Effect of Biochar Application to Fertile Soil on Tomato Crop Production under Saline Irrigation Regime
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Layout and Plant Materials
2.2. Plant Measurements
2.2.1. Plant Growth Parameters
2.2.2. Total Soluble Solids (TSS)
2.2.3. Na+ and K+ Content in Fruits and Stem-Borne Lateral Roots
2.2.4. Stem-Borne Lateral Root Length
2.2.5. Quantitative Gene Expression of Salt Stress-Related Genes
Total RNA and cDNA Synthesis
Real-Time PCR Assay
2.3. Soil Analysis and Biochar Addition
2.4. Statistical Analysis
3. Results
3.1. Analysis of Variance
3.2. Biochar-Enhanced Number of Leaves, Number of Flowers, and Fruit Diameter under Salinity Stress
3.3. Biochar Did Not Alter Sodium and Potassium Ions Content in Roots or Fruits
3.4. Biochar Addition Enhances Stem-Borne Lateral Root Length
3.5. The Expression of Gene LeNR Was Altered after Biochar Addition under Fresh Water Irrigation
3.6. Soil Properties
4. Discussion
4.1. Tomato Plant Response to Saline Irrigation Water in “No BC” Soil
4.2. Biochar Addition Did Not Alleviate Tomato Fruit Yield Reduction under Salinity Stress
4.3. Effect of Saline Water and Biochar on Soil Properties
4.4. Practical Implications of This Study
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Manisankar, G. Potential Impact of Biochar in Agriculture: A Review Potential Impact of Biochar in Agriculture: A Review. Int. J. Agric. Sci. 2022, 13, 466–475. [Google Scholar]
- Alkharabsheh, H.M.; Seleiman, M.F.; Battaglia, M.L.; Shami, A.; Jalal, R.S.; Alhammad, B.A.; Almutairi, K.F.; Al–Saif, A.M. Biochar and Its Broad Impacts in Soil Quality and Fertility, Nutrient Leaching and Crop Productivity: A Review. Agronomy 2021, 11, 993. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Yang, L.; Hu, Z.; Xue, J.; Lu, Y.; Chen, X.; Griffiths, B.S.; Whalen, J.K.; Liu, M. Biochar exerts negative effects on soil fauna across multiple trophic levels in a cultivated acidic soil. Biol. Fertil. Soils 2020, 56, 597–606. [Google Scholar] [CrossRef] [Scilit]
- Kumar Yadav, N.; Vijay Kumar, I.; Kumar, V.; Sharma, K.; Singh Choudhary, R.; Singh Butter, T.; Singh, G.; Kumar, M.; Kumar, R. Biochar and Their Impacts on Soil Properties and Crop Productivity: A Review. J. Pharmacogn. Phytochem. 2018, 7, 49–54. [Google Scholar]
- Qiu, M.; Liu, L.; Ling, Q.; Cai, Y.; Yu, S.; Wang, S.; Fu, D.; Hu, B.; Wang, X. Biochar for the Removal of Contaminants from Soil and Water: A Review. Biochar 2022, 4, 19. [Google Scholar] [CrossRef] [Scilit]
- Ali, I.; Yuan, P.; Ullah, S.; Iqbal, A.; Zhao, Q.; Liang, H.; Khan, A.; Imran; Zhang, H.; Wu, X.; et al. Biochar Amendment and Nitrogen Fertilizer Contribute to the Changes in Soil Properties and Microbial Communities in a Paddy Field. Front. Microbiol. 2022, 13, 834751. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Wang, H.; Tang, X.; Guan, Z.; Reid, B.J.; Rajapaksha, A.U.; Ok, Y.S.; Sun, H. Biochar increased water holding capacity but accelerated organic carbon leaching from a sloping farmland soil in China. Environ. Sci. Pollut. Res. 2016, 23, 995–1006. [Google Scholar] [CrossRef] [Scilit]
- Graber, E.R.; Harel, Y.M.; Kolton, M.; Cytryn, E.; Silber, A.; David, D.R.; Tsechansky, L.; Borenshtein, M.; Elad, Y. Biochar impact on development and productivity of pepper and tomato grown in fertigated soilless media. Plant Soil 2010, 337, 481–496. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, E.A.; El-Sherbini, M.A.; Selim, E.-M.M. Effects of biochar on soil properties, heavy metal availability and uptake, and growth of summer squash grown in metal-contaminated soil. Sci. Hortic. 2022, 301, 111097. [Google Scholar] [CrossRef] [Scilit]
- El-Naggar, A.; Lee, S.S.; Rinklebe, J.; Farooq, M.; Song, H.; Sarmah, A.K.; Zimmerman, A.R.; Ahmad, M.; Shaheen, S.M.; Ok, Y.S. Biochar application to low fertility soils: A review of current status, and future prospects. Geoderma 2019, 337, 536–554. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.A.; Basir, A.; Fahad, S.; Adnan, M.; Saleem, M.H.; Iqbal, A.; Amanullah; Al-Huqail, A.A.; Alosaimi, A.A.; Saud, S.; et al. Biochar Optimizes Wheat Quality, Yield, and Nitrogen Acquisition in Low Fertile Calcareous Soil Treated with Organic and Mineral Nitrogen Fertilizers. Front. Plant Sci. 2022, 13, 879788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verheijen, F.; Jeffery, S.; Bastos, A.C.; Van Der Velde, M.; Diafas, I. Biochar Application to Soils: A Critical Scientific Review of Effects on Soil Properties, Processes and Functions; Office for the Official Publications of the European Communities: Luxembourg, 2010; Volume 8. [Google Scholar] [CrossRef]
- George, M. Unravelling the Impact of Potentially Toxic Elements and Biochar on Soil: A Review. Environ. Chall. 2022, 8, 100540. [Google Scholar] [CrossRef] [Scilit]
- Al-Wabel, M.I.; Hussain, Q.; Usman, A.R.; Ahmad, M.; Abduljabbar, A.; Sallam, A.S.; Ok, Y.S. Impact of biochar properties on soil conditions and agricultural sustainability: A review. Land Degrad. Dev. 2017, 29, 2124–2161. [Google Scholar] [CrossRef] [Scilit]
- Hussain, M.; Farooq, M.; Nawaz, A.; Al-Sadi, A.; Solaiman, Z.M.; Alghamdi, S.S.; Ammara, U.; Ok, Y.S.; Siddique, K. Biochar for crop production: Potential benefits and risks. J. Soils Sediments 2017, 17, 685–716. [Google Scholar] [CrossRef] [Scilit]
- Yin, D.; Yang, X.; Wang, H.; Guo, X.; Wang, S.; Wang, Z.; Ding, G.; Yang, G.; Zhang, J.; Jin, L.; et al. Effects of chemical-based fertilizer replacement with biochar-based fertilizer on albic soil nutrient content and maize yield. Open Life Sci. 2022, 17, 517–528. [Google Scholar] [CrossRef] [Scilit]
- Yaashikaa, P.; Kumar, P.S.; Varjani, S.; Saravanan, A. A critical review on the biochar production techniques, characterization, stability and applications for circular bioeconomy. Biotechnol. Rep. 2020, 28, e00570. [Google Scholar] [CrossRef] [Scilit]
- Gulyás, M.; Someus, E.; Klátyik, S.; Fuchs, M.; Varga, Z.I.; Dér, S.; Fekete, G.; Czinkota, I.; Székács, A.; Gyuricza, C.; et al. Effects of Combined Application of Solid Pyrolysis Products and Digestate on Selected Soil Properties of Arenosol and Plant Growth and Composition in Laboratory Experiments. Agronomy 2022, 12, 1440. [Google Scholar] [CrossRef] [Scilit]
- Marmiroli, M.; Caldara, M.; Pantalone, S.; Malcevschi, A.; Maestri, E.; Keller, A.A.; Marmiroli, N. Building a risk matrix for the safety assessment of wood derived biochars. Sci. Total Environ. 2022, 839, 156–265. [Google Scholar] [CrossRef] [Scilit]
- Gorovtsov, A.V.; Minkina, T.M.; Mandzhieva, S.S.; Perelomov, L.V.; Soja, G.; Zamulina, I.V.; Rajput, V.D.; Sushkova, S.N.; Mohan, D.; Yao, J. The mechanisms of biochar interactions with microorganisms in soil. Environ. Geochem. Health 2022, 42, 2495–2518. [Google Scholar] [CrossRef] [Scilit]
- Brtnicky, M.; Datta, R.; Holatko, J.; Bielska, L.; Gusiatin, Z.M.; Kucerik, J.; Hammerschmiedt, T.; Danish, S.; Radziemska, M.; Mravcova, L.; et al. A critical review of the possible adverse effects of biochar in the soil environment. Sci. Total Environ. 2021, 796, 148756. [Google Scholar] [CrossRef] [Scilit]
- Smider, B.; Singh, B. Agronomic performance of a high ash biochar in two contrasting soils. Agric. Ecosyst. Environ. 2014, 191, 99–107. [Google Scholar] [CrossRef] [Scilit]
- Xia, H.; Riaz, M.; Zhang, M.; Liu, B.; El-Desouki, Z.; Jiang, C. Biochar increases nitrogen use efficiency of maize by relieving aluminum toxicity and improving soil quality in acidic soil. Ecotoxicol. Environ. Saf. 2020, 196, 110531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Riemann, M.; Dhakarey, R.; Hazman, M.; Miro, B.; Kohli, A.; Nick, P. Exploring Jasmonates in the Hormonal Network of Drought and Salinity Responses. Front. Plant Sci. 2015, 6, 1077. [Google Scholar] [CrossRef] [Scilit]
- Teh, K.; Ro, S.; Ray, P. Mapping Water Salinity in Coastal Areas Affected by Rising Sea Level. In Technology Entrepreneurship and Sustainable Development, Disaster Risk Reduction; Ray, P., Shaw, R., Eds.; Springer Nature Pte Ltd.: Singapore, 2022. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, A.A.; Eichler-Löbermann, B.; Schnug, E. Response of Crops to Salinity under Egyptian Conditions: A Review. Landbauforsch. Volkenrode 2007, 57, 119–125. [Google Scholar]
- Mohamed, E.S.; Morgun, E.G.; Goma Bothina, S.M. Assessment of Soil Salinity in the Eastern Nile Delta (Egypt) Using Geoinformation Techniques. Moscow Univ. Soil Sci. Bull. 2011, 66, 11–14. [Google Scholar] [CrossRef] [Scilit]
- Abdel-mawgoud, A.S.A. Water Quality Appraisal for Soil-Water Behavior in Irrigated Clay Soil, Egypt. In Proceedings of the Ninth International Water Technology Conference, IWTC9 2005, Sharm El-Sheikh, Egypt, 17–20 March 2005; pp. 1245–1256. [Google Scholar]
- Kubota, A.; Zayed, B.; Fujimaki, H.; Higashi, T.; Yoshida, S.; Mahmoud, M.M.A.; Kitamura, Y.; Abou El Hassan, W.H. Water and Salt Movement in Soils of the Nile Delta. Irrigated Agriculture in Egypt, 1st ed.; Satoh, M., Aboulroos, S., Eds.; Springer: Cham, Switzerland, 2017; pp. 153–186. [Google Scholar]
- Perez, N.; Kassim, Y.; Ringler, C.; Thomas, T.S.; Eldidi, H. Climate Change and Egypt’s Agriculture; MENA Policy Note 17; International Food Policy Research Institute (IFPRI): Washington, DC, USA, 2021; Volume 18, pp. 1–6. [Google Scholar] [CrossRef] [Scilit]
- Siam, G.; Abdelhakim, T. Analysis of the Tomato Value Chain in Egypt and Establishment of an Action Plan to Increase Its Efficiency. Ph.D. Thesis, CIHEAM-IAMM, Montpellier, France, 2018; p. 118. [Google Scholar]
- El-Khalifa, Z.S.; Ayoub, A.; Zahran, H.F. Estimating the Efficiency of Summer Tomatoes Production: A Case Study in Borg El-Arab Area, Egypt. Open J. Appl. Sci. 2022, 12, 855–864. [Google Scholar] [CrossRef]
- FAO. FAOSTAT. Available online: http://www.fao.org/faostat/en/ (accessed on 17 June 2022).
- Anwar, R.; Fatima, T.; Mattoo, A. Tomatoes: A Model Crop of Solanaceous Plants. Oxford Research Encyclopedia of Environmental Science. Retrieved 24 June 2022. Available online: https://oxfordre.com/environmentalscience/view/10.1093/acrefore/9780199389414.001.0001/acrefore-9780199389414-e-223 (accessed on 24 June 2022).
- Schwarz, D.; Thompson, A.J.; Kläring, H.P. Guidelines to Use Tomato in Experiments with a Controlled Environment. Front. Plant Sci. 2014, 5, 625. [Google Scholar] [CrossRef] [Scilit]
- Lebrun, M.; Miard, F.; Nandillon, R.; Morabito, D.; Bourgerie, S. Biochar Application Rate: Improving Soil Fertility and Linum Usitatissimum Growth on an Arsenic and Lead Contaminated Technosol. Int. J. Environ. Res. 2021, 15, 125–134. [Google Scholar] [CrossRef] [Scilit]
- El-sayed, M.E.A.; Hazman, M.; Abd El-Rady, A.G.; Almas, L.; McFarland, M.; Shams El Din, A.; Burian, S. Biochar Reduces the Adverse Effect of Saline Water on Soil Properties and Wheat Production Profitability. Agriculture 2021, 11, 1112. [Google Scholar] [CrossRef] [Scilit]
- She, D.; Sun, X.; Gamareldawla, A.H.D.; Nazar, E.A.; Hu, W.; Edith, K.; Yu, S. Benefits of Soil Biochar Amendments to Tomato Growth under Saline Water Irrigation. Sci. Rep. 2018, 8, 14743. [Google Scholar] [CrossRef] [Scilit]
- Shaddad, S.M. Geostatistics and Proximal Soil Sensing for Sustainable Agriculture. In Sustainability of Agricultural Environment in Egypt: Part I. The Handbook of Environmental Chemistry; Negm, A.M., Abu-hashim, M., Eds.; Springer: Cairo, Egypt, 2007; p. 76. [Google Scholar] [CrossRef] [Scilit]
- Maynard, D.N.; Hochmuth, G.J. Knott’s Handbook for Vegetable Growers, 5th ed.; John Wiley and Sons, Inc.: New York, NY, USA, 2007. [Google Scholar]
- Rab, A.; Haq, I.U. Foliar application of calcium chloride and borax influences plant growth, yield, and quality of tomato (Lycopersicon esculentum Mill.) fruit. Turk. J. Agric. For. 2012, 36, 695–701. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT–PCR. Nucleic Acids Res. 2001, 29, E45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soliman, G.M.M.; El-Sayed, M.E.A. Effect of Compost and Gypsum Application on Yield and Its Attributes of Three Bread Wheat Cultivars as Well as Soil Properties under Two Irrigation Levels. Assiut J. Agric. Sci. 2020, 50, 102–119. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; El-Sayed, M.E.A.; Abdelhafeez, I.A. The Influence of Groundwater Desalination by Modified Active Carbon/Bentonite on Its Application in Agriculture. Sustainability 2021, 13, 3173. [Google Scholar] [CrossRef] [Scilit]
- Hazman, M.; Hause, B.; Eiche, E.; Riemann, M.; Nick, P. Different Forms of Osmotic Stress Evoke Qualitatively Different Responses in Rice. J. Plant Physiol. 2016, 202, 45–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parvin, K.; Ahamed, K.U.; Islam, M.M.; Haque, M.N. Response of Tomato Plant under Salt Stress: Role of Exogenous Calcium. J. Plant Sci. 2015, 10, 222–233. [Google Scholar] [CrossRef] [Scilit]
- Ullah, N.; Basit, A.; Ahmad, I.; Ullah, I.; Shah, S.T.; Mohamed, H.I.; Javed, S. Mitigation the Adverse Effect of Salinity Stress on the Performance of the Tomato Crop by Exogenous Application of Chitosan. Bull. Natl. Res. Cent. 2020, 44, 181. [Google Scholar] [CrossRef] [Scilit]
- Shavrukov, Y.; Kurishbayev, A.; Jatayev, S.; Shvidchenko, V.; Zotova, L.; Koekemoer, F.; De Groot, S.; Soole, K.; Langridge, P. Early Flowering as a Drought Escape Mechanism in Plants: How Can It Aid Wheat Production? Front. Plant Sci. 2017, 8, 1950. [Google Scholar] [CrossRef] [Scilit]
- Takeno, K. Stress-Induced Flowering: The Third Category of Flowering Response. J. Exp. Bot. 2016, 67, 4925–4934. [Google Scholar] [CrossRef] [Scilit]
- Del Amor, F.M.; Martinez, V.; Cerdá, A. Salt Tolerance of Tomato Plants as Affected by Stage of Plant Development. HortScience 2001, 36, 1260–1263. [Google Scholar] [CrossRef] [Scilit]
- Dasgan, H.Y.; Aktas, H.; Abak, K.; Cakmak, I. Determination of Screening Techniques to Salinity Tolerance in Tomatoes and Investigation of Genotype Responses. Plant Sci. 2002, 163, 695–703. [Google Scholar] [CrossRef] [Scilit]
- Ali, H.E.M.; Ismail, G.S.M. Tomato Fruit Quality as Influenced by Salinity and Nitric Oxide. Turk. J. Bot. 2014, 38, 122–129. [Google Scholar] [CrossRef] [Scilit]
- Bigot, S.; Pongrac, P.; Šala, M.; Van Elteren, J.T.; Mart, J.; Lutts, S.; Quinet, M. The Halophyte Species Solanum chilense Dun. Maintains Its Reproduction despite Sodium Accumulation in Its Floral Organs. Plants 2022, 11, 672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sirivastava, S.; Kulshreshtha, K. Nutritional Content and Significance of Tomato Powder. Ann. Arid Zone 2013, 52, 121–124. [Google Scholar]
- Hazman, M.Y.; Kabil, F.F. Maize Root Responses to Drought Stress Depend on Root Class and Axial Position. J. Plant Res. 2022, 135, 105–120. [Google Scholar] [CrossRef] [Scilit]
- Koch, L. The root cause of shoot-borne roots. Nat. Rev. Genet. 2022, 23, 264. [Google Scholar] [CrossRef] [Scilit]
- Gandullo, J.; Ahmad, S.; Darwish, E.; Karlova, R.; Testerink, C. Phenotyping Tomato Root Developmental Plasticity in Response to Salinity in Soil Rhizotrons. Plant Phenomics 2021, 2021, 2760532. [Google Scholar] [CrossRef] [Scilit]
- Bonarota, M.S.; Program, G. Combatting Salinity: Evaluation of Tomato Rootstocks under Mild and Severe Salt Stress. Reno FS-21-08 2020, 1–8. [Google Scholar]
- Gharsallah, C.; Fakhfakh, H.; Grubb, D.; Gorsane, F. Effect of Salt Stress on Ion Concentration, Proline Content, Antioxidant Enzyme Activities and Gene Expression in Tomato Cultivars. AoB Plants 2016, 8, plw055. [Google Scholar] [CrossRef] [Scilit]
- Yao, J.; Shi, W.M.; Xu, W.F. Effects of salt stress on expression of nitrate transporter and assimilation-related genes in tomato roots. Russ. J. Plant Physiol. 2008, 55, 232–240. [Google Scholar] [CrossRef]
- Blanco-Canqui, H. Biochar and Soil Physical Properties. Soil Sci. Soc. Am. J. 2017, 81, 687–711. [Google Scholar] [CrossRef] [Scilit]
- Jun, Z.; Qun, C.; Changfu, Y. Biochar Effect on Water Evaporation and Hydraulic Conductivity in Sandy Soil. Pedosph. Int. J. 2016, 26, 265–272. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.; Yuan, G.; Feng, L.; Mustafa Shah, M.; Wei, J. Biochar to Reduce Fertilizer Use and Soil Salinity for Crop Production in the Yellow River Delta. J. Soil Sci. Plant Nutr. 2022, 22, 1478–1489. [Google Scholar] [CrossRef] [Scilit]
- Kul, R.; Arjumend, T.; Ek, M.; Yildirim, E.; Turan, M.; Argin, S. Role of Biochar in Mitigating Salinity Stress in Tomato. Soil Sci. Plant Nutr. 2020, 11, 59–65. [Google Scholar]
- Castellini, M.; Giglio, L.; Niedda, M.; Palumbo, A.D.; Ventrella, D. Impact of Biochar Addition on the Physical and Hydraulic Properties of a Clay Soil. Soil Tillage Res. 2015, 154, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Vaccari, F.P.; Maienza, A.; Miglietta, F.; Baronti, S.; Di Lonardo, S.; Giagnoni, L.; Lagomarsino, A.; Pozzi, A.; Pusceddu, E.; Ranieri, R.; et al. Biochar stimulates plant growth but not fruit yield of processing tomato in a fertile soil. Agric. Ecosyst. Environ. 2015, 207, 163–170. [Google Scholar] [CrossRef] [Scilit]
- Sg, L.; Jjo, O.; Adeleke, R.; St, M. The Potential of Biochar to Enhance Concentration and Utilization of Selected Macro and Micro Nutrients for Chickpea (Cicer arietinum) Grown in Three Contrasting Soils. Rhizosphere 2020, 17, 100289. [Google Scholar] [CrossRef] [Scilit]
- Gaskin, J.W.; Speir, R.A.; Harris, K.; Das, K.C.; Lee, R.D.; Morris, L.A.; Fisher, D.S. Effect of Peanut Hull and Pine Chip Biochar on Soil Nutrients, Corn Nutrient Status, and Yield. Agron. J. 2010, 102, 623–633. [Google Scholar] [CrossRef] [Scilit]
- Deenik, J.L.; McClellan, T.; Uehara, G.; Antal, M.J.; Campbell, S.; Antal, M.J., Jr.; Sonia, C. Charcoal Volatile Matter Content Influences Plant Growth and Soil Nitrogen Transformations. Soil Sci. Soc. Am. J. 2010, 74, 1259–1270. [Google Scholar] [CrossRef] [Scilit]
- Van Zwieten, L.; Kimber, S.; Morris, S.; Chan, K.Y.; Downie, A.; Rust, J.; Joseph, S.; Cowie, A. Effects of biochar from slow pyrolysis of papermill waste on agronomic performance and soil fertility. Plant Soil 2010, 327, 235–246. [Google Scholar] [CrossRef] [Scilit]
- Xu, G.; Zhang, Y.; Sun, J.; Shao, H. Negative interactive effects between biochar and phosphorus fertilization on phosphorus availability and plant yield in saline sodic soil. Sci. Total Environ. 2016, 568, 910–915. [Google Scholar] [CrossRef] [Scilit]
- Tejada, M.; Garcia, C.; Gonzalez, J.L.; Hernandez, M.T. Use of organic amendment as a strategy for saline soil remediation: Influence on the physical, chemical and biological properties of soil. Soil Biol. Biochem. 2006, 38, 1413–1421. [Google Scholar] [CrossRef] [Scilit]
- Brown, J.W.; Hayward, H.E.; Richards, A.; Bernstein, L.; Hatcher, J.T.; Reeve, R.C.; Richards, L.A. Diagnosis and Improvement of Saline and Alkaline Soil; Agriculture Handbook No. 60; United States Government Publishing Office: Washington, DC, USA, 1954.
- Lim, T.; Spokas, K.; Feyereisen, G.; Novak, J. Predicting the impact of biochar additions on soil hydraulic properties. Chemosphere 2016, 142, 136–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, Y.; Ma, J.; Wei, H.; Xiao, F.; Wang, Y.; Jahan, N.; Hazman, M.; Qian, Q.; Shang, L.; Guo, L. Combining GWAS, Genome-Wide Domestication and a Transcriptomic Analysis Reveals the Loci and Natural Alleles of Salt Tolerance in Rice (Oryza sativa L.). Front. Plant Sci. 2022, 3, 912637. [Google Scholar] [CrossRef] [Scilit]





| Gene Name | Forward Primer 5′ to 3′ | Reverse Primer 5′ to 3′ |
|---|---|---|
| LeNHX4 | TGGTGGGCAGGTTTGATGAGAG | TGTGGTGGCAGCAGGAGACTTA |
| LeNR | GGTTCATCACTCCCGTACCACTT | TCTGCTTCACCATATTCTGCTCT |
| LeEF1 | TTGCTTGCTTTCACCCTTGG | TTGGCACCAGTTGGGTCCTT |
| Ph. | Br. | Leaves | Inflo. | Flowers | Yield | Fruit dm | TSS | Na+ Root | K+ Root | Na+/K+ Root | Na+ Fruit | K+ Fruit | Na+/K+ Fruit | Root Length | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| season | 0.314 | 0.729 | 0.849 | 0.033 | 1.435 | 0.48 | 0.95 | 0.817 | 0.213 | 3.53 | 0.16 | 4.5 | 1.62 | 2 | 2.3 |
| saline (no BC) | 0.104 | 11.146 ** | 29.79 ** | 7.03 * | 5.229 * | 297.192 ** | 49.85 ** | 7.3 * | 228.09 ** | 10.42 * | 68.174 ** | 32 ** | 4.91 | 18 ** | 18.84 ** |
| season x saline (no BC) | 0.594 | 0.054 | 0.045 | 0.075 | 0.12 | 0.405 | 3.87 | 0.084 | 5.88* | 6.28* | 5.64* | 2 | 1.26 | 0 | 2.86 |
| season | 0.033 | 0.568 | 0.008 | 3.648 | 1.435 | 0 | 0.002 | 0.1 | 0.505 | 1.259 | 2.722 | 0.333 | 11.28 * | 0.33 | 3.347 |
| saline (with BC) | 0.11 | 0.104 | 0.008 | 1.861 | 5.229 * | 4.85 | 0.347 | 4.04 | 67.39 ** | 0.026 | 25.817 ** | 6.259 * | 1.116 | 8.33 * | 8.293 * |
| season x saline (with BC) | 0.761 | 0.29 | 2.229 | 1.508 | 0.012 | 0.4 | 0.574 | 0.13 | 3.98 | 1.117 | 0.004 | 0.037 | 11.38* | 0.33 | 5.441* |
| season | 0.152 | 0.172 | 0 | 2.875 | 0.715 | 0.371 | 0.821 | 0.321 | 11.19 * | 1.75 | 15.45 ** | 2 | 1.199 | 0.33 | 2.447 |
| biochar (fresh) | 1.952 | 11.59 ** | 5.78 * | 0.059 | 44.12 ** | 7.2 * | 5.67 * | 2.5 | 0.445 | 7.08 * | 3.99 | 0.22 | 0.607 | 0.33 | 6.77 * |
| season x biochar (fresh) | 0.007 | 0.062 | 1.143 | 1.188 | 0.13 | 0.009 | 0.021 | 0.33 | 3 | 1.47 | 3 | 0.889 | 1.182 | 0.33 | 6.56 * |
| season | 1.18 | 1.57 | 1.87 | 0.038 | 0.281 | 0.303 | 3.11 | 0.289 | 1.79 | 1.251 | 0.174 | 2 | 4.1 | 0 | 0.623 |
| biochar (saline) | 0.223 | 0.233 | 15.28 ** | 2.751 | 10.125 ** | 5.87 | 25.75 ** | 66.51 ** | 1.708 | 0.117 | 0.616 | 0.22 | 2.05 | 0 | 15.1 |
| season x biochar (saline) | 0.287 | 0.009 | 0.153 | 0.086 | 1.125 | 0.352 | 0.99 | 0.093 | 0 | 1.846 | 1.55 | 0.889 | 0.001 | 0 | 0.958 |
| pH (1:2.5) | % OM | ds·m−1 EC | meq·L-1 | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Samples | Ca2+ | Mg2+ | Na+ | K+ | HCO3− | Cl− | SO42− | ||||
| Season 2019/2020 | Control | 7.80 | 0.36 | 1.80 | 3.80 | 3.20 | 10.30 | 0.60 | 4.2 | 9.7 | 3.1 |
| Fresh | 7.82 | 0.79 | 1.87 | 3.85 | 3.25 | 10.62 | 0.71 | 4.21 | 9.80 | 3.25 | |
| Saline | 7.91 | 0.78 | 2.17 | 4.00 | 3.30 | 13.35 | 0.85 | 4.90 | 12.75 | 4.00 | |
| F test 0.05 | NS | NS | ** | * | * | ** | * | ** | ** | ** | |
| No BC | 7.85 | 0.35 | 2.08 | 3.95 | 3.31 | 12.55 | 0.80 | 4.80 | 11.85 | 3.70 | |
| BC | 7.88 | 1.22 | 1.95 | 3.91 | 3.22 | 11.42 | 0.76 | 4.31 | 10.70 | 3.55 | |
| F test 0.05 | NS | ** | * | NS | * | ** | NS | ** | * | * | |
| WN B0 | 7.80 | 0.36 | 1.86 | 3.80 | 3.30 | 10.60 | 0.70 | 4.20 | 9.80 | 3.20 | |
| WN B1 | 7.85 | 1.22 | 1.88 | 3.90 | 3.20 | 10.64 | 0.72 | 4.22 | 9.80 | 3.30 | |
| WS B0 | 7.90 | 0.34 | 2.30 | 4.10 | 3.32 | 14.50 | 0.90 | 5.40 | 13.90 | 4.20 | |
| WS B1 | 7.92 | 1.23 | 2.05 | 3.92 | 3.25 | 12.20 | 0.80 | 4.40 | 11.60 | 3.80 | |
| F test 0.05 | NS | * | ** | * | NS | ** | NS | ** | * | * | |
| Season 2020/2021 | Fresh | 7.85 | 0.9 | 1.95 | 3.94 | 3.27 | 11.57 | 0.77 | 4.55 | 10.35 | 3.75 |
| Saline | 8.00 | 0.89 | 2.35 | 4.20 | 3.55 | 14.35 | 1.00 | 5.20 | 13.75 | 4.00 | |
| F test 0.05 | NS | * | ** | ** | * | ** | ** | ** | ** | * | |
| No BC | 7.95 | 0.43 | 2.20 | 4.16 | 3.52 | 13.25 | 0.92 | 4.90 | 12.50 | 3.90 | |
| BC | 7.92 | 1.35 | 2.10 | 3.98 | 3.30 | 12.65 | 0.85 | 4.85 | 11.60 | 3.85 | |
| F test 0.05 | NS | ** | * | * | * | ** | * | NS | * | * | |
| WN B0 | 7.80 | 0.45 | 1.90 | 3.92 | 3.25 | 11.35 | 0.75 | 4.50 | 10.30 | 3.70 | |
| WN B1 | 7.90 | 1.35 | 2.01 | 3.96 | 3.30 | 11.80 | 0.80 | 4.60 | 10.40 | 3.80 | |
| WS B0 | 8.10 | 0.42 | 2.50 | 4.40 | 3.80 | 15.20 | 1.10 | 5.30 | 14.70 | 4.10 | |
| WS B1 | 7.95 | 1.36 | 2.20 | 4.00 | 3.30 | 13.50 | 0.90 | 5.10 | 12.80 | 3.90 | |
| F test 0.05 | NS | * | ** | * | NS | ** | * | ** | * | * | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hazman, M.Y.; El-Sayed, M.E.A.; Kabil, F.F.; Helmy, N.A.; Almas, L.; McFarland, M.; Shams El Din, A.; Burian, S. Effect of Biochar Application to Fertile Soil on Tomato Crop Production under Saline Irrigation Regime. Agronomy 2022, 12, 1596. https://doi.org/10.3390/agronomy12071596
Hazman MY, El-Sayed MEA, Kabil FF, Helmy NA, Almas L, McFarland M, Shams El Din A, Burian S. Effect of Biochar Application to Fertile Soil on Tomato Crop Production under Saline Irrigation Regime. Agronomy. 2022; 12(7):1596. https://doi.org/10.3390/agronomy12071596
Chicago/Turabian StyleHazman, Mohamed Y., Mohamed E. A. El-Sayed, Farida F. Kabil, Nourhan A. Helmy, Lal Almas, Mike McFarland, Ali Shams El Din, and Steven Burian. 2022. "Effect of Biochar Application to Fertile Soil on Tomato Crop Production under Saline Irrigation Regime" Agronomy 12, no. 7: 1596. https://doi.org/10.3390/agronomy12071596
APA StyleHazman, M. Y., El-Sayed, M. E. A., Kabil, F. F., Helmy, N. A., Almas, L., McFarland, M., Shams El Din, A., & Burian, S. (2022). Effect of Biochar Application to Fertile Soil on Tomato Crop Production under Saline Irrigation Regime. Agronomy, 12(7), 1596. https://doi.org/10.3390/agronomy12071596

