Evaluation of Raw Cheese as a Novel Source of Biofertilizer with a High Level of Biosecurity for Blueberry

Round 1

Reviewer 1 Report

Reviewer #01 (Report 01)

This research study the Nunes et al., on the article research (Agronomy-1700411) entitled “Evaluation of raw cheese as a novel source of new biofertilizers 2 to blueberry with high biosecurity level”. The present work is valuable and informative new biofertilizers based on isolated raw cheeses and selected by MALDI-TOF-MS. Values information by phylogenetic, antimicrobial analysis, plant growth promotion-regulation in blueberry plants, colonization mechanisms putative and microcopy imagens reveals consistent research in present form. The introduction is ok, but M&M, results and discussion still need to improve some points. This article demonstrated relevant results and discussion, table and figures showed a good presentation, in my opinion. But the minor correction in legends and material and methods description its necessary. Also, some phrases its necessary to rephrase for make them clearance.

#01. Have all 88 putative PGPR been evaluated with MALDI-TOF, culture colony, and microscopy? Isolated but also tested in blueberry? This was not very clear in the course of the work.

#02. What is limited by raw milk application to soil, environment and other cultures?

#03. Were growth analyses performed on blueberry plants (production and productivity) or just colonization aspects even in roots?

#04. what is the influence of soil pH, and the availability of PGPR for macro-micro nutrients? Would this association be beneficial on a large scale?

#05. What are the main limitations for large-scale cultivation, production and application in agriculture and other cultivated plants?

Minor point

#06. All standardization of nomenclature equipment/reagents when necessary (i.e., Bruker Daltonics, Germany; Mattson, Madison, WI, USA). Example: Fabricant, State, Country (three-letter).

L36 - indigenous populations (native population of bacteria)?

L52 - “What is importance? “Between the 88 most studied microorganisms, Serratia or Pantoea stand out”?

L58 - “t” ?

Topic 2.2 MALDI-TOF, how many samples were analyzed?

L205 - L. plantarum (italic)

L207-MALDI-TOF-MS (table legend)

L227 and 231 – ssp. (dot)

L255 and 286 – Figure 2

L316 – What is “PSI”?

L322 – What’s mechanisms?

L326 - dot

L406 - ; or,?

L412—MS

L437-double dots

L467-dot [58]

L509--MS

Figure 1. Axis Y (left) and X (bottom) (very difficult to read... increase the font of the letter and numbers).. PCA Dendrogram and Distance Levels (?)

Figure 2 (legend). Whats is the number of the sample?

Best Regards

Author Response

Dear Revisor

First of all, we would like to warmly thank you for the review carried out on our work in a thorough way, allowing us to improve the work presented. Secondly, indicate that we have answered each of the indicated comments trying to respond correctly to their instructions.

#01. Have all 88 putative PGPR been evaluated with MALDI-TOF, culture colony, and microscopy? Isolated but also tested in blueberry? This was not very clear in the course of the work.

Thank you very much for your comment. In this case, 1 representative of each of the groups obtained in the MALDI-TOF MS analysis has been selected both for sequencing and for the analysis of the ability to promote plant growth because the groups obtained by this technique have characteristics homogeneous genetics as has been shown in previous works (Sanchez-Juanes et al., 2021). However, a sentence has been included at the beginning of subheadings 3.2, 3.3 and 3.4 to facilitate understanding by the reader.

#02. What is limited by raw milk application to soil, environment and other cultures?

This is an interesting question, the application of raw milk to soils is not limited and in some situations it is considered as a beneficial practice, as well as whey from the dairy industry. However, in our work we propose the use of cheese made with raw milk as a source of microorganisms with biofertilizing potential because when raw milk is used as raw material for cheese manufacturing, there is no elimination in the initial populations of lactic acid bacteria present. in cheese whose origin is the environment where the milk was obtained. Thus, during the cheese manufacturing process, there is an increase and selection of initial lactic acid bacteria, facilitating their isolation due to their high concentration.

#03. Were growth analyses performed on blueberry plants (production and productivity) or just colonization aspects even in roots?

The tests shown in the manuscript refer to the study of the ability to promote growth in the seedling stage (subheading 3.4) and colonization on blueberry roots (subheading 3.5). These tests have served as an initial stage in the selection of competent bacteria for application under field conditions where their effect on productivity will be analyzed at a later stage.

#04. what is the influence of soil pH, and the availability of PGPR for macro-micro nutrients? Would this association be beneficial on a large scale?

The pH is one of the most relevant factors in the solubility of numerous macro and micronutrients, as mentioned in the text, the solubilization of phosphate, for example, is determined by the production of organic acids and by the production of specific enzymes, in In the case of Fe, the solubility of this element is also increased at acid pH. However, these alterations only occur at the microscale and soil pH alteration occurs in narrow ranges determined by the viability of bacteria in these pH ranges. In turn, the soil, due to its intrinsic composition, has an important buffer capacity, so the effects occur in the environment of the bacteria and while it exerts its biological activity without generating drastic imbalances that limit the productivity of the soil. crop. Although, this type of consideration will be taken in later studies because this question is extremely interesting.

#05. What are the main limitations for large-scale cultivation, production and application in agriculture and other cultivated plants?

The use of selected lactic acid bacteria as biofertilizers has the same limitations as other bacterial biofertilizers, related to large-scale production, transport and accumulation. However, at an industrial and productive level, they have the advantage that by-products from the dairy industry can be used as whey for their production. Although this is a first study, in future tests we will propose the use of these bacteria that have shown a good character as a biofertilizer to determine their capacity as a multifunctional biofertilizer, which would be a great advantage for their industrial use.

Minor point

#06. All standardization of nomenclature equipment/reagents when necessary (i.e., Bruker Daltonics, Germany; Mattson, Madison, WI, USA). Example: Fabricant, State, Country (three-letter).

Muchas gracias por su comentario, se han corregido las nomenclaturas referentes a los reagentes y equipamientos en el main text.

L36 - indigenous populations (native population of bacteria)?

Yes, we corrected this in the text

L52 - “What is importance? “Between the 88 most studied microorganisms, Serratia or Pantoea stand out”?

Gracias por su comentário. Hemos procedido a incluir una frase expresando de manera adecuada las implicaciones de estos géneros. En los últimos años se han publicado ciertos estudios buscan nuevos géneros y especies que puedan servir como biofertilizantes bacterianos, sin embargo, Serratia y Pantoea han recibido una atención importante sin considerar las implicaciones que su uso puede tener debido a su naturaleza patogénica tanto para consumidores finales como para los propios aplicadores.

L58 - “t” ?

Corrected

Topic 2.2 MALDI-TOF, how many samples were analyzed?

Muchas gracias por su comentario, se analizaron 3 quesos pertenecientes a lotes de fabricación diferentes por triplicado haciendo un total de 9 aislamientos. La información ha sido añadida al texto (line 85).

L205 - L. plantarum (italic)

Corrected

L207-MALDI-TOF-MS (table legend)

Corrected

L227 and 231 – ssp. (dot)

Added

L255 and 286 – Figure 2

Corrected

L316 – What is “PSI”?

It means Phosphate Solubilization Index and we added the explanation in line 192

L322 – What’s mechanisms?

Thank you very much, these mechanisms are solubilization of phosphate from several sources, production of siderophores and indole-acetic acid and the information has been added in the text (line 366).

L326 – dot

Added

L406 - ; or,?

Corrected

L412—MS

Added

L437-double dots

Changed

L467-dot [58]

Deleted

L509—MS

Added

Figure 1. Axis Y (left) and X (bottom) (very difficult to read... increase the font of the letter and numbers).. PCA Dendrogram and Distance Levels (?)

Thank you very much for your comment. The figure has been updated improving the readability

Figure 2 (legend). Whats is the number of the sample?

We added the information to the legend of the figure 2. Thank you very much

Best Regards

 

Author Response File: Author Response.docx

Reviewer 2 Report

The study is interesting and could open to a safe crop management context. In summary, the manuscript is well designed and written, and it needs only little minor revisions, indicated as highlighted words and sticky notes, in the attached pdf file, named " agronomy-1700411-peer-review-v1_reviewer revised".

Comments for author File: Comments.pdf

Author Response

Dear Editor

 

We appreciate your work as reviewer of our manuscript and especially the invaluable review carried out, managing to improve the quality of the manuscript. Corrections have been made to the main manuscript. However, we attach as files the pdf with the response to each of the proposed corrections.

Best regards

 

Author Response File: Author Response.pdf

Reviewer 3 Report

Following your request to review this manuscript, this is my report which contains some remarks. In this paper entitled ' Evaluation of raw cheese as a novel source of new biofertilizers 2 to blueberry with high biosecurity level'.The authors evaluated  raw cheese as source of biofertilizers as well as their biosecurity level

 The work is well done, carefully thought out, and performed and the manuscript is well written and falls within the scope of Agronomy. To emphasize  the MS for being suitable for consideration in this Jornal, I would recommend:

• Emphasizing the discussion by revising additional new references dealing biofertilizers and their biosecurity
• Adding Institutional Review Board Statement
• Adding Informed Consent Statement
• Adding Data Availability Statement

 

Author Response

Dear revisor

 

Thank you very much for your comments and for having reviewed our work, your efforts are of great consideration to us.

 The work is well done, carefully thought out, and performed and the manuscript is well written and falls within the scope of Agronomy. To emphasize  the MS for being suitable for consideration in this Jornal, I would recommend:

• Emphasizing the discussion by revising additional new references dealing biofertilizers and their biosecurity

Thank you very much for your comment, the discussion has been increased considering these aspects of biosafety in the design of biofertilizers and mainly in the search for new genera with biotechnological interest. Line 495-510

• Adding Institutional Review Board Statement

Added. This is not applicable due to that the manuscript does not involve experiments with humans or animals.

• Adding Informed Consent Statement

Added. This is not applicable due to that the manuscript does not involve experiments with humans.

• Adding Data Availability Statement

We added the information. The pheS gene sequences have been deposited in the Genbank under the accession numbers indicated in the text and included below. The sequences will be released once the manuscript is published. However, I include below the list of the same and the sequences deposited for your knowledge.

QSE11     OM802165

QSE17     OM802166

QSE20     OM802167

QSE23     OM802168

QSE26     OM802169

QSE28     OM802170

QSE32     OM802171

QSE37     OM802172

QSE38     OM802173

QSE60     OM802174

QSE62     OM802175

QSE63     OM802176

QSE64     OM802177

QSE67     OM802178

QSE68     OM802179

QSE79     OM802180

 

>QSE11

ATCCGGCCCCGTGATATGCAAGATACATTTTACATTACGCCAGAAATTTTATTGCGTACGCAAACATCTCCAGTTCAATCTCGATCGCTTGAAAAACATGATTTTTCAAAAGGACCACTGAAAATGATTGCTCCTGGAAAAGTCTATCGTCGTGACACGGATGATGCCACTCACTCGCATCAGTTCCATCAAGTTGAGGGCATGGTGGTTGGCGAAAATATCACAATGGCTGACTTAAAAGGTACATTGCTTTCCATTATGCAAGAATTATTTGGTGAAAAACATCAGATTCGCATGCGACCTTCTTATTTCCCTTTCACTGAGCCATCTGTGGAGGTAGATGTTTCCTGGAATGAAGTTACACCCAGATT

>QSE17

ATCCGGCCTCGTGATATGCAAGATACATTTTACATTACGCCAGAAATTTTATTGCGTACGCAAACATCTCCAGTTCAATCTCGATCGCTTGAAAAACATGATTTTTCAAAAGGACCACTGAAAATGATTGCTCCTGGAAAAGTCTATCGTCGTGACACGGATGATGCCACTCACTCGCATCAGTTCCATCAAGTTGAGGGCATGGTGGTTGGCGAAAATATCACAATGGCTGACTTAAAAGGTACATTGCTTTCCATTATGCAAGAATTATTTGGTGAAAAACATCAGATTCGCATGCGACCTTCTTATTTCCCTTTCACTGAGCCATCTGTGGAGGTAGATGTTTCCTGGAATGAAGTTACACCAGATATGAATCCAGAAGACATTGAGTGGATTGAAGTTCTTGGTGCCGGCATGGGGTCCACCCA

>QSE20

CATCCGGCTCGTGATATGCAAGAGACTTTTTACATTACCAATGAGTTACTCATGCGCTCGCAGACAAGTCCAATGCAGGCGCGGACAATGGAAAAGCACGACTTTACCAAAGGACCGCTGAAAATGATTAGCCCTGGGGTGGTTTATCGACGTGATGACGACGATGCTACTCATAGCCATCAGTTTCACCAGATGGAAGGACTCGTCATTGACAAGCATATAACCATGGCTGATCTAAAGGGAACCTTGTTGGCCATGTGCCAACACGTTTTTGGTAAAGATCGGACAATTCGCTTGCGGCCAAGTTATTTTCCATTTACGGAGCCATCCGTTGAAGTTGATGTTTCCTGTTTTCGTTGCGGCGGTAAAGGTTGCCCGGTTTGCAAATATACCGGTTGGATTGAAGTGTTAGGTGCCGGCATGGTCCACCCAC

>QSE23

ATCCGGCCTCGTGATATGCAAGATACTTTCTATATCaCTAATGAAGTTTTACTTCGTACGCATACTTCACCTATGCAAGCTCGGACAATGGATGCTCATGATTTCTCTAAAGGTGGTTTACGCATGATTGCTCCTGGTCGTGTTTATCGTCGTGATACAGATGATGCCACTCACAGCCACCAATTTCATCAAATTGAAGGTTTGGTTGTAGATAAAAATATCACAATGGCAGACCTTAAAGGAACGCTTGACCTTGTCATGAAAAAAATGTTTGGTCAAGACCGTGAATTACGCTGGCGTCCAAGTTATTTCCCATTTACTGAACCTTCTGTTGAGGTTGATATTTCTTGTTTCAAATGTGGCGGAAAAGGCTGTAACGTCTGCAAACATACCGGCTGGATTGAAATTCTTGGTGCAGGCATGGGTCCACCCA

>QSE26

CTCATCCGGCCTCGTGATATGCAGGAAACTTTTTATATTACCAATGAGTTGCTGATGCGGTCCCAAACCAGCCCGATGCAGGCACGGACGATGGAGAAACATGACTTTACTAAAGGCCCGCTGAAAATGATCAGTCCGGGCGTGGTTTATCGGCGTGATGATGATGATGCCACACATAGCCACCAGTTTCATCAGATGGAAGGCCTGGTGATCGACAAGCATATTACAATGGCTGATCTTAAGGGGACGTTACTCGCCATGTGTCAGCATGTGTTTGGCGCTGATCGGACGATTCGCCTGCGCCCGAGCTATTTTCCGTTTACAGAACCGTCTGTAGAAGTGGACGTTTCCTGCTTCCGCTGCGGTGGCAAGGGCTGCCCTGTTTGCAAGTATACCGGCTGGATTGAAGTTCTCGGAGCAGGGCATGGGTCCACCCA

>QSE28

ATCCGGCCTCGTGATATGCAAGATACATTTTACATTACGCCAGAAATTTTATTGCGTACGCAAACATCTCCAGTTCAATCTCGATCGCTTGAAAAACATGATTTTTCAAAAGGACCACTGAAAATGATTGCTCCTGGAAAAGTCTATCGTCGTGACACGGATGATGCCACTCACTCGCATCAGTTCCATCAAGTTGAGGGCATGGTGGTTGGCGAAAATATCACAATGGCTGACTTAAAAGGTACATTGCTTTCCATTATGCAAGAATTATTTGGTGAAAAACATCAGATTCGCATGCGACCTTCTTATTTCCCTTTCACTGAGCCATCTGTGGAGGTAGATGTTTCCTGGAATGAAGTTACACCAGATATGAATCCAGAAGACATTGAGTGGATTGAAGTTCTTGGTGCAGGCATGGGTCCACCCA

>QSE32

ATCCGGCCTCGTGATATGCAAGATACGTTCTATATTACTAATGATTTATTGATGCGCACGCACATGTCACCCAATGAAGCACGTGACTTGGAAAACCATGACTTTGCTAATGGTCCCATTAAGATGATTAGTCCCGGCCGTGTTTACCGCCGTGATACAGATGATGCAACGCATTCGCATCAATTCTATCAAATGGAAGGCCAAGTGATTGATAAAAACATTACAATGGCAGACTTAAAGGGAACCTTAGAATACACGATTCACCATATTTTTGGTGAAGACCGTGATTTACGTTTCCGGCCAAGTTACTTTCCATTCACGGAACCATCTGTTGAAGTGGATATTTCTTGTTTCCGTTGTGATGGTAAAGGCTGTAATGTCTGCAAGCAAACTGGCTGGATTGAAGTTTTAGGGGCAGGCATGGGTCCACCCA

>QSE37

AATCTTATTACGCACACAAACCTCACCTGTGCAGTCACGCTCGTTGGAAAACATGATTTTTCAAAAGGACCATTAAAAATGATAGCGCCAGGCAAGGTGTATCGTCGTGACACTGATGATGCGACACATTCGCACCAATTTCATCAGGTCGAAGGGATGGTTGTTGGCGAAAATATTACCATGGCCGACTTAAAGGGCACGTTGTTATCAATCATGCAAAAGTTATTTGGCGAAAAGCATCAAATTCGTATGCGACCATCTTATTTCCCATTTACGGAACCTTCAGTTGAAGTAGACGTATCTTGGAATGAAGTCACACCAGATATGAAACCAGAGGATATTGAATGGATTGAAGTGCTTGGTGCAGGCATGGGTCCACCCA

>QSE38

ATCCGGCCTCGTGATATGCAAGATACTTTCTATATCACTAATGAAGtTTTACTTCGTACGCATACTTCACCTATGCAAGCTCGGACAATGGATGCTCATGATTTCTCTAAAGGTGGTTTACGCATGATTGCTCCTGGTCGTGTTTATCGTCGTGATACAGATGATGCCACTCACAGCCACCAATTTCATCAAATTGAAGGTTTGGTTGTAGATAAAAATATCACAATGGCAGACCTTAAAGGAACGCTTGACCTTGTCATGAAAAAAATGTTTGGTCAAGACCGTGAATTACGCTGGCGTCCAAGTTATTTCCCATTTACTGAACCTTCTGTTGAGGTTGATATTTCTTGTTTCAAATGTGGCGGAAAAGGCTGTAACGTCTGCAAACATACCGGCTGGATTGAAATTCTTGGTGCAGGCATGGGTCCACCCA

>QSE60

ATCCGGCCTCGTGATATGCAAGATACTTTCTATATCACTAATGAAGtTTTACTTCGTACGCATACTTCACCTATGCAAGCTCGGACAATGGATGCTCATGATTTCTCTAAAGGTGGTTTACGCATGATTGCTCCTGGTCGTGTTTATCGTCGTGATACAGATGATGCCACTCACAGCCACCAATTTCATCAAATTGAAGGTTTGGTTGTAGATAAAAATATCACAATGGCAGACCTTAAAGGAACGCTTGACCTTGTCATGAAAAAAATGTTTGGTCAAGACCGTGAATTACGCTGGCGTCCAAGTTATTTCCCATTTACTGAACCTTCTGTTGAGGTTGATATTTCTTGTTTCAAATGTGGCGGAAAAGGCTGTAACGTCTGCAAACATACCGGCTGGATTGAAATTCTTGGTGCAGGCATGGGTCCA

>QSE62

CCGGCTCGTGATATGCAAGAGACTTTTTACATTACCAATGAGTTACTCATGCGCTCGCAGACAAGTCCAATGCAGGCGCGGACAATGGAAAAGCACGACTTTACCAAAGGACCGCTGAAAATGATTAGCCCTGGGGTGGTTTATCGACGTGATGACGACGATGCTACTCATAGCCATCAGTTTCACCAGATGGAAGGACTCGTCATTGACAAGCATATAACCATGGCTGATCTAAAGGGAACCTTGTTGGCCATGTGCCAACACGTTTTTGGTAAAGATCGGACAATTCGCTTGCGGCCAAGTTATTTTCCATTTACGGAGCCATCCGTTGAAGTTGATGTTTCCTGTTTTCGTTGCGGCGGTAAAGGTTGCCCGGTTTGCAAATATACCGGTTGGATTGAAGTGTTAGGTGCGGGCATGGGTCCACCCA

>QSE63

CCTCGTGATATGCAAGAGACTTTTTATATTACCAATGAGTTACTCATGCGCTCGCAGACAAGTCCAATGCAGGCGCGGACAATGGAAAAGCACGACTTTACCAAAGGACCGCTGAAAATGATTAGCCCTGGGGTGGTTTATCGACGTGATGACGACGATGCTACTCATAGCCATCAGTTTCACCAGATGGAAGGACTCGTCATTGACAAGCATATAACCATGGCTGATCTAAAGGGAACCTTGTTGGCCATGTGCCAACACGTGTTTGGTAAAGATCGGACAATTCGCTTGCGGCCAAGTTATTTTCCATTTACGGAGCCATCCGTTGAAGTTGATGTTTCCTGTTTTCGTTGCGGCGGTAAAGGTTGCCCGGTTTGCAAATATACCGGTTGGATTGAAGTGTTAGGTGCCGGCATGGGTCCACCCA

>QSE64

CATCCCGCCCGTGACATGCAAGACACGTTCTATATTACCAAAGACGTGCTACTACGCACGCAGACGTCTGCTGATCAGCCGCGGTCACTTGAAAATCACGATTTTTCTAAAGGACCGCTGAAGGTCTTGTCACCTGGCCGCGTTTATCGGCGTGATACGGATGATGCAACCCATTCCCATCAATTTCATCAAATTGAAGGGTTAGTCGTGGACAAGCATATTACGATGGCTGATTTGAAGGGCACCTTAATTCTGGTTGCCAAGACTTTGTTTGGCGATCAATTCGATGTTCGGCTACGGCCAAGCTTCTTTCCATTCACGGAACCATCCGTAGAAGCTGATGTAACTTGCTTTAATTGCAATGGCAAGGGCTGTGCAATCTGTAAGCAAACGGGTTGGATCGAAGTACTGGGTGCAGGCATGGGTCCACCCA

>QSE67

CATCCCGCTCGTGATATGCAAGAGACTTTTTATATTACCAATGAGTTACTCATGCGCTCGCAGACAAGTCCAATGCAGGCGCGGACAATGGAAAAGCACGACTTTACCAAAGGACCGCTGAAAATGATTAGCCCTGGGGTGGTTTATCGACGTGATGACGACGATGCTACTCATAGCCATCAGTTTCACCAGATGGAAGGACTCGTCATTGACAAGCATATAACCATGGCTGATCTAAAGGGAACCTTGTTGGCCATGTGCCAACACGTGTTTGGTAAAGATCGGACAATTCGCTTGCGGCCAAGTTATTTTCCATTTACGGAGCCATCCGTTGAAGTTGATGTTTCCTGTTTTCGTTGCGGCGGTAAAGGTTGCCCGGTTTGCAAATATACCGGTTGGATTGAAGTGTTAGGTGCCGGCATGGTCCACCCA

>QSE68

CCTCCCGCTCGTGATATGCAAGACACGTTCTATATTACCAAAGACGTGCTACTACGCACGCAGACGTCTGCTGATCAGCCGCGGTCACTTGAAAATCACGATTTTTCTAAAGGACCGCTGAAGGTCTTGTCACCTGGCCGCGTTTATCGGCGTGATACGGATGATGCAACCCATTCCCATCAATTTCATCAAATTGAAGGGTTAGTCGTGGACAAGCATATTACGATGGCTGATTTGAAGGGCACCTTAATTCTGGTTGCCAAGACTTTGTTTGGCGATCAATTCGATGTTCGGCTACGGCCAAGCTTCTTTCCATTCACGGAACCATCCGTAGAAGCTGATGTAACTTGCTTTAATTGCAATGGCAAGGGCTGTGCAATCTGTAAGCAAACGGGTTGGATCGAAGTACTGGGTGCAGGCATGGTCCACCCAG

>QSE79

CGTGACATGCAAGACACGTTCTATATTACCAAAGACGTGCTACTACGCACGCAGACGTCTGCTGATCAGCCGCGGTCACTTGAAAATCACGATTTTTCTAAAGGACCGCTGAAGGTCTTGTCACCTGGCCGCGTTTATCGGCGTGATACGGATGATGCAACCCATTCCCATCAATTTCATCAAATTGAAGGGTTAGTCGTGGACAAGCATATTACGATGGCTGATTTGAAGGGCACCTTAATTCTGGTTGCCAAGACTTTGTTTGGCGATCAATTCGATGTTCGGCTACGGCCAAGCTTCTTTCCATTCACGGAACCATCCGTAGAAGCTGATGTAACTTGCTTTAATTGCAATGGCAAGGGCTGTGCAATCTGTAAGCAAACGGGTTGGATCGAAGTACTGGGTGCGGGCATGGTCCACCCAGCA

 

Author Response File: Author Response.docx