global sesame genetic improvement to boost seed yield and oil production to meet the soaring demand for oil and derived products.

3. Constraints to Sesame Production

The major constraints to sesame production and productivity are a lack of high-yielding and locally adapted varieties, capsule shattering and seed loss, uneven maturity, biotic stresses (insect pests and diseases), abiotic stresses (e.g., drought, waterlogging, salinity, and frost), the use of traditional production technologies, and poor pre- and post-harvest infrastructure [8,15,17,23,24,25,26,27,28,29].
Field insect pests cause a yield loss of 25% in sesame [30]. The major insect pests of sesame crop are webworm (Antigastra catalaunalis), gall midge (Asphondylia sesame), and seed bug (Elasmolomus sordidus) [31]. The seed bug is both a field and a storage insect pest that causes up to 50% yield loss at storage [32]. Moreover, most sesame varieties are attacked by diseases caused by bacteria (e.g., blight caused by Xanthomonas campestris pv. sesame), fungi (e.g., charcoal rot caused by Macrophomina phaseolina, stem anthracnose (Colletotrichum spp.), mildew (Erysiphe cichoracearum), Fusarium wilt caused by Fusarium oxysporum f.sp. sesame (Fos), and root rot (Rhizoctonia solani)), and viruses (e.g., phyllody, Orosius albicinctus) [12].
Among the fungal diseases, charcoal rot is the most devastating disease of sesame caused by soil-borne necrotrophic fungus Macrophomina phaseolina (Tassi) Goid [33]. This fungus causes pre- and post-emergence damage in more than 500 plant families, including sesame. Furthermore, Fusarium wilt is one of the most economically important soil-borne diseases of sesame globally causing 15–30% 1yield loss [34,35]. For instance, root rot caused by Rhizoctonia solani is one of the most damaging fungal diseases in Egypt [36,37]. Drought stress is the main yield-limiting constraint in sesame during the vegetative and flowering growth stages [12,38,39,40]. Yousif et al. [41] and Tripathy et al. [28] reported that sesame is sensitive to waterlogging, salinity, and low-temperature conditions. Waterlogging leads to reduced plant growth, leaf axils per plant, biomass, net photosynthesis, and seed yield [42,43].
Cultivation of sesame using varieties with indeterminate growth habits and that are susceptible to capsule shattering leads to yield penalty [8,12,15,17,24,25,26,27]. Globally, 99% of sesame varieties are susceptible to capsule shattering [12,18,19]. Langham and Wiemers [18] reported a 50% pre-harvest yield loss owing to capsule shattering and seed loss.
Sesame seed loss is common during pre-harvest (e.g., field crop stand) and post-harvest (e.g., harvesting, stacking, drying, threshing, transporting, storage, seed cleaning, and packaging) [44]. Pre- and post-harvest losses are the confounding factors of reduced yield loss and high market price in sesame production.
Lack of access to post-harvest infrastructure and low and variable market prices during harvest are among the critical challenges in sesame value chains [12,17,24]. For instance, in Ethiopia, a 100 kg of sesame grain is traded at 1000–3000 ETB (about 22.3–67 USD) during the harvest period (October to December), while the price is at 3000–3500 ETB (about 67–78 USD) during the off-season (January to September) [17].

4. Sesame Breeding

The main goals in sesame breeding programs include high seed yield, seed oil quantity and quality, capsule shattering resistance, high seed retention rate, uniform maturity, and tolerance to biotic and abiotic stresses. However, breeding gains in sesame are low and stagnant compared to other oilseed crops such as groundnut and sunflower [45]. Selection for improved seed yield and yield components remains the key breeding strategy. The main yield-related traits include early and uniform maturity, reduced plant height, higher number of capsules per plant, number of branches per plant, number of seeds per capsule, and heavier 1000-seed weight. Thus far, most sesame breeding programs have largely focused on germplasm characterization and recommendation using the conventional breeding methods. There is a need to complement phenotyping with other modern breeding strategies such as identifying and discovering new genes, genomic-assisted breeding, and gene editing, which are described below.

Progress and Achievements in Sesame Genetic Improvement

In the past 20 years, sesame research and development have benefited from conventional breeding methods, including pure line and mass selection, hybridization and mutation breeding. This has led to the development of improved sesame varieties. In the last 40 years, more than 200 improved sesame varieties with high yields, oil quantity and quality, early maturity, and resistance to diseases and insect pests were developed and released globally.
Genetic and genomic techniques such as genomics-assisted breeding and genome editing have been markedly used in oil crop research such as in groundnut and rapeseed crops. There has been rapid development of genetic tools, particularly molecular markers, and their application in genetic diversity studies, marker-assisted breeding, chloroplast genome sequencing, haplotype mapping, database development, association mapping, genome-wide association studies (GWAS), gene discovery and functional studies, genetic mapping, and genomics-assisted breeding [45,46,47]. Nevertheless, these genomic resources have been widely used in most sesame genetic improvement programs.
Modern sesame genotypes reported with agronomic and other valuable traits are summarized in Table 3. India and China have each developed more than 50 improved cultivars over the last 40 years [48]. A total of 32 improved sesame varieties have been developed and released by the Ethiopian Institute of Agricultural Research (EIAR) through mass selection from among the local germplasm collections since 1976 [49]. Among the EIAR’s released varieties, Humera-1 and Setit-1 are widely grown by farmers for their early maturity, better yield response (about 1 ton/ha), and broad adaptability [17]. However, the yield response of these varieties is below the reportedly attainable yields of the crop. Some 29 sesame varieties were released in Myanmar in the past 42 years. These varieties were bred for early maturity, white seed color, high yield, and seed oil content [12]. In Myanmar, the following varieties were released: Ju-Ni-Poke, Me-Daw-Let-The, Gwa-Taya, and Gwa-KyawNet. The varieties reportedly had stable yields. Ju-Ni-Poke, Shark-Kale, Hnan-Ni 25/160, Yoe-Sein, Boat-Hmway, Kye-Ma-Shoung, Selin-Boat-Taung, Magway-Ni 50/2, and Nyaung-Aing had relatively higher seed oil content (≥ 55%) [12]. In Bulgaria, four sesame varieties, namely, Victoria, Aida, Valya, and Nevena, were successfully developed for amenable to mechanized harvesting with a mean grain yield of 1.35 tons·ha−1 through a research collaboration between plant breeders and agricultural engineers over the last 30 years [50]. In Kenya, sesame cultivars such as SIK 031 and SIK 013 showed resistance to the white leaf spot disease, whereas SIK 031 and SPS 045 showed resistance to angular leaf spot disease [51]. The two varieties were released by the department of crop science, the University of Nairobi [52].

5. Sesame Genetic Resources and Gene Banks

Sesame genetic resources are the key sources of genetic variation that lead to the selection of desirable traits for current and future genetic improvement programs. Genetically diverse sesame germplasm resources are collected and maintained by different local and international gene banks in sesame improvement programs (Table 4).
A significant number of sesame genetic materials involving cultivated and wild species are maintained in different gene banks globally (Table 4) [59]. About 95% of the sesame genetic resources are maintained in Asia, while 5% are maintained in the United States of America (Table 4). The major sesame gene banks are the National Bureau of Plant Genetic Resources (NBPGR) in India, the National Agrobiodiversity Center, Rural Development Administration in South Korea [60], the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences in China, and the US Department of Agriculture—Agricultural Research Service—Plant Genetic Resource Unit (USDA-ARS-PGRU) in the United States of America [61].
A total of 27,283 sesame genetic materials are preserved in the gene banks in India, South Korea, China, and the United States of America (Table 4). Several African countries, such as Ethiopia, Nigeria, and Sudan, have small-scale gene banks [22,45]. The African sesame gene banks have reservoirs of a reasonable amount of genetic resources, but vital core collections (CCs) are yet required in the region for efficient exploration and utilization of novel genetic variation [62]. Currently, there are three CCs of sesame globally, of which 362 accessions are in India [63], 453 are in China [64], and 278 are in South Korea [60]. The collected accessions are a source of valuable genetic variation for genetic improvement and analysis of useful traits. The Asian sesame genetic resources have been relatively well characterized and preserved compared to African germplasms [65]. Therefore, there is a need to collect the cultivated and wild forms of the sesame species from Africa. This will lead to an establishment of CCs for efficient conservation and exploitation of the novel genetic variation in Africa and internationally.

6. Landraces and Improved Sesame Varieties

Landraces are a valuable source of genetic diversity and possess important traits for pre-breeding and breeding programs [66]. Landraces are widely cultivated in developing countries, often using traditional farming systems in various harsh growing environments and diseases and insect pest pressures [67]. Landraces are useful to integrate unique traits into elite lines and pipeline breeding programs. This enhances sustainable sesame production to meet the standard quality requirements of the local and international markets, as well as for environmental adaption and mitigation against climate change.
Despite the economic value of sesame in the food and oil industries and export market, sesame remains largely under-researched and underutilized in Africa, including Ethiopia [22]. For instance, in Ethiopia, the current sesame production relies on a limited number of genetically unimproved landrace varieties selected by farmers. The landrace variety “Hirhir” is widely cultivated by smallholder and medium-to-large commercial farmers in the country. The variety has a low yield level but possesses novel seed oil quality characteristics, such as aroma and taste [22].
Sehr et al. [68] characterized Ugandan sesame landraces and reported a narrow genetic variation when assayed with morphological and molecular data. Promising sesame landraces were selected amongst Myanmar collections that possessed useful traits such as high seed yield, as well as oil quality and quantity [12]. In China, novel genome sequence data have been generated for two sesame landraces Baizhima and Mishuozhima and two modern cultivars Zhongzhi 13 and Yuzhi 11, in addition to Swetha in India. The genome sequence of these genetic resources is a useful reference for sesame breeders, geneticists and biologists [35]. The sequence information revealed that modern varieties contain genes mainly related to yield and quality, while the landraces contain genes involved in environmental adaptation. The two landraces were originally cultivated in Hainan and Zhejiang provinces in China [61]. The sesame landrace genetic resources present in the centers of origin or diversity need to be systematically collected and evaluated on the basis of seed yield and yield-related traits, as well as oil quantity and quality, for breeding and conservation.

7. Breeding Methods and Associated Technologies for Sesame Improvement

7.1. Conventional Breeding

Sesame improvement and variety development are dependent on conventional breeding methods [69]. In the past, limited genomic tools were used due to limited access to the technology and a lack of a consolidated genetic database on important agronomic traits and genes conditioning key traits [45].
Conventional sesame breeding has been the source of creating new genetic variations [60,61,62,63,64,65,66,67,68]. Previous reports indicated the presence of genetic variation for important traits such as reduced days to 50% flowering, days to 75% maturity, capsule filling period, short plant height, greater internode length, a higher number of primary branches per plant, number of secondary branches per plant, number of capsules per plant, number of seeds per capsule, increased capsule length, capsule width, stem height to first branch, distance from lowest branch to first capsule, 1000-seed weight, biomass yield per hectare, harvesting index, and seed yield per hectare in sesame. These traits are useful for sesame variety descriptions, agro-morphological and genetic analyses, and breeding programs [70,71,72,73,74,75,76,77,78]
Understanding the prevailing genetic variability, magnitude of heritability, and correlation of agronomic traits plays a vital role in the effective use of germplasm [12]. Heritability estimates measure the extent of genetic variation and advancement through phenotypic selection [79]. High heritability and high genetic advances are preconditions for effective phenotypic selection in conventional breeding [80]. Divya et al. [81] in India and Aye and Htwe [82] in Myanmar reported high heritability and genetic advances for plant height and the number of capsules per plant in sesame.
The magnitude of association amongst economic phenotypes guides the selection efficiency in sesame breeding. Highly correlated traits ensure higher selection response and yield gains [83]. Sesame seed yield exhibits a highly significant positive correlation with plant height, number of primary and secondary branches, number of capsules per plant, and 1000-seed weight [22,71,74,77,82]. Dossa et al. [6] assessed the contents of oil, protein, and fatty acid among 139 sesame genotypes collected from Africa and Asia. The authors reported a negative correlation between seed oil and oleic acid contents, corroborating with Teklu et al. [84] when assaying 100 Ethiopian sesame germplasm collections. Additionally, a negative correlation was recorded between oleic acid and linoleic acid contents in sesame genotypes [6,60,84]. Analyzing trait correlations in sesame breeding populations is vital for effective selection for seed yield, yield components, and oil content and profiles.

7.2. Mutation Breeding

Mutation breeding is helpful in enhancing genetic variation to complement conventional breeding programs [85,86]. Induced mutagenesis has made significant contributions to sesame breeding. Some 147 sesame mutants with desirable economic traits were registered through improvement programs globally [87,88].
Table 5 lists some of the reportedly improved sesame varieties with economic traits derived through mutation induction globally. For example, Senai white 48 and Cairo white 8 mutant varieties were developed and released in Egypt [87]. These varieties are grown by the farmers for their white seed color and nonbranching habits. In India, the variety Usha was developed through chemical mutagenesis and released for its increased yield. Lee and Choi [89] reported sesame mutant varieties with high oil content and disease resistance in South Korea. Kang [90] reported higher oleic content and phytophthora blight tolerance in a mutant variety Seodun in South Korea. In Sri Lanka, the mutant variety ANK-2 was developed and released, possessing adequate disease resistance [91]. Capsule shattering is amongst the low-yield-attributing factors in sesame [17]. Hence, future mutation breeding programs should target this grand challenge.

7.3. Genomics-Assisted Breeding

Genomic tools and techniques are key for trait discovery and molecular breeding [92]. Various databases for sesame genomics are summarized in Table 6. A study by Wei et al. [35] reported a genome size of 554.05 Mbp in sesame, of which the core and dispensable genomes were 258.79 and 295.26 Mbp, respectively. The sesame genome consists of 26,472 orthologous gene clusters, of which 15,890 genes are variety-specific [93]. The sesame pangenome, the entire set of genes, is a vital genomic resource for sesame improvement programs and genetic analysis.

7.3.1. Genetic Diversity Analysis

Molecular markers are highly reliable genetic tools that complement phenotypic selection for breeding [100]. Knowledge on the genetic diversity and population structure of germplasm collections is vital for genetic analysis, breeding, and conservation [101]. Genetic diversity in sesame has been explored using several DNA markers. Various studies have assessed the genetic diversity of sesame accessions globally using amplified fragment length polymorphism (AFLP) [102,103], random amplified polymorphic DNA (RAPD) [15,104,105], inter simple sequence repeat (ISSR) [25,26,106], microsatellites or simple sequence repeat (SSR) [22,35,59,65,107,108,109,110], and single-nucleotide polymorphisms (SNPs) [111,112]. The SSR markers are widely used in sesame genetic analysis and breeding for their ability to detect higher degrees of polymorphism, higher reproducibility, codominance, and abundant genome coverage [35].
Table 7 lists of some polymorphic SSR markers developed for sesame breeding. SSR markers play an important role in genetic diversity research, population genetics, linkage mapping, comparative genomics, and association analysis [41,53,65,109,113]. Some SSR primers such as ZM_20, ZM_21, and ZM_22, followed by ZM_11, and ZM_45, are more polymorphic (with polymorphic information content (PIC) of ≥0.80).
Frary et al. [114] conducted a genetic diversity study using morphological traits and RAPD markers among 137 Turkish sesame germplasms which led to the selection of a core collection. A total of 121 Ugandan sesame landraces were investigated using 24 SSR markers, and the results showed incongruence between morphological and molecular data [68]. Anyanga et al. [27] reported a medium genetic differentiation among 85 test germplasms sourced from different countries at the National Semi-Arid Resources Research Institute (NaSARRI) in eastern Uganda. Moreover, Pandey et al. [53] analyzed a worldwide germplasm collection predominantly of Indian accessions and reported a high genetic diversity within the germplasm. However, there were nonsignificant correlations between phenotypic and molecular marker information. Pham et al. [115] reported a substantial amount of genetic diversity present in 12 Vietnamese and Cambodian populations. Twenty-seven Iranian sesame accessions were characterized that revealed large genetic variability [116]. Teklu et al. [22] reported a wide genetic diversity among 100 Ethiopian sesame genotypes when assessed using 27 SSR markers.
The genetic diversity among 100 Ethiopian germplasm collections was assessed using seed oil, fatty acid compositions, and SSR markers [84]. The authors reported wide genetic variation for the contents of seed oil and fatty acid profiles among the test lines. The contents of oil in the assessed lines varied from 44.30% to 55.60%, with a mean of 49.84%, followed by oleic acid ranging from 36.70% to 48.80% and a mean of 42.90%, and linoleic acid (36.60% to 47.10%, mean 41.70%) [84].
Limited genetic studies have been conducted on wild related species of the genus Sesamum [40]. Nyongesa et al. [25] reported a high genetic diversity within wild sesame species using six ISSR markers. Uncu et al. [117] discovered a high rate of SSR marker transferability between S. indicum and S. malabaricum, supporting the designation of the two taxa as cultivated and wild forms of the same species. The wild species of sesame possess genes related to resistance to biotic and abiotic stresses, as well as broad adaptability [118]. In sesame, the introgression of valuable genes from wild related species into cultivars through conventional breeding has not been so far successful due to the post-fertilization barrier [119].

7.3.2. Quantitative Trait Locus (QTL) Analysis

Quantitative trait locus (QTL) analysis detects major genetic regions of a target quantitative trait in a population [120]. Table 8 summarizes some quantitative trait loci (QTLs) of target traits identified for sesame breeding. QTL maps are useful for discovering, dissecting, and manipulating the genes responsible for simple and complex traits in crop plants [121]. A high-quality genetic map improves genome assembly and provides a foundation for gene mapping that underlie agronomic traits of important oil crops such as sesame [122].

7.3.3. Next-Generation Sequencing

Next-generation sequencing (NGS) has revolutionized genomic and transcriptome research. Sequencing tools are valuable for the discovery, validation, and assessment of genetic markers in diverse populations [133]. Quantitative trait locus (QTL) NGS technologies have significantly enhanced the efficiency and costs of genotyping in several model and crop plants [133].
NGS allowed for the rapid construction of high-density or ultra-dense single-nucleotide polymorphism (SNP) genetic maps for gene identification [134,135,136,137]. Genetic research on sesame has steadily progressed in the last few years with the development of the NGS technology. Six high-density molecular genetic maps have been constructed and are currently being used for sesame genome assembly and map-based gene cloning [96,122,123,125,126,138,139]. Ultra-dense SNP genetic maps using whole-genome re-sequencing are used to enhance gene cloning and genomics research in sesame [126,140]. Two sesame genes, Sidt1 controlling inflorescence determinacy and Sicl1 controlling leaf curling and capsule indehiscence, were successfully cloned using the linkage mapping method and candidate variant screening [126,140]. The NGS platform in sesame breeding programs can assist in the rapid development of genomic tools for genetic improvement, cultivar development, and commercialization.
Sesame is an indeterminate type with a long flowering duration which is more than 1 month in some varieties [126]. Flowering time affects adaptation, agronomic traits, and seed yield [45]. Reduced days to 50% flowering and days to 75% maturity are yield-contributing traits in sesame. The low seed yield of sesame is attributable to indeterminate flowering habits compared to other oilseed crops [141]. Wei et al. [61] reported two candidate genes of loci SiDOG1 (SIN_1022538) and SiIAA14 (SIN_1021838) conditioning flowering time. Zhang et al. [126] reported that the gene SiDt (DS899s00170.023) conferred determinate growth habits in sesame. The determinate trait is desirable for shortening the flowering time, enhancing capsule ripening and uniform maturity, easing mechanical harvesting, reducing capsule shattering and seed loss, and increasing seed yield [126].

7.3.4. Genetic Engineering and Genome Editing

Genetic engineering techniques involve various innovative approaches that can complement conventional breeding in sesame [12]. Genetic transformation of traits would be an ideal opportunity to transfer some functional genes into sesame’s elite cultivars, including capsule shattering resistance. Some successful efforts have been made toward sesame genetic transformation, including target gene insertion and new variety development [142,143,144]. The authors reported up to 42.66% transformation efficiency using the Agrobacterium-mediated transformation technique. Improved transformation efficiency will enhance sesame genetic engineering for precision and speeding breeding. Studies in the transfer of candidate genes conditioning oil quality traits and abiotic stress tolerance into elite sesame cultivars are in progress at the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences (OCRI-CAAS), China [45]. The first study on the functional analysis in transgenic sesame for tolerance to drought, salinity, oxidative stresses, and the charcoal rot pathogen was reported by Chowdhury et al. [132].
Genome editing, also known as targeted gene modification, is a technique for generating new allelic variants in the genomes, including crop plants [145]. The clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing systems, such as CRISPR/Cas9, CRISPR/Cpf1, base-editing system, and prime editing system, have brought promise for genetic improvement programs of crop plants, including sesame [146]. CRISPR-based genome editing technology can alter single or multiple target genes, including polyploid oil crops such as canola/rapeseed (Brassica napus L., 2n = 4× = 38, AACC). CRISPR-based genome editing has led to the development of stably inherited knockout mutants of canola [147]. The CRISPR technology has shown promise in oil crop genetic improvement, including canola/rapeseed and groundnut crops [148]. Nevertheless, there are limited reports on CRISPR-based genome editing technology in sesame and sunflower owing to their unique genomes and recalcitrance to genetic transformation [148].

8. Waterlogging and Drought Tolerance

Sesame is highly susceptible to waterlogging, which is high soil water saturation. Waterlogging stress reduces plant height, leaf axil development, biomass production, net photosynthesis and seed yield [42,43]. Wang et al. [149] reported some 13,307 differentially expressed genes (DEGs) in sesame under waterlogging stress conditions. Of these genes, 1379 were functional for waterlogging resistance [124]. Additionally, 66 candidate genes were reported encoding improved waterlogging tolerance in sesame. The QTLs qEZ09ZCL13, qWH09CHL15, qEZ10ZCL07, qWH10ZCL09, qEZ10CHL07, and qWH10CHL09 and the SSR marker ZM428 were identified to be effective for marker-assisted selection for waterlogging tolerance [129].
Sesame is relatively a drought-tolerant crop thriving under water-limited agro-ecologies where most crops could fail [150]. Drought stress is the main yield-limiting constraint in sesame during the vegetative and flowering growth stages [12,38,39,40]. Currently, limited genomic or proteomic studies have been reported regarding drought tolerance in sesame. Dossa et al. [131] reported 75 candidate genes enriched in transcription factors (TFs) in the sesame conditioning drought tolerance. The authors subsequently isolated two significant TF families (AP2/ERF and HSF) [30,151] responsible for drought tolerance. The relatively high number of drought tolerance genes reported in the early sesame studies showed this trait’s genetic complexity for conventional breeding. In RNA-seq analysis, 722 genes were found to be the main focal genes involved in drought responses, while 61 candidate genes were important for greater drought tolerance in sesame [152]. Transgenic sesame plants with the Osmotin-like gene (SindOLP) had increased tolerance to drought, salinity, and charcoal rot disease [132].

9. Insect Pest Resistance in Sesame

Field insect pests cause a yield loss of 25% in sesame [30]. The major insect pests of sesame are webworm (Antigastra catalaunalis), gall midge (Asphondylia sesame), and seed bug (Elasmolomus sordidus) [31]. The seed bug causes up to 50% yield loss in storage [32]. Webworm causes leaf webbing, as well as capsule and seed damage [31]. Simoglou et al. [153] reported more than 50% yield loss due to webworm damage and premature opening of the infested capsules. Most released sesame varieties are susceptible to the major diseases caused by bacteria (e.g., blight caused by Xanthomonas campestris pv. sesame), fungi (e.g., charcoal rot caused by Macrophomina phaseolina, stem anthracnose (Colletotrichum spp.), and mildew (Erysiphe cichoracearum)), and viruses (e.g., phyllody and Orosius albicinctus) [12]. Phyllody causes a yield loss of 34% to 100% [154,155]. Phyllody has been reported in several countries, including Burkina Faso, Ethiopia, India [155,156], Iraq, Israel, Mexico, Myanmar [157], Nigeria, Oman, Pakistan, Sudan, Taiwan [158], Tanzania, Thailand, Turkey [159], Venezuela, and Uganda [160]. Crop management systems reportedly reduce field insect pests of sesame. For instance, intercropping sesame with legumes and cereals reduced the damage caused by webworms [161]. Sesame is widely intercropped with sorghum, maize, and groundnut in Ethiopia [17], as well as with sorghum and millet in Senegal and Mali [24], for multiple benefits.

10. Market-Driven Breeding in Sesame

The success of a crop breeding program is measured by the adoption rate of the new varieties by farmers and their markets. Farmers are the main actors in agriculture enterprises, with a wealth of indigenous knowledge about their crops, farming systems, and production constraints and they have their own coping mechanism and means to adopt a technology [162]. Plant breeders are required to incorporate the knowledge and opinions of farmers in the planning and management of their breeding programs [163]. Several socioeconomic studies were conducted on sesame to document the production opportunities and constraints, as well as farmer- and market-preferred varieties and traits, as a guide for large-scale production and breeding. Dossa et al. [24] in Senegal and Mali examined the socioeconomic aspects of sesame to guide production, research, and policies. The authors identified a lack of marketing, a decline in soil fertility, limited access to land, drought stress, backward agricultural implements, a lack of extension services, and limited access to agricultural inputs as the essential constraints on sesame production in both countries. In Myanmar, the use of low-yielding varieties, insect pests, post-harvest loss, drought, and salinity stresses were regarded as the overriding sesame production constraints [12]. A recent participatory rural appraisal study conducted in Ethiopia identified lack of access to improved seeds, low yield, diseases, low market price, insect pests, lack of market information, and high cost of improved seed as the most important production constraints to sesame [17]. White seed color, increased seed size, true-to-type seed, high oil content, and increased 1000-seed weight are identified as the most critical sesame market-preferred traits in Ethiopia [17].

11. Conclusion and Outlook

Breeding gains for sesame seed oil yields and fatty acid composition are relatively low due to the limited research and development support compared with other traditional oilseed crops. A limited number of improved sesame varieties with high yields, oil quantity and quality, early maturity, and resistance to diseases and insect pests have been developed and released globally. Sesame improvement has primarily focused on conventional breeding through germplasm characterization, selection, and variety recommendation. More importantly, a number of functional genes, QTLs, and molecular markers associated with these traits are now available and can be employed in sesame breeding programs. There is need to develop new-generation, climate-smart, abiotic and biotic stress-resistant, capsule shattering-resistant sesame varieties that meet the quality requirements of the local and international markets. Therefore, current and future sesame genetic improvement programs should integrate yield- and quality-promoting traits, local adaptation, machine harvesting, and other industrially essential attributes for multiple utilities. This can be achieved by integrating the conventional and mutation breeding methods and genomic techniques such as molecular breeding, genomic-assisted breeding, and genome editing. Additionally, there is a need for vibrant public and private sector sesame breeding programs and seed industries. Genetic and advanced genomic resources, as well as increased investment for research and development by public and private sectors, will enhance the dissemination and adoption of improved production technologies for sustainable production and economic gains from sesame enterprises.

Author Contributions

D.H.T., conceptualization, study design, and writing—original draft; H.S., supervision, conceptualization, study design, and writing—review and editing; S.A., writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

Funding was supplied by the University of KwaZulu-Natal (UKZN) for publication fee.

Data Availability Statement

Not applicable.

Acknowledgments

The Agricultural Transformation Institute (ATI) of Ethiopia is thanked for the PhD study support to the first author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ashri, A. Sesame breeding. In Plant Breeding Reviews; Janick, J., Ed.; John Wiley: Oxford, UK, 2010; Volume 16. [Google Scholar]
  2. Bedigian, D.; Harlan, J. Evidence for cultivation of sesame in the ancient world. Econ. Bot. 1986, 40, 137–154. [Google Scholar] [CrossRef] [Scilit]
  3. De la Vega, A.J.; Hall, A.J. Effect of planting date, genotype, and their interactions on sunflower yield: II. Components of oil yield. Crop Sci. 2002, 42, 1202–1210. [Google Scholar] [CrossRef] [Scilit]
  4. Zheljazkov, V.D.; Vick, B.A.; Ebelhar, M.W.; Buehring, N.; Baldwin, B.S.; Astatkie, T.; Mille, J.F. Yield, oil content, and composition of sunflower grown at multiple locations in Mississippi. Agron. J. 2008, 100, 635–639. [Google Scholar] [CrossRef] [Scilit]
  5. Wei, W.; Zhang, Y.; Lv, H.; Li, D.; Wang, L.; Zhang, X. Association analysis for quality traits in a diverse panel of Chinese sesame (Sesamum indicum L.) germplasm. J. Integr. Plant Biol. 2013, 55, 745–758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Dossa, K.; Wei, X.; Niang, M.; Liu, P.; Zhang, Y.; Wang, L.; Liao, B.; Cissé, N.; Zhang, X.; Diouf, D. Near-infrared reflectance spectroscopy reveals wide variation in major components of sesame seeds from Africa and Asia. Crop J. 2018, 6, 202–206. [Google Scholar] [CrossRef] [Scilit]
  7. Gulluoglu, L.; Arioglu, H.; Bakal, H.; Onat, B.; Kurt, C. The Effect of Harvesting on Some Agronomic and Quality Characteristics of Peanut Grown in the Mediterranean Region of Turkey. Turk. J. Field Crop 2016, 21, 224–232. [Google Scholar] [CrossRef] [Scilit]
  8. Were, B.A.; Onkware, A.O.; Gudu, S.; Welander, M.; Carlsson, A.S. Seed oil content and fatty acid composition in East African sesame (Sesamum indicum L.) accessions evaluated over 3 years. Field Crops Res. 2006, 97, 254–260. [Google Scholar] [CrossRef] [Scilit]
  9. Anastasi, U.; Sortino, O.; Tuttobene, R. Agronomic performance and grain quality of sesame (Sesamum indicum L.) landraces and improved varieties grown in a Mediterranean environment. Genet. Resour. Crop Evol. 2017, 64, 127–137. [Google Scholar]
  10. Yen, G.C. Influence of seed roasting process on the changes in composition and quality of sesame (Sesame indicum L.) oil. J. Sci. Food Agric. 1990, 50, 563–570. [Google Scholar] [CrossRef] [Scilit]
  11. Yol, E.; Toker, R.; Golukcu, M.; Uzun, B. Oil Content and fatty acid Characteristics in mediterranean sesame core collection. Crop Sci. 2015, 55, 2177–2185. [Google Scholar] [CrossRef] [Scilit]
  12. Myint, D.; Gilani, S.A.; Kawase, M.; Watanabe, K.N. Sustainable Sesame (Sesamum indicum L.) Production through Improved Technology: An Overview of Production, Challenges, and Opportunities in Myanmar. Sustainability 2020, 12, 3515. [Google Scholar] [CrossRef] [Scilit]
  13. FAOSTAT. The Food and Agriculture Organization Corporate Statistical Database (FAOSTAT), Rome, Italy. 2020. Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 16 March 2022).
  14. Morris, J.B. Food, industrial, nutraceutical, and pharmaceutical uses of sesame genetic resources. In Trends in News Crops and New Uses; Janick, J., Whipkey, A., Eds.; ASHS Press: Alexandria, Egypt, 2002; pp. 153–156. [Google Scholar]
  15. Abdellatef, E.; Sirelkhatem, R.; Ahmed, M.M.; Radwan, K.H.; Khalafalla, M.M. Study of genetic diversity in Sudanese sesame (Sesamum indicum L.) germplasm using random amplified polymorphic DNA (RAPD) markers. Afr. J. Biotechnol. 2008, 24, 4423–4427. [Google Scholar]
  16. Uzun, B.; Çagirgan, M.I. Identification of molecular markers linked to determinate growth habit in sesame. Euphytica 2009, 166, 379–384. [Google Scholar] [CrossRef] [Scilit]
  17. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Abady, S. Appraisal of the sesame production opportunities and constraints, and farmer-preferred varieties and traits, in Eastern and Southwestern Ethiopia. Sustainability 2021, 13, 11202. [Google Scholar] [CrossRef] [Scilit]
  18. Langham, D.R.; Wiemers, T. Progress in mechanizing sesame in the US through breeding. In Trends in New Crops and New Uses; Janick, J., Whipkey, A., Eds.; ASHS Press: Alexandria, Egypt, 2002; pp. 157–173. [Google Scholar]
  19. Khidir, M.O. Natural cross-fertilization in sesame under Sundan conditions. Exp. Agric. 1972, 8, 55–59. [Google Scholar] [CrossRef] [Scilit]
  20. Bedigian, D. Origin, diversity, exploration and collection of sesame. Sesame: Status and Improvement. In Proceedings of the Expert Consultation, Rome, Italy, 8–12 December 1980; FAO Plant Production and Protection Paper: Rome, Italy, 1981; Volume 29, pp. 164–169. [Google Scholar]
  21. Seegeler, C.J. Oil Seeds in Ethiopia: Their Taxonomy and Agricultural Significance; Centre for Agricultural Publication and Documentation: Wageningen, The Netherlands, 1983. [Google Scholar]
  22. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Mashilo, J.; Zhang, X.; Zhang, Y.; Dossa, K.; Shayanowako, A.I.T. Genetic variability and population structure of Ethiopian sesame (Sesamum indicum L.) germplasm assessed through phenotypic traits and simple sequence repeats markers. Plants 2021, 10, 1129. [Google Scholar] [CrossRef] [Scilit]
  23. Were, B.A.; Lee, M.; Stymne, S. Variation in seed oil content and fatty acid composition of Sesamum indicum L. and its wild relatives in Kenya. Swed. Seed Assoc. 2001, 4, 178–183. [Google Scholar]
  24. Dossa, K.; Konteye, M.; Niang, M.; Doumbia, Y.; Cissé, N. Enhancing sesame production in West Africa’s Sahel: A comprehensive insight into the cultivation of this untapped crop in Senegal and Mali. Agric. Food Secur. 2017, 6, 68. [Google Scholar] [CrossRef] [Scilit]
  25. Nyongesa, B.O.; Were, B.A.; Gudu, S.; Dangasuk, O.G.; Onkware, A.O. Genetic diversity in cultivated sesame (Sesamum indicum L.) and related wild species in East Africa. J. Crop Sci. Biotechnol. 2013, 16, 9–15. [Google Scholar] [CrossRef] [Scilit]
  26. Woldesenbet, D.T.; Tesfaye, K.; Bekele, E. Genetic diversity of sesame germplasm collection (Sesamum indicum L.): Implication for conservation, improvement and use. Int. J. Biotechnol. Mol. Biol. Res. 2015, 6, 7–18. [Google Scholar]
  27. Anyanga, W.O.; Hohl, K.H.; Burg, A.; Gaubitzer, S.; Rubaihayo, P.R.; Vollmann, J.; Gibson, P.T.; Fluch, S.; Sehr, E.M. Genetic variability and population structure of global collection of sesame (Sesamum indicum L.) germplasm assessed through phenotypic traits and simple sequence repeats markers for Uganda. J. Agric. Sci. 2017, 9, 13–14. [Google Scholar]
  28. Tripathy, S.K.; Kar, J.; Sahu, D. Advances in Sesame (Sesamum indicum L.) Breeding. In Advances in Plant Breeding Strategies: Industrial and Food Crops; Al-Khayri, J.M., Jain, S.M., Johnson, D.V., Eds.; Springer: Cham, Switzerland, 2019; pp. 577–635. [Google Scholar]
  29. Yol, E.; Uzun, B. Inheritance of indehiscent capsule character, heritability and genetic advance analyses in the segregation generations of dehiscent x indehiscent capsules in sesame. Tarim Bilim. Derg. 2019, 25, 79–85. [Google Scholar] [CrossRef] [Scilit]
  30. Weiss, E.A. Sesame. Oilseed Crops, 2nd ed.; Blackwell Science: London, UK, 2000. [Google Scholar]
  31. Gebregergis, Z.; Dereje, A.; Fitwy, I. Assessment of incidence of sesame webworm (Antigastra catalaunalis (Duponchel)) in Western Tigray, North Ethiopia. J. Agric. Ecol. Res. Int. 2016, 9, 1–9. [Google Scholar] [CrossRef] [Scilit]
  32. Ministry of Agriculture (MoA). Crop extension Package and Manual; MOA: Addis Ababa, Ethiopia, 2018; pp. 126–132. [Google Scholar]
  33. Thiyagu, K.; Kandasamy, G.; Manivannan, N.; Muralidharan, V.; Manoranjitham, S.K. Identification of resistant genotypes to root rot disease (Macrophomina phaseolina) of sesame (Sesamum indicum L). Agric. Sci. Digest. 2007, 27, 34–37. [Google Scholar]
  34. Li, D.; Wang, L.; Zhang, Y.; Lv, H.; Qi, X.; Wei, W.; Zhang, X. Pathogenic variation and molecular characterization of Fusarium species isolated from wilted sesame in China. Afr. J. Microbiol. Res. 2012, 6, 149–154. [Google Scholar] [CrossRef] [Scilit]
  35. Wei, X.; Zhu, X.; Yu, J.; Wang, L.; Zhang, Y.; Li, D. Identification of sesame genomic variations from genome comparison of landrace and variety. Front. Plant Sci. 2016, 7, 1169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. El-Barougy, E.S. Pathological Studies on Sesame (Sesamum indicum L.) Plant in Egypt. Master’s Thesis, Agriculture and Botany Department, Faculty of Agriculture, Seuz Canal University, Ismailia, Egypt, 1990; p. 145. [Google Scholar]
  37. El-Shakhess, S.A.M. Inheritance of some economic characters and disease reaction in some sesame (Sesamum indicum L.). Ph. D. Thesis, Agronomy Department, Faculty of Agriculture, Cario University, Cario, Egypt, 1998; p. 135. [Google Scholar]
  38. Boureima, S.; Oukarroum, A.; Diouf, M.; Cisse, N.; Van Damme, P. Screening for drought tolerance in mutant germplasm of sesame (Sesamum indicum) probing by chlorophyll A inflorescence. Environ. Exp. Bot. 2012, 81, 37–43. [Google Scholar] [CrossRef] [Scilit]
  39. Kadkhodaie, A.; Zahedi, M.; Razmjoo, J.; Pessarakli, M. Changes in some anti-oxidative enzymes and physiological indices among sesame genotypes (Sesamum indicum L.) in response to soil water deficits under field conditions. Acta Physiol. Plant 2014, 36, 641–650. [Google Scholar] [CrossRef] [Scilit]
  40. Aye, M.; Khaing, T.T.; Hom, N.H. Morphological characterization and genetic divergence in myanmar sesame (Sesamum indicum L.) germplasm. Int. J. Curr. Adv. Res. 2018, 6, 297–307. [Google Scholar] [CrossRef] [Scilit]
  41. Yousif, H.Y.; Bingham, F.T.; Yermason, D.M. Growth, mineral composition, and seed oil of sesame (Sesamum indicum L.) as affected by NaCl. Soil Sci. Soc. Am. J. 1972, 36, 450–453. [Google Scholar] [CrossRef] [Scilit]
  42. Uçan, K.; Kıllı, F.; Gençoglan, C.; Merdun, H. Effect of irrigation frequency and amount on water use efficiency and yield of sesame (Sesamum indicum L.) under field conditions. Field Crops Res. 2007, 101, 249–258. [Google Scholar] [CrossRef] [Scilit]
  43. Sun, J.; Zhang, X.R.; Zhang, Y.X.; Wang, L.H.; Huang, B. Effects of waterlogging on leaf protective enzyme activities and seed yield of sesame at different growth stages. Chin. J. Appl. Environ. 2009, 15, 790–795. [Google Scholar] [CrossRef] [Scilit]
  44. Gebretsadik, D.; Haji, J.; Tegegne, B. Sesame post-harvest loss from small-scale producers in Kafta Humera District, Ethiopia. J. Dev. Agric. Econ. 2019, 11, 33–42. [Google Scholar]
  45. Dossa, K.; Diouf, D.; Cissé, N. Genome-Wide investigation of Hsf genes in Sesame reveals their segmental duplication expansion and their active role in drought stress response. Front. Plant Sci. 2016, 7, 1522. [Google Scholar] [CrossRef] [Scilit]
  46. Dixit, A.; Jin, M.H.; Chung, J.W.; Yu, J.W.; Chung, H.K.; Ma, K.H. Development of polymorphic microsatellite markers in sesame (Sesamum indicum L.). Mol. Ecol. Resour. 2005, 5, 736–738. [Google Scholar] [CrossRef] [Scilit]
  47. Wang, L.; Zhang, Y.; Qi, X.; Gao, Y.; Zhang, X. Development and characterization of 59 polymorphic cDNA-SSR markers for the edible oil crop Sesamum indicum L. (Pedaliaceae). Am. J. Bot. 2012, 99, 394–398. [Google Scholar] [CrossRef] [Scilit]
  48. Hodgkin, T.; Qingyuan, G.; Xiurong, Z.; Ying-zhong, Z.; Xiang-yun, F.; Gautam, P.L.; Mahajan, R.; Bisht, I.S.; Loknathan, T.R.; Mathur, P.N.; et al. Developing sesame core collections in China and India. In Core Collections for Today and Tomorrow; International Plant Genetic Resources Institute: Rome, Italy, 1999. [Google Scholar]
  49. Ministry of Agriculture (MoA). Plant variety release. Protection and seed quality control directorate. In Crop Variety Register; MoA: Addis Ababa, Ethiopia, 2019; Volume 22, p. 330. [Google Scholar]
  50. Stamatov, S.; Velcheva, N.; Deshev, M. Introduced sesame accessions as donors of useful qualities for breeding of Introduced sesame accessions as donors of useful qualities for breeding of mechanized harvesting cultivars. Bulg. J. Agric. Sci. 2018, 24, 820–824. [Google Scholar]
  51. Nyanapah, J.O.; Ayiecho, P.O.; Nyabundi, J.O. Evaluation of sesame cultivars for resistance to Cercospora leaf spot. East Afr. Agric. J. 1995, 60, 115–121. [Google Scholar] [CrossRef] [Scilit]
  52. Ayiecho, P.O.; Nyabundi, J.O. Yield Improvement of Kenyan Sesame Varieties Using Induced Mutations; 1st year report to IAEA; Department of Crop Science, University of Nairobi: Nairobi, Kenya, 1994. [Google Scholar]
  53. Pandey, S.K.; Das, A.; Rai, P.; Dasgupta, T. Morphological and genetic diversity assessment of sesame (Sesamum indicum L.) accessions differing in origin. Physiol. Mol. Biol. Plants. 2015, 21, 519–529. [Google Scholar] [CrossRef] [Scilit]
  54. Chellamuthu, M.; Subramanian, S.; Swaminathan, M. Genetic potential and possible improvement of Sesamum indicum L. IntechOpen 2020, 11, 1–18. [Google Scholar] [CrossRef] [Scilit]
  55. NBPGR. National Bureau of Plant Genetic Resources, India. 2021. Available online: www.nbpgr.ernet.in (accessed on 5 December 2021).
  56. OCRI. Oil Crops Research Institute, China. 2021. Available online: http://www.sesame-bioinfo.org/phenotype/index.html (accessed on 5 December 2021).
  57. NACRDA. National Agrobiodiversity Center, Rural Development Administration, South Korea. 2021. Available online: http://www.rda.go.kr/foreign/ten/ (accessed on 5 December 2021).
  58. USDA-ARS-PGRU. United States Department of Agriculture-Agricultural Research Service-Plant Genetic Resource Unit, USA. 2021. Available online: https://www.ars.usda.gov/ (accessed on 5 December 2021).
  59. Zhang, Y.; Zhang, X.; Che, Z.; Wang, L.; Wei, W.; Li, D. Genetic diversity assessment of sesame core collection in China by phenotype and molecular markers and extraction of a mini-core collection. BMC Genet. 2012, 13, 102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Park, J.; Suresh, S.; Raveendar, S.; Baek, H.; Kim, C.; Lee, S. Development and evaluation of core collection using qualitative and quantitative trait descriptor in sesame (Sesamum indicum L.) germplasm. Korean J. 2015, 60, 75–84. [Google Scholar] [CrossRef] [Scilit]
  61. Wei, X.; Liu, K.; Zhang, Y.; Feng, Q.; Wang, L.; Zhao, Y. Genetic discovery for oil production and quality in sesame. Nat. Commun 2015, 6, 8609. [Google Scholar] [CrossRef] [Scilit]
  62. Hodgkin, T.; Brown, A.H.D.; Hintum, T.J.L.V.; Morales, E.A.V. Core Collections of Plant Genetic Resources; A co-publication with the International Plant Genetic Resources Institute (IPGRI) and Sayce publishing: London, UK, 1995. [Google Scholar]
  63. Bisht, I.S.; Mahajan, R.K.; Loknathan, T.R.; Agarwal, R.C. Diversity in Indian sesame collection and stratification of germplasm accessions in different diversity groups. Genet. Resour. Crop Evol. 1998, 45, 325–335. [Google Scholar] [CrossRef] [Scilit]
  64. Zhang, X.; Zhao, Y.; Cheng, Y.; Feng, X.; Guo, Q.; Zhou, M. Establishment of sesame germplasm core collection in China. Genet. Resour. Crop Evol. 2000, 47, 273–279. [Google Scholar] [CrossRef] [Scilit]
  65. Dossa, K.; Wei, X.; Zhang, Y.; Fonceka, D.; Yang, W.; Diouf, D. Analysis of genetic diversity and population structure of sesame accessions from Africa and Asia as major centers of its cultivation. Genes 2016, 7, 14. [Google Scholar] [CrossRef] [Scilit]
  66. Lopes, M.S.; El-Basyonim, I.; Baenziger, P.S.; Singh, S.; Royo, C.; Ozbek, K.; Aktas, H.; Ozer, E.; Ozdemir, F.; Manickavelu, A. Exploiting genetic diversity from landraces in wheat breeding for adaptation to climate change. J. Exp. Bot. 2015, 66, 3477–3486. [Google Scholar] [CrossRef] [Scilit]
  67. Pícha, K.; Navrátil, J.; Švec, R. Preference to local food vs. Preference to “national” and regional food. J. Food Prod. Mark. 2018, 24, 125–145. [Google Scholar] [CrossRef] [Scilit]
  68. Sehr, E.M.; Okello-Anyanga, W.; Hasel-Hohl, K.; Burg, A.; Gaubitzer, S.; Rubaihayo, P.R. Assessment of genetic diversity amongst Ugandan sesame (Sesamum indicum L.) landraces based on agro-morphological traits and genetic markers. J. Crop Sci. Biotechnol. 2016, 19, 117–129. [Google Scholar] [CrossRef] [Scilit]
  69. Ashri, A. Report on FAO/IAEA. Expert consultation on breeding improved sesame cultivars; Hebrew University: Jerusalem, Israel, 1987. [Google Scholar]
  70. Furat, S.; Uzun, B. The use of agro-morphological characters for the assessment of genetic diversity in sesame (Sesamum indicum L.). Plant Omics 2010, 3, 85–91. [Google Scholar]
  71. Akbar, F.; Rabbani, M.A.; Shinwari, Z.K.; Khan, S.J. Genetic divergence in sesame (Sesamum Indicum L.) landraces based on qualitative and quantitative traits. Pak. J. Bot. 2011, 43, 2737–2744. [Google Scholar]
  72. Gidey, Y.T.; Kebede, S.A.; Gashawbeza, G.T. Extent and pattern of the genetic diversity for morpho-agronomic traits in Ethiopian sesame landraces (Sesamum indicum L.). Asian J. Agric. Res. 2012, 6, 118–128. [Google Scholar] [CrossRef] [Scilit]
  73. Teklu, D.H.; Kebede, S.A.; Gebremichael, D.E. Assessment of genetic variability, genetic advance, correlation, and path analysis for morphological traits in sesame genotypes. Asian J. Agric. Res. 2014, 7, 118–128. [Google Scholar] [CrossRef] [Scilit]
  74. Hika, G.; Geleta, N.; Jaleta, Z. Correlation and divergence analysis for phenotypic traits in sesame (Sesamum indicum L.) Genotypes. Sci. Technol. Arts Res. J. 2014, 3, 1–9. [Google Scholar] [CrossRef] [Scilit]
  75. Hika, G.; Geleta, N.; Jaleta, Z. Genetic variability, heritability and genetic advance for the phenotypic sesame (Sesamum indicum L.) Populations from Ethiopia. Sci. Technol. Arts Res. J. 2015, 4, 20–26. [Google Scholar] [CrossRef] [Scilit]
  76. Abdou, R.I.Y.; Moutari, A.; Ali, B.; Basso, Y.; Djibo, M. Variability study in sesame (Sesamum indicum L.) cultivars based on agro-morphological characters. Int. J. Agric. Fish. 2015, 6, 237–242. [Google Scholar]
  77. Harfi, M.E.; Jbilou, M.; Hanine, H.; Rizki, H.; Fechtali, M.; Nabloussi, A. Genetic Diversity Assessment of Moroccan Sesame (Sesamum indicum L.) Populations Using Agro-morphological Traits. J. Agric. Sci. Technol. 2018, 8, 296–305. [Google Scholar] [CrossRef] [Scilit]
  78. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Mashilo, J. Genetic diversity and association of yield-related traits in sesame. Plant Breed. 2021, 40, 331–341. [Google Scholar] [CrossRef] [Scilit]
  79. Johnson, M.W.; Robinson, H.F.; Comstock, R.E. Genotypic and phenotypic correlations in soybeans and their implication in selection. Agron. J. 1955, 47, 477–483. [Google Scholar] [CrossRef] [Scilit]
  80. Panse, V.G. Genetics of quantitative characters in relation to plant breeding. Indian J. Genet. Plant Br. 1957, 17, 318–346. [Google Scholar]
  81. Divya, K.; Rani, T.S.; Babu, T.K.; Padmaja, D. Assessment of genetic variability, heritability and genetic gain in advanced mutant breeding lines of sesame (Sesamum indicum L.). Int. J. Curr. Microbiol. Ap. 2018, 71, 565–1574. [Google Scholar] [CrossRef] [Scilit]
  82. Aye, M.; Htwe, N.M. Trait association and path coefficient analysis for yield traits in myanmar sesame (Sesamum indicum L.). Germplasm. J. Exp. Agric. Int. 2019, 4, 1–10. [Google Scholar] [CrossRef] [Scilit]
  83. Abraha, M.; Shimelis, H.; Laing, M.; Assefa, K. Performance of tef [Eragrostis tef (Zucc.) Trotter] genotypes for yield and yield components under drought-stressed and non-stressed conditions. Crop Sci. 2016, 56, 1799–1806. [Google Scholar] [CrossRef] [Scilit]
  84. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Shayanowako, A.I.T. Analyses of genetic diversity and population structure of sesame (Sesamum indicum L.) germplasm collections through seed oil and fatty acid compositions and SSR markers. J. Food Compos. Anal. 2022, 110, 104545. [Google Scholar] [CrossRef] [Scilit]
  85. Maluszynski, M.; Ahloowalia, B.S.; Sigurbjornsson, B. Application of in vivo and in vitro mutation techniques for crop improvement. Euphytica 1995, 85, 303–315. [Google Scholar] [CrossRef] [Scilit]
  86. Muduli, K.C.; Mishra, R.C. Efficacy of mutagenic treatments in producing useful mutants in finger millet (Eleusine coracana Gaertn.). Indian J. Genet. Plant Breed. 2007, 67, 232–237. [Google Scholar]
  87. Ashri, A. Induced Mutations in Sesame Breeding. Proceedings of 2nd FAO/IAEA, Co-Ordinated Research Project Organized by the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture. Sesame Improvement by Induced Mutations. IAEA, Vienna, Austria, 1997, 13–20. Available online: https://inis.iaea.org/collection/NCLCollectionStore/_Public/32/007/32007909.pdf (accessed on 9 August 2022).
  88. Mutant Variety Database (MVD). The Joint FAO/IAEA Mutant Variety Database. 2022. Available online: https://mvd.iaea.org/ (accessed on 23 March 2022).
  89. Lee, J.I.; Choi, B.H. Progress and prospects of sesame breeding in Korea. In Sesame and Safflower: Status and Potential; Ashri, A., Ed.; FAO Plant Production and Protection Paper 66: Rome, Italy, 1985; pp. 137–144. [Google Scholar]
  90. Kang, C.W. Breeding for diseases and shatter resistant high yielding varieties using induced mutations in sesame. In Proceedings of the 2nd FAO/IAEA Res. Coord. Mtg, Induced Mutations for Sesame Improvement; IAEA: Vienna, Austria, 1997; pp. 48–57. [Google Scholar]
  91. Pathirana, R. Gamma ray-induced field tolerance to Phytophthora blight in sesame. Plant Breed. 1992, 108, 314–319. [Google Scholar] [CrossRef] [Scilit]
  92. Khan, A.W.; Garg, V.; Roorkiwal, M.; Golicz, A.A.; Edwards, D.; Varshney, R.K. Super-Pangenome by integrating the wild side of a species for accelerated crop improvement. Trends Plant Sci. 2020, 25, 148–158. [Google Scholar] [CrossRef] [Scilit]
  93. Yu, J.; Golicz, A.A.; Lu, K.; Dossa, K.; Zhang, Y.; Chen, J.; Wang, L.; You, J.; Fan, D.; Edwards, D.; et al. Insight into the evolution and functional characteristics of the pan-genome assembly from sesame landraces and modern cultivars. Plant Biotechnol. J. 2019, 17, 881–892. [Google Scholar] [CrossRef] [Scilit]
  94. Wang, L.; Yu, S.; Tong, C.; Zhao, Y.; Liu, Y.; Song, C. Genome sequencing of the high oil crop sesame. Genome Biol. 2014, 15, R39. [Google Scholar] [CrossRef] [Scilit]
  95. Wei, X.; Gong, H.; Yu, J.; Liu, P.; Wang, L.; Zhang, Y. Sesame FG: An integrated database for the functional genomics of sesame. Sci. Rep. 2017, 7, 2342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  96. Zhang, Y.; Wang, L.; Xin, H.; Li, D.; Ma, C.; Ding, X.; Hong, W.; Zhang, X. Construction of a high-density genetic map for sesame based on large scale marker development by specific length amplified fragment (SLAF) sequencing. BMC Plant Biol. 2013, 13, 141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  97. Ke, T.; Yu, J.; Dong, C.; Mao, H.; Hua, W.; Liu, S. OcsESTdb: A database of oil crop seed EST sequences for comparative analysis and investigation of a global metabolic network and oil accumulation metabolism. BMC Plant Biol. 2015, 15, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  98. Yu, J.; Ke, T.; Tehrim, S.; Sun, F.; Liao, B.; Hua, W. PTGBase: An integrated database to study tandem duplicated genes in plants. Database 2015, 2015, bav017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  99. Yu, J.; Dossa, K.; Wang, L.; Zhang, Y.; Wei, X.; Liao, B. PMDBase: A database for studying microsatellite DNA and marker development in plants. Nucleic Acids Res. 2016, 45, D1046–D1053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Jones, N.; Ougham, H.; Thomas, H.; Pasakinskiene, I. Markers and mapping revisited: Finding your gene. New Phytol. 2009, 183, 935–966. [Google Scholar] [CrossRef] [Scilit]
  101. Thomson, M.J.; Septiningsih, E.M.; Suwardjo, F.; Santoso, T.J.; Silitonga, T.S.; McCouch, S.R. Genetic diversity analysis of traditional and improved Indonesian rice (Oryza sativa L.) germplasm using microsatellite markers. Theor. Appl. Genet. 2007, 114, 559–568. [Google Scholar] [CrossRef] [Scilit]
  102. Laurentin, E.H.; Karlovsky, P. Genetic relationship and diversity in a sesame (Sesamum indicum L.) germplasm collection using amplified fragment length polymorphism (AFLP). BMC Genet. 2006, 7, 10. [Google Scholar] [CrossRef] [Scilit]
  103. Laurentin, H.; Karlovsky, P. AFLP fingerprinting of sesame (Sesamum indicum L.) cultivars: Identification, genetic relationship and comparison of AFLP informativeness parameters. Genet. Resour. Crop Evol. 2007, 54, 1437–1446. [Google Scholar] [CrossRef] [Scilit]
  104. Bhat, K.V.; Babrekar, P.P.; Lakhanpaul, S. Study of genetic diversity in Indian and exotic sesame (Sesamum indicum L.) germplasm using random amplified polymorphic DNA (RAPD) markers. Euphytica 1999, 110, 21–33. [Google Scholar] [CrossRef] [Scilit]
  105. Ercan, A.G.; Taskin, M.; Turgut, K. Analysis of genetic diversity in Turkish sesame (Sesamum indicum L.) populations using RAPD markers. Genet. Resour. Crop Evol. 2004, 51, 599–607. [Google Scholar] [CrossRef] [Scilit]
  106. Kim, D.H.; Zur, G.; Danin-Poleg, Y.; Lee, S.W.; Shim, K.B.; Kang, C.W.; Kashi, Y. Genetic relationships of sesame germplasm collection as revealed by inter-simple sequence repeats. Plant Breed. 2002, 121, 259–262. [Google Scholar] [CrossRef] [Scilit]
  107. Gebremichael, D.E.; Parzies, H.K. Genetic variability among landraces of sesame in Ethiopia. Afr. Crop Sci. J. 2011, 19, 1–13. [Google Scholar] [CrossRef] [Scilit]
  108. Wei, X.; Wang, L.; Zhang, Y.; Qi, X.; Wang, X.; Ding, X.; Zhang, J.; Zhang, X. Development of Simple Sequence Repeat (SSR) Markers of Sesame (Sesamum indicum L.) from a Genome Survey. Molecules 2014, 19, 5150–5162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  109. Asekova, S.; Kulkarni, K.P.; Oh, K.W.; Lee, M.H.; Oh, E.; Kim, J.I.; Yeo, U.; Pae, U.S.; Ha, T.J.; Kim, S.U. Analysis of molecular variance and population structure of sesame (Sesamum indicum L.) genotypes using SSR markers. Plant Breed. Biotechnol. 2018, 6, 321–336. [Google Scholar] [CrossRef] [Scilit]
  110. Araújo, E.D.S.; Arriel, N.H.C.; Santos, R.C.D.; Lima, L.M.D. Assessment of genetic variability in sesame accessions using SSR markers and morpho agronomic traits. Aust. J. Crop Sci. 2019, 13, 45–54. [Google Scholar] [CrossRef] [Scilit]
  111. Basak, M.; Uzun, B.; Yol, E. Genetic diversity and population structure of the Mediterranean sesame core collection with use of genome-wide SNPs developed by double digest RAD-Seq. PLoS ONE 2019, 14, e0223757. [Google Scholar] [CrossRef] [Scilit]
  112. Tesfaye, T.; Tesfaye, K.; Keneni, G.; Ziyomo, C.; Alemu, T. Genetic diversity of Sesame (Sesamum indicum L.) using high throughput diversity array technology. J. Crop Sci. Biotechnol. 2022, 25, 359–371. [Google Scholar] [CrossRef] [Scilit]
  113. Wei, W.; Qi, X.; Wang, L.; Zhang, Y.; Hua, W.; Li, D.; Lv, H.; Zhang, X. Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired-end sequencing and development of EST-SSR markers. BMC Genom. 2011, 19, 12–451. [Google Scholar] [CrossRef] [Scilit]
  114. Frary, A.; Tekin, P.; Celik, I.; Furat, S.; Uzun, B.; Doganlar, S. Morphological and molecular diversity in Turkish sesame germplasm and selection of a core set for inclusion in the national collection. Crop Sci. 2014, 54, 702–711. [Google Scholar] [CrossRef] [Scilit]
  115. Pham, T.D.; Geleta, M.; Bui, T.M.; Bui, T.C.; Merker, A.; Carlsson, A.S. Comparative analysis of genetic diversity of sesame (Sesamum indicum L.) from Vietnam and Cambodia using agro-morphological and molecular markers. Hereditas 2011, 148, 28–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  116. Tabatabaei, I.; Pazouki, L.; Bihamta, M.R.; Mansoori, S.; Javaran, M.J.; Niinemets, Ü. Genetic variation among Iranian sesame (Sesamum indicum L.) accessions vis-à-vis exotic genotypes on the basis of morpho-physiological traits and RAPD markers. Aust. J. Crop Sci. 2011, 11, 1396–1407. [Google Scholar]
  117. Uncu, A.O.; Gultekin, V.; Allmer, J.; Frary, A.; Doganlar, S. Genomic simple sequence repeat markers reveal patterns of genetic relatedness and diversity in sesame. Plant Genome. 2015, 8, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  118. Joshi, A.B. Sesamum; Indian Central Oilseed Committee: Hyderabad, India, 1961. [Google Scholar]
  119. Tiwari, S.; Kumar, S.; Gontia, I. Biotechnological approaches for sesame (Sesamum indicum L.) and Niger (Guizotia abyssinica L.f. Cass.). Asia Pac. J. Mol. Biol. Biotechnol. 2011, 19, 2–9. [Google Scholar]
  120. Zhang, X.; Zhang, K.; Wu, J.; Guo, N.; Liang, J.; Wang, X. QTL-Seq and sequence assembly rapidly mapped the gene BrMYBL2.1 for the purple trait in Brassica rapa. Sci. Rep. 2020, 10, 2328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  121. Tanksley, S.D.; Ganal, M.W.; Prince, J.P.; de Vicente, M.C.; Bonierbale, M.W.; Broun, P. High density molecular linkage maps of the tomato and potato genomes. Genetics 1992, 132, 1141–1160. [Google Scholar] [CrossRef] [Scilit]
  122. Wang, L.; Xia, Q.; Zhang, Y.; Zhu, X.; Zhu, X.; Li, D.; Ni, X.; Gao, Y.; Xiang, H.; Wei, X.; et al. Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic map. BMC Genom. 2016, 17, 31. [Google Scholar] [CrossRef] [Scilit]
  123. Mei, H.; Liu, Y.; Du, Z.; Wu, K.; Cui, C.; Jiang, X. High-density Genetic map construction and gene Mapping of basal branching habit and flowers per leaf axil in Sesame plant materials and trait investigation. Front. Plant Sci. 2017, 8, 636. [Google Scholar] [CrossRef] [Scilit]
  124. Wang, L.; Li, D.; Zhang, Y.; Gao, Y.; Yu, J.; Wei, X.; Zhang, X. Tolerant and susceptible sesame genotypes reveal waterlogging stress response patterns. PLoS ONE 2016, 11, e0149912. [Google Scholar] [CrossRef] [Scilit]
  125. Wu, K.; Liu, H.; Yang, M.; Tao, Y.; Ma, H.; Wu, W.; Zuo, Y.; Zhao, Y. High-density genetic map construction and QTLs analysis of grain yield-related traits in Sesame (Sesamum indicum L.) based on RAD-Seq technology. BMC Plant Biol. 2014, 14, 1–14. [Google Scholar] [CrossRef] [Scilit]
  126. Zhang, H.; Miao, H.; Li, C.; Wei, L.; Duan, Y.; Ma, Q.; Kong, J.; Xu, F.; Chang, S. Ultra-dense SNP genetic map construction and identification of SiDt gene controlling the determinate growth habit in Sesamum indicum L. Sci. Rep. 2016, 6, 31556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  127. Zhao, Y.; Yang, M.; Wu, K.; Liu, H.; Wu, J.; Liu, K. Characterization and genetic mapping of a novel recessive genic male sterile gene in sesame (Sesamum indicum L.). Mol. Breed. 2013, 32, 901–908. [Google Scholar] [CrossRef] [Scilit]
  128. Li, C.; Miao, H.; Wei, L.; Zhang, T.; Han, X.; Zhang, H. Association Mapping of Seed Oil and Protein Content in Sesamum indicum L. Using SSR Markers. PLoS ONE 2014, 9, e105757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  129. Yan-xin, Z.; Lin-hai, W.; Dong-hua, L.I.; Yuan, G.A.O.; Hai-xia, L.Ü.; Xiu-rong, Z. Mapping of Sesame Waterlogging Tolerance QTL and Identification of Excellent Waterlogging Tolerant Germplasm. Sci. Agric. Sin. 2014, 47, 422–430. [Google Scholar]
  130. Dossa, K.; Niang, M.; Assogbadjo, A.E.; Cisse, N.; Diouf, D. Whole genome homology-based identification of candidate genes for drought tolerance in sesame (Sesamum indicum L.). Afr. J. Biotechnol. 2016, 15, 1464–1475. [Google Scholar]
  131. Dossa, K.; Diouf, D.; Wang, L.; Wei, X.; Zhang, Y.; Niang, M.; Fonceka, D.; Yu, J.; Mmadi, M.A.; Yehouessi, L.W.; et al. The Emerging Oilseed Crop Sesamum indicum Enters the “Omics” Era. Front. Plant Sci. 2017, 8, 1154. [Google Scholar] [CrossRef] [Scilit]
  132. Chowdhury, S.; Basu, A.; Kundu, S. Overexpression of a new osmotinlike protein gene (SindOLP) confers tolerance against biotic and abiotic stresses in sesame. Front. Plant Sci. 2017, 8, 410. [Google Scholar] [CrossRef] [Scilit]
  133. Davey, J.W.; Hohenlohe, P.A.; Etter, P.D.; Boone, J.Q.; Catchen, J.M.; Blaxter, M.L. Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat. Rev. Genet. 2011, 17, 499–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  134. Ganal, M.W.; Durstewitz, G.; Polley, A.; Berard, A.; Buckler, E.S.; Charcosset, A.; Clarke, J.D.; Graner, E.M.; Hansen, M.; Joets, J.; et al. A large maize (Zea mays L.) SNP genotyping array: Development and germplasm genotyping, and genetic mapping to compare with the B73 reference genome. PLoS ONE 2011, 6, e28334. [Google Scholar] [CrossRef] [Scilit]
  135. Sim, S.C.; Durstewitzm, G.; Plieske, J.; Wieseke, R.; Ganal, M.W.; Deynze, A.V.; Hamilton, J.P.; Buell, C.R.; Causse, M.; Wijeratne, S.; et al. Development of a large SNP genotyping array and generation of high-density genetic maps in tomato. PLoS ONE 2012, 7, e40563. [Google Scholar]
  136. Wang, S.; Chen, J.; Zhang, W.; Hu, Y.; Chang, L.; Fang, L.; Wang, Q.; Lv, F.; Wu, H.; Si, Z.; et al. Sequence-based ultra-dense genetic and physical maps reveal structural variations of allopolyploid cotton genomes. Genome Biol. 2015, 16, 108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  137. Zhao, X.; Han, Y.; Li, Y.; Liu, D.; Sun, M.; Zhao, Y.; Lv, C.; Li, D.; Yang, Z.; Huang, L.; et al. Loci and candidate gene identification for resistance to Sclerotinia sclerotiorum in soybean (Glycine max L. Merr.) via association and linkage maps. Plant J. 2015, 82, 245–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  138. Zhang, H.; Miao, H.; Wei, L.; Li, C.; Zhao, R.; Wang, C. Genetic analysis and QTL mapping of seed coat color in sesame (Sesamum indicum L.). PLoS ONE 2013, 8, e63898. [Google Scholar]
  139. Miao, H. The genome of Sesamum indicum L. In Proceedings of the Plant and Animal Genome XXII Conference. Plant and Animal Genome, San Diego, CA, USA, 7–13 January 2016. [Google Scholar]
  140. Zhang, H.; Miao, H.; Wei, L.; Li, C.; Duan, Y.; Xu, F.; Qu, W.; Zhao, R.; Ju, M.; Chang, S. Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening. BMC Plant Biol. 2018, 18, 296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  141. Yol, E.; Uzun, B. Geographical patterns of sesame (Sesamum indicum L.) accessions grown under Mediterranean environmental conditions, and establishment of a core collection. Crop Sci. 2012, 52, 2206–2214. [Google Scholar] [CrossRef] [Scilit]
  142. Yadav, M.; Sainger, D.C.M.; Jaiwal, P.K. Agrobacterium tumefaciensmediated genetic transformation of sesame (Sesamum indicum L.). Plant Cell Tissue Organ Cult. 2010, 103, 377–386. [Google Scholar] [CrossRef] [Scilit]
  143. Al-Shafeay, A.F.; Ibrahim, A.S.; Nesiem, M.R.; Tawfik, M.S. Establishment of regeneration and transformation system in Egyptian sesame (Sesamum indicum L.) cv Sohag1. GM Crops. 2011, 2, 182–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  144. Chowdhury, S.; Basu, A.; Kundu, S. A new high-frequency Agrobacterium-mediated transformation technique for Sesamum indicum L. using de-embryonated cotyledon as explant. Protoplasma 2014, 251, 1175–1190. [Google Scholar] [CrossRef] [Scilit]
  145. David, V.; Řepková, J. Application of next-generation sequencing in plant breeding. Czech J. Genet. Plant Breed. 2017, 53, 89–96. [Google Scholar] [CrossRef] [Scilit]
  146. Zhu, H.; Li, C.; Gao, C. Applications of CRISPR–Cas in agriculture and plant biotechnology. Nat. Rev. Mol. Cell Biol. 2020, 21, 661–677. [Google Scholar] [CrossRef] [Scilit]
  147. Zhang, K.; Nie, L.; Cheng, Q.; Yin, Y.; Chen, K.; Qi, F.; Zou, D.; Liu, H.; Zhao, W.; Wang, B. Effective editing for lysophosphatidic acid acyltransferase 2/5 in allotetraploid rapeseed (Brassica napus L.) using CRISPR-Cas9 system. Biotechnol. Biofuels. 2019, 12, 225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  148. He, J.; Zhang, K.; Tang, M.; Zhou, W.; Chen, L.; Chen, Z.; Li, m. CRISPR-based genome editing technology and its applications in oil crops. Oil Crop Sci. 2021, 6, 105–113. [Google Scholar] [CrossRef] [Scilit]
  149. Wang, L.; Zhang, Y.; Qi, X.; Li, D.; Wei, W.; Zhang, X. Global gene expression responses to waterlogging in roots of sesame (Sesamum indicum L.). Acta Physiol. Plant. 2012, 34, 2241–2249. [Google Scholar] [CrossRef] [Scilit]
  150. Ashri, A. Sesame (Sesamum indium L.). In Genetic Resources, Chromosome Engineering, and Crop Improvement; Singh, R.J., Ed.; CRC Press: Boca Raton, FL, USA, 2007; Volume 4, pp. 231–289. [Google Scholar]
  151. Dossa, K.; Wei, X.; Li, D.; Zhang, Y.; Wang, L.; Fonceka, D.; Zhang, Y.; Wang, L.; Yu, J.; Boshuo, L.; et al. Insights into the AP2/ERF transcription factor superfamily in sesame (Sesamum indicum) and expression profiling of the DREB subfamily under drought stress. BMC Plant Biol. 2016, 16, 171. [Google Scholar] [CrossRef] [Scilit]
  152. Dossa, K.; Li, D.; Wang, L.; Zheng, X.; Yu, J.; Wei, X.; Fonceka, D.; Zhang, Y.; Wang, L.; Yu, J.; et al. Dynamic transcriptome landscape of sesame (Sesamum indicum L.) under progressive drought and after rewatering. Genomic Data 2017, 11, 122–124. [Google Scholar] [CrossRef] [Scilit]
  153. Simoglou, K.B.; Anastasiades, A.I.; Baixeras, J.; Roditakis, E. First report of Antigastra catalaunalis on sesame in Greece. Entomol. Hell. 2017, 26, 6–12. [Google Scholar] [CrossRef] [Scilit]
  154. Ramanujam, S. The cytogenetics of an amphidiploid Sesamum orientale and S. prostratum. Curr. Sci. 1944, 13, 40–41. [Google Scholar]
  155. Rao, G.P.; Un, N.S.; MadhuPriya. Overview on a century progress in research on sesame phyllody disease. Phytopathogenic Mollicutes 2015, 5, 74–83. [Google Scholar] [CrossRef] [Scilit]
  156. Rao, G.P.; Kumar, A.; Baranwal, V.K. Classification of sesame phytoplasma strain in India at 16Sr subgroup level. J. Plant Pathol. 2015, 3, 523–528. [Google Scholar] [CrossRef] [Scilit]
  157. Win, N.K.K.; Back, C.; Jung, H.Y. Phyllody phytoplasma infecting sesame in Myanmar belongs to group 16SrI and subgroup 16SrI-B. Tropical. Plant Pathol. 2010, 35, 310–313. [Google Scholar] [CrossRef] [Scilit]
  158. Tseng, Y.W.; Deng, W.L.; Chang, C.J.; Huang, J.W.; Jan, F.J. First report on the association of a 16SrII-A phytoplasma with sesame (Sesamum indicum) exhibiting abnormal stem curling and phyllody in Taiwan. Plant Dis. 2014, 98, 990. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  159. Catal, M.; Ikten, C.; Yol, E.; Ustun, R.; Uzun, B. First report of a 16SrIX group (pigeon pea witches’-broom) phytoplasma associated with sesame phyllody in Turkey. Plant Dis. 2013, 97, 835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  160. Singh, P.K.; Akram, M.; Vajpeyi, M.; Srivastava, R.L.; Kumar, K.; Naresh, R. Screening and development of resistant sesame varieties against phytoplasma. Bull. Insectol. 2007, 60, 303–304. [Google Scholar]
  161. Ahirwar, R.M.; Banerjee, S.; Gupta, M.P. Insect pest management in sesame crop by intercropping system. Ann. Plant Sci. 2009, 17, 225–226. [Google Scholar]
  162. Altieri, M.A.; Koohafkan, P. Enduring Farms: Climate Change, Smallholders and Traditional Farming Communities. In Environment and Development Series 6; Third World Network: Pulau Pinang, Malaysia, 2008. [Google Scholar]
  163. Chambers, R. Rapid Appraisal: Rapid, Relaxed and Participatory IDS Discussion Paper; Institute of Development Studies: Brighton, UK, 1992; Volume 311, p. 90. [Google Scholar]
Figure 1. Total sesame production (million tons) and seed yield (tons ha−1) from 2011 to 2020 globally (adapted from FAOSTAT [13]).
Figure 1. Total sesame production (million tons) and seed yield (tons ha−1) from 2011 to 2020 globally (adapted from FAOSTAT [13]).
Agronomy 12 02144 g001
Table 1. Regions of global sesame production in 2020.
Table 1. Regions of global sesame production in 2020.
Region/ContinentArea
(× 103 ha)
Production
(× 103 tons)
% of World
Production
Average Yield
(tons·ha−1)
Africa9692.174282.9959.050.54
Asia4064.402645.2336.471.13
Latin America462.37306.374.220.71
Europe25.5618.690.260.88
AustraliaNANANANA
World14,244.507253.28NA0.79
Source: FAOSTAT [13]; NA = data not available.
Table 2. The top 10 sesame-producing countries in 2020 with the total area, production, and yield globally.
Table 2. The top 10 sesame-producing countries in 2020 with the total area, production, and yield globally.
CountryArea
(× 103 ha)
Production
(× 103 tons)
% of World
Production
Yield
(tons·ha−1)
Sudan5173.521525.1021.020.29
China554.97896.6312.361.62
Myanmar1500.00740.0010.200.49
The United Republic of Tanzania960.00710.009.780.74
India1520.00658.009.070.43
Nigerian621.41490.006.760.79
Burkina Faso450.00270.003.720.60
Ethiopia369.90260.263.590.70
Chad392.24202.072.790.52
South Sudan608.16189.722.610.31
World14,244.507253.28NA0.79
Source: FAOSTAT [13]; NA = data not available.
Table 3. Modern sesame varieties reported globally with desirable agronomic and seed oil traits.
Table 3. Modern sesame varieties reported globally with desirable agronomic and seed oil traits.
VarietyPedigreeTraitCountryYear of ReleaseReferences
Sin-Yadana 4-Good export qualityChina1994[12]
Ju-Ni-Poke-Stable yield and high oil contentMyanmar1994[12]
Me-Daw-Let-The-Stable yield and high oil content1994
Gwa-Taya-Stable yield1994
Gwa-Kyaw-Net-Stable yield1994
Humera-1ACC.038 sel.1Early maturity, better yield and broad adaptabilityEthiopia2010[17]
Setit-1Col sel p#1Early maturity, better yield and oil content and broad adaptability2010
DangurE.W.013.(8)High oil contentEthiopia2015[49]
BaHaNechoW-109/WSS/
(Acc-EW-012(5)
Better yield and oil content2016
BaHaZeyitW- 119/WSM/
(Acc-EW-023(1)
Better yield and oil content2016
Setit-2J-03Early maturity, better yield, and broad adaptability2016
Setit-3HuARC-4Early maturity, better yield and oil content, and broad adaptability 2017
WaliinBG-004-1Better yield and oil content 2017
Gida AyanaAss-acc-29Late maturity, better yield and oil content, and broad adaptability 2018
HagaloEW002 × Obsa22-1Late maturity, better yield, resistance to bacterial blight, and broad adaptability 2019
YaleEW002 × Dicho 5-3Late maturity, better yield and oil content, resistance to bacterial blight, and broad adaptability 2019
RAMA‘Khosla’ localMedium seed size and brown seed colorIndia1989[53]
OSC-593-White seed color1995
TKG-352 - White seed color1995
TMV 1 - Erect, fairly bushy with moderate branching, 4-loculed, red brown to black seeds, and better oil content 1939[54]
TMV 2Nagpur white × SatturOpen, moderate branching, 6–8-loculed, cylindrical big sized capsules, and dark brown to black seeds
Suitable for cold weather conditions and better oil content
1942
TMV 3South Arcot variety × Malabar Variety Bushy with profuse branching, 4-loculed, dark brown to black seeds, and better oil content 1943
KRR 1 - Bushy with profuse branching, 4-loculed, brown seeds, and better oil content 1967
KRR 2Karur local × Bombay whiteBushy with profuse branching, 4-loculed, better oil content, and white seeds 1970
TMV 4 - Bushy with profuse branching, 4-loculed, brown seeds, and better oil content 1977
TMV 5 - Erect with moderate branching, 4-loculed, brown seeds, and better oil content 1978
TMV 6 - Erect with moderate branching, 4-loculed, brown seeds, and better oil content 1980
CO 1(TMV 3 × Si 1878) × Si 1878Bushy plant, 4-loculed, black warty seeds, and better oil content 1983
Paiyur 1 Si2511 × Si 2314 Resistance to powdery mildew, 4-loculed, bushy, suitable for irrigated condition, black seeds, and better oil content 1990
SVPR 1 - White seeds, 4-loculed, high yield, suitable for irrigated conditions, and better oil content 1992
VRI 1 - Early maturity, 4-loculed, and better oil content 1995
VRISV2 US9003 × TMV6 Moderate resistance to shoot webber, 4-loculed, and higher oil content 2005
TMV (Sv) 7 High yield, 4-loculed, tolerance to root rot disease, lustrous brown testa, and higher oil content 2009
VRI 3 SVPR 1 × TKG 87 Moderate resistance to phyllody and root rot diseases, white seed, and higher oil content 2017
MoA = Minstry of Agriculture; - = data not available.
Table 4. The major sesame gene banks globally.
Table 4. The major sesame gene banks globally.
CountryInstitutionTotal Number of AccessionsWebsiteReference
IndiaNational Bureau of Plant Genetic Resources10,359www.nbpgr.ernet.in (accessed on 5 December 2021)[55]
ChinaOil Crops Research Institute>8000http://www.sesame-bioinfo.org/phenotype/index.html (accessed on 5 December 2021)[56]
South KoreaNational Agrobiodiversity Center, Rural Development Administration7698http://www.rda.go.kr/foreign/ten/ (accessed on 5 December 2021)[57]
United States of AmericaUSDA-ARS-PGRU1226www.ars.usda.gov (accessed on 5 December 2021)[58]
USDA-ARS-PGRU = United States Department of Agriculture—Agricultural Research Service—Plant Genetic Resource Unit.
Table 5. Some sesame varieties developed through induced mutation with traits descriptions.
Table 5. Some sesame varieties developed through induced mutation with traits descriptions.
Variety NameTraitCountryYear of ReleaseReference
NIAB-PearlHigher capsules per plantPakistan2017[88]
NIAB-Sesame 2016High oil content2016
Binatil-3High yieldBangladesh2013[88]
Cairo white 8NonbranchingEgypt1992[87]
Senai white 48Seed color1992
KalikaShort statureIndia1980[87]
UMAUniform maturity1990
USHAHigher yield1990
BabilEarlinessIraq1992[87]
RafidenEarliness1992
EshtarCapsule size1992
AhnsanDisease resistanceSouth Korea1985[87]
SuweonLodging and disease resistance1991
YangbaekHigher oil content1995
PungsanDeterminate growth habit and high seed retention1996
SeodunHigher oleic acid content and phytophthora blight tolerance1997
ANK-2Disease resistanceSri Lanka1995[87]
MVD = Mutant Variety Database.
Table 6. Online genomic resources for sesame.
Table 6. Online genomic resources for sesame.
DatabaseWebsiteUtilityReference
Sinbasehttp://www.ocri-genomics.org/Sinbase/index.html. (accessed on 9 August 2022)Genomics, comparative genomics, genetics, phenotypes, etc.[94]
SesameHapMaphttp://202.127.18.228/SesameHapMap/ (accessed on 9 August 2022)Genome-wide SNP[61]
SesameFGhttp://www.ncgr.ac.cn/SesameFG (accessed on 9 August 2022)Genomics, evolution, breeding, comparative genomics, molecular markers, phenotypes, transcriptomics[95]
SisatBasehttp://www.sesame-bioinfo.org/SisatBase/ (accessed on 9 August 2022)Genome-wide SSR-
The Sesame Genome Projecthttp://www.sesamegenome.org (accessed on 9 August 2022)Genomics[96]
Sesame Germplasm Resource Information Databasehttp://www.sesame-bioinfo.org/phenotype/index.html (accessed on 9 August 2022)Plant phenotype-
NCBI∗http://www.ncbi.nlm.nih.gov/genome/?term=sesame (accessed on 9 August 2022)Versatile-
ocsESTdb∗http://www.ocri-genomics.org/ocsESTdb/index.html (accessed on 9 August 2022)Seed expression sequence tags, comparative genomics[97]
PTGBase∗http://www.ocri-genomics.org/PTGBase/index.html (accessed on 9 August 2022)Tandem duplication, evolution[98]
PMDBase∗http://www.sesame-bioinfo.org/PMDBase (accessed on 9 August 2022)SSR information[99]
* these databases involve several species including sesame.
Table 7. Some polymorphic SSR markers developed for genetic analysis in sesame.
Table 7. Some polymorphic SSR markers developed for genetic analysis in sesame.
Marker Sequence
PrimersForward Primer SequenceReverse Primer SequenceReferences
GBssr-sa-05TCATATATAAAAGGAGCCCAACGTCATCGCTTCTCTCTTCTTC[46]
GBssr-sa-08GGAGAAATTTTCAGAGAGAAAAAATTGCTCTGCCTACAAATAAAA
Sesame-09CCCAACTCTTCGTCTATCTCTAGAGGTAATTGTGGGGGA
GBssr-sa-33TTTTCCTGAATGGCATAGTTGCCCAATTTGTCTATCTCCT
GBssr-sa-123GCAAACACATGCATCCCTGCCCTGATGATAAAGCCA
GBssr-sa-182CCATTGAAAACTGCACACAATCCACACACAGAGAGCCC
GBssr-sa-184TCTTGCAATGGGGATCAGCGAACTATAGATAATCACTTGGAA
SSR-ES-12GCTGAGGAGTCTTGAAGCAGACAAAATCCCCCAACTCGATA[53]
SSR-ES-15TGCAGGAATGAACTCAAGGAACCTTATTCCCAGCCCACTT
ZM_2CTTCTTGAAGTTCTGGTGTTGATTCTTGGAGAAAGAGTGAGG[111]
ZM_3ATCACCACACACTGACACAGCGTGTCTGAGAATCCAATATC
ZM_6GGTGTGTTCTCTCTCTCACACGGGCTGCTCAATAAATGTAG
ZM_7ATCCTCTGCTCCTAACTTCATTCTGGTACTATCCTCAAGCAA
ZM_10ATGCCCATCTCCATATACTCTAATTCTTGCCTGACTCTACG
ZM_11GGATTCTCTAGACATGGCTTTAACGCAGAATTCTCTCCTACT
ZM_12ATTGCTGTGCAATCCTTATCATCTCTTTCTACCACCACGTT
ZM_13GCAGAAGGCAATAAAGTCAT GGCGTCAGAAGAAAAATACTG
ZM_14GGAAGGCGAGTTGATAGATAACATGGGATGTTCAAAGAACT
ZM_17CTTGCTTCCTCTTTTCTCTCTACACTGTACTCAGCGGATTT
ZM_18AATACCCTTCAGTATTCAGGTGCAACAACACAAACACTGCTAC
ZM_20GGGATGTTGATAGAGATGTTGTCTTTCACTCTCACACACACA
ZM_21CTCTCTCTCTCTGCTGTTTCAGCCATACGATCTCAAAATCAC
ZM_22ACCACCGATCTACTCACTTTTCCACTGCACACTACAGTTTTT
ZM_30CACTCCACTCATTATCCAAAGCAAGACACAACTGACACGTAA
ZM_34AAGTCCCTTTTCAAGCAATCGAGAGAGGAAAATGCAGAGAG
ZM_39AGAGGCAGAGGAGTTGATAATCTTAACTGTAACTCCCTTTTCG
ZM_40CGAAAAGGGAGTTACAGTTAAGCTTCCTCTCCTATCATCCTGT
ZM_44GTCTTAAGCCCTCTTAGTTCCGAAAACCTTCAATGTCAGGA
ZM_45GCAAAATCTCTGTTGTCTCAGGTGTTCCTACCACTCAACACA
ZM_47GTTTCCAGGTCTATTCCTTTGAGGTAGAGCTAATCCTTACCG
Table 8. Quantitative trait loci (QTLs) and associated phenotypic traits in sesame.
Table 8. Quantitative trait loci (QTLs) and associated phenotypic traits in sesame.
TraitsName of QTLMarkers TypeMarker Code/NumberMapping PopulationReference
Production Enhancement
Grain yieldQgn-1, Qgn-6,SLAF9378150 BC1[96,122,123]
Number of seeds per capsuleQgn-12
1000-seed weightQtgw-11
Seed coat colorQTL-1, QTL11-1, QTL11-2, QTL13-1
Seed coat colorqSCa-8.2, qSCb-4.1, qSCb-8.1,
qSCb-11.1, qSCl-4.1, qSCl-8.1,
qSCl-11.1, qSCa-4.1 and qSCa-8.1
SLAF
SNP
1233107 F2
430 recombinant inbred lines (RILS, F8)
-
Seed coat colorSiPPO (SIN_1016759)SSR400500 RILs (F6)[35]
Plant heightQph-6 and Qph-12SNP1,800,000705 worldwide accessions[61]
Semi-dwarf
plant phenotype
QTL (qPH-3.3), Gene SiGA20ox1 (SIN_1002659)SNP
SSR
400430 RILS (F8)
500 RILs (F6)
[35,124]
Plant heightSiDFL1 (SIN_1014512) andSiILR1 (SIN_1018135)SNP1,800,000705 worldwide accessions[61]
Number of capsules per plantQcn-11SNP
SSR
InDels
1190
22
18
224 (RIL), F8:9[125]
First capsule heightQfch-4, Qfch-11, and Qfch-12
Capsule axis lengthQcal-5 and Qcal-9
Capsule lengthQcl-3, Qcl-4, Qcl-7, Qcl-8, and Qcl-12
Number of capsules per axilSiACS (SIN_1006338)SNP1,800,000705 worldwide accessions[61]
Mono flower vs. triple flowerSiFASLAF (Marker58311, Marker34507, Marker36337)9378150 BC1[123]
Flowering timeSiDOG1 (SIN_1022538) and SiIAA14SNP-705 sesame accessions[61]
Determinate growth habitGene SiDt (DS899s00170.023)NP30,193120 F2[126]
Branching habitSiBHSLAF (Marker129539, Marker41538, Marker31462)9378150 BC1[126]
Recessive GMSRecessive GMS geneSiMs1AFLP markers P01MC08, P06MG04, P12EA14-237 NILs (near-isogenic lines)[127]
Dominant GMSSBM298 and GB50SSR1500Noval GMS line W1098A (backcrossing and sib-mating); BC2F6[128]
Stress-Related
Waterlogging toleranceqEZ09ZCL13, qWH09CHL15, qEZ10ZCL07, qWH10ZCL09, qEZ10CHL07, and qWH10CHL09SSR (ZM428) closely linked toqWH10CHL09113206 RIL F6[122,129]
Drought toleranceTF (transcription factor) families (AP2/ERF and HSF)---[130,131]
Tolerance to drought, salinity, oxidative stresses, and charcoal rotOsmotin-like gene (SindOLP)---[132]
Gene for Oil Traits
Sesamin productionSiDIR (SIN_1015471), SiPSS (SIN_1025734)SNP1,800,000705 worldwide accessions[61]
Oil contentSIN_1003248, SIN_1013005, SIN_1019167, SIN_1009923 SiPPO (SIN_1016759) SiNST1 (SIN_1005755)
Fatty acid compositionSiKASI (SIN_1001803), SiKASII (SIN_1024652), SiACNA (SIN_1005440), SiDGAT2 (SIN_1019256), SiFATA (SIN_1024296), SiFATB (SIN_1022133), SiSAD (SIN_1008977), SiFAD2 (SIN_1009785)
Sesamin and sesamolin contentSiNST1 (SIN_1005755)
Protein contentSiPPO (SIN_1016759)
SLAF: specific length amplified fragment sequencing; SNP: single-nucleotide polymorphism; SSR: simple sequence repeat; AFLP: amplified fragment length polymorphism; Indels: insertions–deletions; GMS: genetic male sterility.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Teklu, D.H.; Shimelis, H.; Abady, S. Genetic Improvement in Sesame (Sesamum indicum L.): Progress and Outlook: A Review. Agronomy 2022, 12, 2144. https://doi.org/10.3390/agronomy12092144

AMA Style

Teklu DH, Shimelis H, Abady S. Genetic Improvement in Sesame (Sesamum indicum L.): Progress and Outlook: A Review. Agronomy. 2022; 12(9):2144. https://doi.org/10.3390/agronomy12092144

Chicago/Turabian Style

Teklu, Desawi Hdru, Hussein Shimelis, and Seltene Abady. 2022. "Genetic Improvement in Sesame (Sesamum indicum L.): Progress and Outlook: A Review" Agronomy 12, no. 9: 2144. https://doi.org/10.3390/agronomy12092144

APA Style

Teklu, D. H., Shimelis, H., & Abady, S. (2022). Genetic Improvement in Sesame (Sesamum indicum L.): Progress and Outlook: A Review. Agronomy, 12(9), 2144. https://doi.org/10.3390/agronomy12092144

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop