Single-Nucleotide Polymorphisms in Bmy1 Intron III Alleles Conferring the Genotypic Variations in β-Amylase Activity under Drought Stress between Tibetan Wild and Cultivated Barley
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Cultivation and Drought Treatment
2.2. Measurement of β-Amylase Activity
2.3. DNA Extraction
2.4. Polymorphism Analysis of the Bmy1 Gene, Cloning, and Sequencing of Bmy1 Intron III
2.5. Statistical Analysis
3. Results
3.1. Polymorphisms of Bmy1 DNA
3.2. Bmy1 Gene Intron III Alleles
3.3. Polymorphisms of Bmy1 cDNA and Amino Acid Composition
3.4. The Effect of Drought on β-Amylase Activity
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Delcour, J.A.; Versciiaeve, S. Malt Diastatic Activity. Part ii. A Modified Ebc Diastatic Power Assay for the Selective Estimation of Jie7vi-Amylase Activity. Time and Temperature Dependence Ofthe Release of Reducing Sugars. J. Inst. Brew. 1987, 33, 296–301. [Google Scholar] [CrossRef] [Scilit]
- Arends, A.M.; Fox, G.P.; Henry, R.J.; Marschke, R.J.; Symons, M.H. Genetic and Environmental Variation in the Diastatic Power of Australian Barley. J. Cereal Sci. 1995, 21, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Solah, T.S. Diastatic power in malted barley-contributions of malt parameters to its development and the potential of barley grain β-amylase to predict malt diastatic power. J. Inst. Brew. 1995, 101, 277–280. [Google Scholar]
- Powling, A.; Islam, A.K.; Shepherd, K.W. Isozymes in wheat-barley hybrid derivative lines. Biochem. Genet. 1981, 19, 237–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nielsen, G.; Johansen, H.; Jensen, J.; Hejgaard, J. Localization on barley chromosome 4 of genes coding for β-amylase (Bmy1) and protein Z (Paz1). Barley Genet. Newsl. 1983, 13, 55–57. [Google Scholar]
- Kreis, M.; Williamson, M.S.; Shewry, P.R.; Sharp, P.; Gale, M. Identification of a second locus encoding β-amylase on chromosome 2 of barley. Genet. Res. 1988, 51, 13–16. [Google Scholar] [CrossRef] [Scilit]
- Yoshigi, N.; Okada, Y.; Sahara, H.K.S. PCR cloning and sequencing of the β-amylase cDNA from barley. J. Biochem. 1994, 115, 47–51. [Google Scholar] [CrossRef] [Scilit]
- Hayes, P.M.; Liu, B.H.; Knapp, S.J.; Chen, F.; Jones, B.; Blake, T.; Franckowiak, J.; Rasmusson, D.; Sorrells, M.; Ullrich, S.E.; et al. Quantitative trait locus effects and environmental interaction in a sample of North American barley germ plasm. TAG. Theor. Appl. Genetics. Theor. Angew. Genet. 1993, 87, 392–401. [Google Scholar] [CrossRef] [Scilit]
- Erkkila, M.J.; Leah, R.; Ahokas, H.; Cameron-Mills, V. Allele-dependent barley grain beta-amylase activity. Plant Physiol. 1998, 117, 679–685. [Google Scholar] [CrossRef] [Scilit]
- Vinje, M.A.; Duke, S.H.; Henson, C.A. Utilization of Different Bmy1 Intron III Alleles for Predicting β-Amylase Activity and Thermostability in Wild and Cultivated Barley. Plant Mol. Biol. Rep. 2010, 28, 491–501. [Google Scholar] [CrossRef] [Scilit]
- Sjakste, T.G.; Zhuk, A.F. Novel haplotype description and structural background of the eventual functional significance of the barley beta-amylase gene intron III rearrangements. TAG. Theor. Appl. Genetics. Theor. Und Angew. Genet. 2006, 113, 1063–1079. [Google Scholar] [CrossRef] [Scilit]
- Kaneko, T.; Kihara, M.; Ito, K. Genetic analysis of β-amylase thermostability to develop a DNA marker for malt fermentability improvement in barley, Hordeum vulgare. Plant Breed. 2000, 119, 197–201. [Google Scholar] [CrossRef] [Scilit]
- Erkkila, M.J.; Ahokas, H. Special barley P-amylase allele in a Finnish landrace line HA52 with high grain enzyme activity. Hereditas 2001, 134, 91–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.F.; Evans, D.E.; Logue, S.J.; Langridge, P. Mutations of barley beta-amylase that improve substrate-binding affinity and thermostability. Mol. Genet. Genom. MGG 2001, 266, 345–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pairs, M.; Jones, M.G.; Eglinton, J.K. Genotyping Single Nucleotide Polymorphisms for Selection of Barley-amylase Alleles. Plant Mol. Biol. Rep. 2002, 20, 149–159. [Google Scholar] [CrossRef] [Scilit]
- Gunkel, J.; Voetz, M.; Rath, F. Effect of the Malting Barley Variety Hordeum vulgare L. on Fermentability. J. Inst. Brew. 2002, 108, 355–361. [Google Scholar] [CrossRef] [Scilit]
- Coventry, S.J.; Collins, H.M.; Barr, A.R.; Jefferies, S.P.; Chalmers, K.J.; Logue, S.J.; Langridge, P. Use of putative QTLs and structural genes in marker assisted selection for diastatic power in malting barley (Hordeum vulgare L.). Aust. J. Agric. Res. 2003, 54, 1241–1250. [Google Scholar] [CrossRef] [Scilit]
- Li, C.D.; Langridge, P.; Zhang, X.Q.; Eckstein, P.E.; Rossnagel, B.G.; Lance, R.C.M.; Lefol, E.B.; Lu, M.Y.; Harvey, B.L.; Scoles, G.J. Mapping of Barley (Hordeum vulgare L.) Beta-amylase Alleles in which an Amino Acid Substitution Determines Beta -amylase Isoenzyme Type and the Level of Free Beta-amylase. J. Cereal Sci. 2002, 35, 39–50. [Google Scholar] [CrossRef] [Scilit]
- Dai, F.; Nevo, E.; Wu, D.; Comadran, J.; Zhou, M.; Qiu, L.; Chen, Z.; Beiles, A.; Chen, G.; Zhang, G. Tibet is one of the centers of domestication of cultivated barley. Proc. Natl. Acad. Sci. USA 2012, 109, 16969–16973. [Google Scholar] [CrossRef] [Scilit]
- Qiu, L.; Wu, D.; Ali, S.; Cai, S.; Dai, F.; Jin, X.; Wu, F.; Zhang, G. Evaluation of salinity tolerance and analysis of allelic function of HvHKT1 and HvHKT2 in Tibetan wild barley. TAG. Theor. Appl. Genetics. Theor. Und Angew. Genet. 2011, 122, 695–703. [Google Scholar] [CrossRef] [Scilit]
- Dai, H.; Shan, W.; Zhao, J.; Zhang, G.; Li, C.; Wu, F. Difference in response to aluminum stress among Tibetan wild barley genotypes. J. Plant Nutr. Soil Sci. 2011, 174, 952–960. [Google Scholar] [CrossRef] [Scilit]
- Wei, K.; Jin, X.; Chen, X.; Wu, F.; Zhou, W.; Qiu, B.; Qiu, L.; Wang, X.; Li, C.; Zhang, G. The effect of H2O2 and abscisic acid (ABA) interaction on beta-amylase activity under osmotic stress during grain development in barley. Plant Physiol. Biochem. 2009, 47, 778–784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCleary, B.V.; Codd, R. Measurement of β-amylase in cereal flours and commercial enzyme preparations. J. Cereal Sci. 1989, 9, 17–33. [Google Scholar] [CrossRef] [Scilit]
- Hayden, M.J.; Nguyen, T.M.; Waterman, A.; McMichael, G.L.; Chalmers, K.J. Application of multiplex-ready PCR for fluorescence-based SSR genotyping in barley and wheat. Mol. Breed. 2008, 21, 271–281. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.J.; Chen, X.; Zeng, F.R.; Zhang, G.P. The genotypic difference in the effect of water stress after anthesis on the malt quality parameters in barley. J. Cereal Sci. 2015, 65, 209–214. [Google Scholar] [CrossRef] [Scilit]
- Gong, X.; Westcott, S.; Zhang, X.Q.; Yan, G.; Lance, R.; Zhang, G.; Sun, D.; Li, C. Discovery of novel Bmy1 alleles increasing beta-amylase activity in Chinese landraces and Tibetan wild barley for improvement of malting quality via MAS. PLoS ONE 2013, 8, e7287. [Google Scholar] [CrossRef] [Scilit]
- Prasad, M.; Varshney, R.K.; Roy, J.K.; Balyan, H.S.; Gupta, P.K. The use of microsatellites for detecting DNA polymorphism, genotype identification and genetic diversity in wheat. TAG. Theor. Appl. Genet. Theor. Und Angew. Genet. 2000, 100, 584–592. [Google Scholar]
- Stein, N.; Graner, A. Map-Based Gene Isolation in Cereal Genomes. In Cereal Genomics; Gupta, P.K., Varshney, R.K., Eds.; Springer: Dordrecht, The Netherlands, 2005; pp. 331–360. [Google Scholar]
- Varshney, R.K.; Sigmund, R.; Börner, A.; Korzun, V.; Stein, N.; Sorrells, M.E.; Langridge, P.; Graner, A. Interspecific transferability and comparative mapping of barley EST-SSR markers in wheat, rye and rice. Plant Sci. 2005, 168, 195–202. [Google Scholar] [CrossRef] [Scilit]
- Koebner, R.M.; Summers, R.W. 21st century wheat breeding: Plot selection or plate detection? Trends Biotechnol. 2003, 21, 59–63. [Google Scholar] [CrossRef] [Scilit]
- Crepieux, S.; Lebreton, C.; Flament, P.; Charmet, G. Application of a new IBD-based QTL mapping method to common wheat breeding population: Analysis of kernel hardness and dough strength. TAG. Theor. Appl. Genet. Theor. Und Angew. Genet. 2005, 111, 1409–1419. [Google Scholar] [CrossRef] [Scilit]
- Erkkilä, M.J. Intron III-Specific Markers for Screening of β-amylase Alleles in Barley Cultivars. Plant Mol. Biol. Rep. 1999, 17, 139–147. [Google Scholar] [CrossRef] [Scilit]
- Chiapparino, E.; Donini, P.; Reeves, J.; Tuberosa, R.; O’Sullivan, D.M. Distribution of β-amylase I haplotypes among European cultivated barleys. Mol. Breed. 2006, 18, 341–354. [Google Scholar] [CrossRef] [Scilit]
- Filichkin, T.P.; Vinje, M.A.; Budde, A.D.; Corey, A.E.; Duke, S.H.; Gallagher, L.; Helgesson, J.; Henson, C.A.; Obert, D.E.; Ohm, J.B.; et al. Phenotypic Variation for Diastatic Power, β-Amylase Activity, and β-Amylase Thermostability vs. Allelic Variation at the Bmy1 Locus in a Sample of North American Barley Germplasm. Crop Sci. 2010, 50, 826–834. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.S.; Li, X.; Liu, J.B. Genetic variation of Bmy1 alleles in barley (Hordeum vulgare L.) investigated by CAPS analysis. TAG. Theor. Appl. Genet. Theor. Und Angew. Genet. 2007, 114, 1039–1050. [Google Scholar] [CrossRef] [Scilit]
- Clark, S.E.; Hayes, P.M.; Henson, C.A. Effects of single nucleotide polymorphisms in β-amylase1 alleles from barley on functional properties of the enzymes. Plant Physiol. Biochem. 2003, 41, 798–804. [Google Scholar] [CrossRef] [Scilit]



| HvSSR | Primer (5′ → 3′) Primer (5′ → 3′) | PCR Size | Allele Size |
|---|---|---|---|
| hv1006 | CAGACAFTTCACCCATAAGCT TGCTGCTGCTTTGAAGTCTGC | 458 | 437–458 |
| hv1010 | CCTCAAAATTTGCAGGTAGCAT TGGTGTGTAAACCATTGCCTTC | 304 | 209–304 |
| hv1013 | GATGAGCGCACCAGAAGAACT CCCTCTCTCCATCCAGCACTC | 266 | 222–266 |
| hv1014 | TTGTTGATTTGCAGGTGCCTA TCGATATTTCTGGCCCTGATC | 147 | 144–147 |
| hv1015 | CAATTGCTGAAAGGCATGAAA GCCACCCGAGCAATGAGATAC | 369 | 352–369 |
| hv1016 | ACCTTGACTACACTTCCATTGTTG CGAACCTGTTGTTCACGCTCA | 99 | 95–99 |
| hv1018 | TGTGGCTGTGACAGATGTATGC CATTTGGGTGTTTGTTTCCTGA | 470 | 344–470 |
| hv1019 | GAAGATCTGCCGTCCAGGTTA RGCTAGGTTTTGTTYCTTTGCT | 185 | 170–185 |
| hv1020 | GGGTGGCATCCAAATTTTCC TTGGCTCMMGGGAGAATATGCT | 272 | 244–278 |
| hv1021 | GGGTGGCATCCAAATTTTCC CACATCYAAATGCTACCTGCAA | 303 | 277–303 |
| hv1022 | TATGATTCATTGACCCCRCACG CCTTGCATCAAGGTTTGTGCTA | 272 | 244–278 |
| hv1023 | CAGACAGTTCACCCATAAGCT CCTTGCATCAAGGTTTGTGCTA | 130 | 109–130 |
| Intron III Allele | 126 bp | 38 bp | 11 bp | 21 bp | Cultivated Barley | NO. | Wild Barley | NO. |
|---|---|---|---|---|---|---|---|---|
| Bmy1.a | + | + | - | + | Q33, Q1, Q146, Q24, Q19, Q145, Q13, Q77, D24, D90, Q8, Q9, D31, Q222, D15, D27, D44, Q64, D72, D57, D65, D33, Q66, D68, D25, Q65, D28 | 27 | XZ171, XZ178, XZ172, XZ26, XZ50, XZ126, XZ103 | 7 |
| Bmy1.b | - | + | - | - | Q26, Q151, D69, Q16, D67, D84, D64, D71, Triumph, TL43 | 10 | XZ142, XZ80, XZ150, XZ144, XZ16, XZ34, XZ145, XZ166, XZ35, XZ117, XZ37, XZ40, XZ127, XZ51, XZ78, XZ11, XZ125, XZ118, XZ99, XZ124, XZ108, XZ102, XZ131, XZ130, XZ94, XZ147 | 26 |
| Bmy1.c | - | + | + | + | Q223, D41, Q73, Q18, Q138, Q11, Q17, Q23, Q224, Q143, D56, Q149, Q79, D40, D55, Q36, Q107, Q119, D76, D83, D73, Q80, D59, Q81, D6, D13, D39, D36, D78, D8, D87, D9, D22, D94, Q113, D10, Haruna Nijo | 36 | XZ140, XZ137, XZ134, XZ136, XZ73, XZ17, XZ36, XZ122, XZ114, XZ64, XZ176, XZ152, XZ165, XZ19, XZ161, XZ1, XZ25, XZ3, XZ5 | 19 |
| Allele Type | Genotypes | 343 | 495 | 698 | 1040 | 1289 | 1581 |
|---|---|---|---|---|---|---|---|
| R115C | D165E | V233A | L347S | V430A | M527I | ||
| Bmy1.b | Huruna Nijo | C(R) | G(E) | T(V) | C(S) | C(A) | T(M) |
| XZ147 | C(R) | C(D) | C(A) | C(S) | T(V) | T(M) | |
| Triumph | T(C) | C(D) | T(V) | T(L) | T(V) | A(I) |
| β-Amylase Activity | ||||
|---|---|---|---|---|
| Cultivated Barley | Wild Barley | |||
| Control | Drought | Control | Drought | |
| Average | 926.83 | 983.04 | 974.41 | 1410.73 |
| Maximum | 1513.57 | 1991.69 | 1472.34 | 2467.18 |
| Minimum | 465.81 | 394.42 | 705.63 | 975.86 |
| Max/Min | 3.25 | 5.05 | 2.09 | 2.53 |
| CV % | 31.09% | 40.26% | 34.97% | 37.07% |
| G | *** | *** | *** | *** |
| E | *** | *** | ||
| G × E | *** | |||
| β-Amylase Activity | ||||
|---|---|---|---|---|
| Cultivated Barley | Wild Barley | |||
| Control | Drought | Control | Drought | |
| Average | 1173.23 | 1548.07 | 356.17 | 1236.42 |
| Maximum | 2322.76 | 3091.99 | 699.97 | 2467.18 |
| Minimum | 534.94 | 709.65 | 131.47 | 590.87 |
| Max/Min | 4.34 | 4.36 | 5.32 | 4.18 |
| CV % | 49.7% | 42.41% | 25.29% | 27.86% |
| G | *** | *** | *** | *** |
| E | *** | *** | ||
| G × E | *** | |||
| β-Amylase Activity | ||||
|---|---|---|---|---|
| Cultivated Barley | Wild Barley | |||
| Control | Drought | Control | Drought | |
| Average | 892.12 | 908.57 | 356.17 | 1236.42 |
| Maximum | 1904.21 | 1472.34 | 699.97 | 2467.18 |
| Minimum | 111.86 | 404.47 | 131.47 | 590.87 |
| Max/Min | 17.02 | 3.64 | 5.32 | 4.18 |
| CV % | 32.27% | 29.73% | 42.46% | 50.18% |
| G | *** | *** | *** | *** |
| E | *** | *** | ||
| G × E | *** | |||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, X.; Yue, W.; Cai, K.; Wang, H.; Zeng, F.; Wang, J. Single-Nucleotide Polymorphisms in Bmy1 Intron III Alleles Conferring the Genotypic Variations in β-Amylase Activity under Drought Stress between Tibetan Wild and Cultivated Barley. Agronomy 2022, 12, 1737. https://doi.org/10.3390/agronomy12081737
Wu X, Yue W, Cai K, Wang H, Zeng F, Wang J. Single-Nucleotide Polymorphisms in Bmy1 Intron III Alleles Conferring the Genotypic Variations in β-Amylase Activity under Drought Stress between Tibetan Wild and Cultivated Barley. Agronomy. 2022; 12(8):1737. https://doi.org/10.3390/agronomy12081737
Chicago/Turabian StyleWu, Xiaojian, Wenhao Yue, Kangfeng Cai, Huan Wang, Fanrong Zeng, and Junmei Wang. 2022. "Single-Nucleotide Polymorphisms in Bmy1 Intron III Alleles Conferring the Genotypic Variations in β-Amylase Activity under Drought Stress between Tibetan Wild and Cultivated Barley" Agronomy 12, no. 8: 1737. https://doi.org/10.3390/agronomy12081737
APA StyleWu, X., Yue, W., Cai, K., Wang, H., Zeng, F., & Wang, J. (2022). Single-Nucleotide Polymorphisms in Bmy1 Intron III Alleles Conferring the Genotypic Variations in β-Amylase Activity under Drought Stress between Tibetan Wild and Cultivated Barley. Agronomy, 12(8), 1737. https://doi.org/10.3390/agronomy12081737

