Next Article in Journal
Winter Wheat Seeding Decisions for Improved Grain Yield and Yield Components
Previous Article in Journal
Underestimated Damage Caused by the European Hazelnut Weevil, Curculio nucum (Curculionidae)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 12
10.3390/agronomy12123060
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Expanded and Diversified Calmodulin-Binding Protein 60 (CBP60) Family in Rice (Oryza sativa L.) Is Conserved in Defense Responses against Pathogens

by
Diksha Kumari
1,†,
Bishun Deo Prasad
1,2,*,†,
Sangita Sahni
3,
Heather M. Nonhebel
4 and
Priti Krishna
5,*
1
Department of Molecular Biology and Genetic Engineering, Bihar Agricultural University, Sabour, Bhagalpur 813210, Bihar, India
2
Department of Agricultural Biotechnology & Molecular Biology, CBS&H, Dr. Rajendra Prasad Central Agricultural University, Pusa, Samastipur 848125, Bihar, India
3
Department of Plant Pathology, Tirhut College of Agriculture, Dholi, Muzaffarpur 843121, Bihar, India
4
School of Science and Technology, University of New England, Armidale, NSW 2351, Australia
5
School of Science, Western Sydney University, Locked Bag 1797, Penrith, NSW 2751, Australia
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2022, 12(12), 3060; https://doi.org/10.3390/agronomy12123060
Submission received: 7 September 2022 / Revised: 24 November 2022 / Accepted: 28 November 2022 / Published: 3 December 2022
(This article belongs to the Section Crop Breeding and Genetics)
Browse Figures
Review Reports Versions Notes

Abstract

:
Plant disease management is key to sustainable production of staple food crops. Calcium (Ca2+) signal and phytohormones play critical roles in regulating plant defense responses against pathogens. The Ca2+ signals are sensed, decoded and transduced by calmodulin and other Ca2+ -binding proteins, followed by interaction with and modulation of activities of target proteins such as calmodulin-binding proteins (CBPs). Members of the Arabidopsis CBP60 gene family, AtCBP60g and AtSARD1, have emerged as major regulators of immune responses. In this study, we identified a 15 member CBP60 gene family in rice (Oryza sativa) of which OsCBP60g-3, OsCBP60g-4, OsCBP60a and OsSARD-like1 genes were consistently upregulated in rice seedlings in response to infection with both fungal (Magnaporthe oryzae) and bacterial (Xanthomonas oryzae) pathogens as well as by salicylic acid (SA). OsCBP60g-4 and OsCBP60g-3 were induced maximally by SA and brassinosteroid (BR), respectively, and OsCBP60g-4 was expressed at 3-fold higher levels in the M. oryzae resistant rice genotype (IC-346004) as compared to the susceptible rice genotype (Rajendra Kasturi). The considerable expansion of the immunity clade and the up-regulation of several OsCBP60 genes in response to pathogens and defense hormones supports the importance of further investigating OsCBP60 genes as targets for increasing disease resistance in rice.

1. Introduction

Rice, as a staple food of more than half of the world’s population, is key to food security in most Asian countries. The global demand for rice will continue to increase due to the predicted population growth to 9 billion by 2050 [1]. As with other crops, both biotic and abiotic stresses constrain the production of rice, and with the emergence of new diseases and pests associated with global warming, the situation is likely to be further exacerbated. Rice yield losses due to pests and pathogens at a global scale range from 20 to 40% [2]. Of the nearly 70 diseases that can occur in rice, losses due to bacterial blight caused by Xanthomonas oryzae pv. oryzae, and blast caused by Magnaporthe oryzae, are paramount [3]. The study of the molecular interactions between rice and X. oryzae and M. oryzae has made rice a model monocotyledonous plant in understanding pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) [4,5].
Phytohormones and a variety of secondary messengers play key roles in mediating cellular responses to various stress stimuli [6,7]. Of the known phytohormones, salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) have been implicated in disease resistance in rice plants [8]. The plant steroid hormone, brassinosteroid (BR), plays vital roles in plant growth and development, and also modulates abiotic and biotic stress responses [9,10]. BR has also been implicated in rice immune mechanisms [11], but due to its cross-talk with other defense hormones [12,13], the role of BR in rice immunity requires further investigation.
Calcium ion (Ca2+) is an ubiquitous and a highly versatile secondary messenger involved in regulating plant growth and stress responses [14,15]. Calcium signatures are formed by changes in cytosolic free Ca2+ concentration ([Ca2+]cyt) in response to developmental and environmental stimuli, including pathogen signals [16]. The calcium signatures are decoded by Ca2+ sensors such as calmodulin (CaM) and CaM-like (CML) proteins, calcium-dependent protein kinases (CDPKs) and calcineurin B-like (CBL) proteins that translate the signal to molecular, physiological and metabolic responses [17]. CaM, the primary receptor of intracellular Ca2+, functions by interacting with and modulating the activities of various target proteins, such as transcription factors, kinases, phosphatases and metabolic enzymes [18,19]. Although there is no well-defined consensus sequence for a CaM-binding domain (CBD), several characteristic features such as higher propensity for helical conformation, net positive charge within the binding region, and hydrophobic anchor residues separated by certain number of amino acids, have allowed for prediction of CBD within a protein [20,21].
Several CaM-binding protein (CBP) families with distinct roles in stress responses have been identified in plants [22,23]. An eight-member plant-specific gene family in Arabidopsis, AtCBP60, comprises of members that are induced by pathogen infection and play critical roles in SA-mediated immunity [24,25]. Two closely related members of the AtCBP60 family, AtCBP60g and SAR DEFICIENT1 (SARD1), promote SA production in response to recognition of microbe associated molecular patterns (MAMPs) and impact both SA-dependent and SA-independent gene expression [26,27]. AtCBP60g binds CaM via its CBD located at the N-terminus, while AtSARD1 appears to lack a CBD and does not bind CaM [26,28]. Studies in Arabidopsis suggest that AtCBP60g responds to the initial activation of Ca2+ flux in response to plant-pathogen interaction, which leads to SA production and subsequent immunity-related gene expression, while AtSARD1 functions similarly but in a Ca2+-independent manner such that immune responses continue to persist even after Ca2+ levels have returned to the normal range [25]. Recently it was demonstrated that AtCBP60b positively regulates immunity by activating the expression of AtSARD1 and AtCBP60g and other immune response genes [29]. In contrast to the positive regulation of immune responses by AtCBP60g, AtSARD1 and AtCBP60b, knockdown of the CBP60a ortholog in cotton increased SA levels and resistance against pathogen, indicating that CBP60a is a negative regulator of immunity [30]. Phylogenetic analysis of CBP60 protein sequences of diverse plant species has revealed that CBP60a, CBP60g and SARD1 form an immune-related clade and that these subfamilies are evolving at a fast rate, likely due to strong selection pressure from pathogen effectors [31]. Interestingly, AtCBP60g and AtSARD1 have also been linked with cold and drought stress responses [24,32], and to be induced by BR (P. Krishna, personal communication).
While the roles of a subset of CBP60 genes in immune regulation are well documented in dicotyledonous plants [25,33], there is little information on the CBP60 genes and their functions in monocotyledonous plants [33]. Considering the growing importance of the roles of CBP60 genes in biotic and abiotic stress responses, we undertook a study of the CBP60 gene family in rice, a model monocotyledonous plant. Fifteen OsCBP60 genes were identified in rice. Of these, 12 gene products fell in the immunity clade, indicating a significant expansion of the CBP60g and SARD1 subfamilies in rice. Five OsCBP60 genes within the immunity clade were upregulated by both pathogens, SA and BR. Single nucleotide polymorphisms (SNPs) were identified within the putative promoter region of OsCBP60g-4, which was expressed at a higher level in M. oryzae resistant genotype as compared to a susceptible genotype. These results provide strong preliminary evidence for an expanded role of the OsCBP60 gene family in defense against pathogens in rice.

2. Materials and Methods

2.1. Sequence Analysis

Similarity searches of nucleotide and amino acid sequences were carried out using BLASTP at the National Center for Biotechnology Information (NCBI) GenBank database and the Phytozome (https://phytozome.jgi.doe.gov/pz/portal.html) (accessed on 14 June 2016) database. A phylogenetic tree was constructed using the neighbour-joining (NJ) method based on the genetic distance of the protein sequences using the MEGA 7 (http://www.megasoftware.net/) (accessed on 14 June 2016) tool. The chromosomal positions of OsCBP60s were studied using Phytozome v12.1 database (https://phytozome.jgi.doe.gov/pz/portal.html) (accessed on 16 August 2017). In order to identify the conserved motif structures encoded by the OsCBP60s, gene structure analysis was carried out using the Gene structure display server GSDS 2.0.
Using Boxshade (https://embnet.vital-it.ch/software/BOX_form.html) (accessed on 12 September 2021) and CLUSTAL Omega (accessible through https://www.ebi.ac.uk) (accessed on 12 September 2021), the sequences for the conserved CaM and DNA-binding domains were analysed. The Calmodulin Target Database (http://calcium.uhnres.utoronto.ca/ctdb/ctdb/sequence.html) (accessed on 15 September 2021) and CalModulin intEraction Learning System (CaMELS; https://camels.pythonanywhere.com/) (accessed on 15 September 2021) were used to further examine OsCBP60 amino acid sequences for the presence of potential CBD. In addition, amino acid sequences were submitted to https://heliquest.ipmc.cnrs.fr/ for the detection of amphipathic helices.
Subcellular localization of proteins was analysed using Balanced Subcellular Localization Predictor tool (BaCelLo) (http://gpcr.biocomp.unibo.it/bacello/info.htm) (accessed on 25 October 2021).
Upstream sequences of genes were obtained from the Rice Annotation Project Database (http://rapdb.dna.affrc.go.jp/tools/dump) (accessed on 13 April 2018). The putative promoters regions (1000 bp and 2000 bp upstream of transcription start site) of Arabidopsis and rice CBP60 genes were searched for the presence of TGACG motif as binding site for TGA1/TGA4, W-box [(T)TGAC(C/T)] for WRKY70, and CAMTA motif [(A/C/G)CGCG(C/G/T)] for CAMTA, using PlantPAN 3.0 (http://PlantPAN.itps.ncku.edu.tw/) (accessed on 20 September 2021) platform. BES1 (CANNTG, CACGTG and CACTTG) and BZR1 (CGTGT/CG) binding sites were manually searched within the putative promoter sequences of the genes [10,34,35].

2.2. Plant Materials and Treatments

Rice cv. Rajendra Kasturi (Oryza sativa L. sp. indica cv. Rajendra Kasturi) was used in this study. Seeds of Rajendra Kasturi were grown in earthen pots containing 2:1 soil:cocopit in a greenhouse maintained at 28 °C. M. oryzae (isolate B157, corresponding to international race IC 9) was obtained from Dr. Bharat Chattoo Genome Research Centre, M.S. University, Vadodara, Gujarat. M. oryzae was grown on Potato Dextrose Agar (PDA) medium at 28–30 °C. For infection with the fungus, 21-day-old rice seedlings were inoculated with conidial suspensions (1 × 105 spores/mL) of M. oryzae as described previously [36,37,38]. For mock treatment, rice seedlings were treated with an equal volume of distilled water.
X. oryzae pv. oryzae was isolated from blight infected rice field at Bihar Agricultural College, Sabour (NCBI GenBank: MH986180) [39]. X. oryzae was grown on a nutrient agar medium at 28 °C [39,40]. Leaf infection with X. oryzae was performed using the leaf clipping method [38,41]. Rice leaves were clipped with scissors dipped in bacterial suspension (1 × 108−9 cfu/mL) in saline (0.9%) containing 0.05% Triton-X-100. Sterile water containing 0.05% Triton-X-100 was used for mock treatment. Leaf samples were collected at 12 h, 24 h and 48 h after pathogen and mock inoculation, quick frozen in liquid nitrogen and stored at −80 °C till further use.
Rice genotypes IC-346004, IRBB55, Pusa Basmati-1 and Tetap were also used for pathogens treatment as described for Rajendra Kasturi.
For SA treatments, 21-day-old rice seedlings were sprayed with 3 mM sodium salicylate containing 0.05% Triton-X-100 [38]. Seedlings sprayed with distilled water containing 0.05% Triton-X-100 served as a mock treatment. For JA treatment, seedlings were grown for 21 days in black portrays (9 cm diameter and 9 cm height) containing a hole at the bottom for water absorption from a tray (20X14X7 cm) containing 1 litre of water. Seedlings were then placed in another tray containing either 100 µM JA [42] or water for mock treatment. Leaf samples were collected at 12 h, 24 h and 48 h after treatment.
For EBR treatment, surfaced sterilized rice seeds were placed on ½ Murashige and Skoog (MS) medium containing either 1 µM EBR or 0.02% ethanol (solvent of EBR) in test tubes [10,43]. The test tubes were closed with sterilized cotton plugs. Seedlings were grown for 15 days in the presence of EBR before leaf tissue was collected for gene expression analysis.
SNP analysis was carried out using DNA isolated from rice varieties IC-346004 (resistant to M. oryzae) and Rajendra Kasturi (susceptible to M. oryzae).

2.3. qRT-PCR Analysis

Total RNA was isolated using the SV Total RNA isolation kit (Promega). Random hexamer primers (Promega) were used for the synthesis of cDNA from total RNA by reverse transcription. cDNA was diluted in nuclease free water (1:5) and used for Quantitative real-time RT-PCR (qRT-PCR) analysis. qRT-PCR was carried out using SYBR Green dye in Light Cycler system (Applied Biosystem). Each qRT-PCR quantification was carried out in triplicate using gene specific primers (Supplementary Table S1). ACTIN was used as reference gene to normalize the gene expression data. The fold-change in expression level was calculated using the 2−∆∆Ct method of relative quantification compared with control [44].

2.4. Promoter Mining

Genomic DNA was extracted from young seedlings of IC-346004 and Rajendra Kasturi using the DNA extraction kit (Qiagen, Germantown, MD, USA). The 1000 bp upstream region of OsCBP60g-4 was amplified using specific primers (Fp: GCTGTGGACACTTCCTAGCC and Rp: GCAACTCACGCGGTGACACG) and the amplified product was sequenced. The sequences of IC-346004 and Rajendra Kasturi were compared with the reference sequence (Nipponbare; AP014967.1) available at NCBI by generating sequence alignment using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) (accessed on 12 July 2020) to identify Single Nucleotide Polymorphisms (SNPs).

2.5. Statistical Analysis

Gene expression data was statistically analysed using the computer software SPSS. Significance of differences were analysed by one-way analysis of variance (ANOVA). Comparison among treatment means was performed using the Least Significant Difference (LSD) multiple-comparison test.

3. Results

3.1. Phylogenetic Analysis of CBP60 Families in Arabidopsis and Rice

CBP60 proteins in rice were identified by performing BLASTP searches at Phytozome11 using complete protein sequences of the eight Arabidopsis members as query against the rice genome (Oryza sativa v7_JGI). After removing the incomplete sequences, a total of 15 OsCBP60/SARD1-like genes were identified. The protein sequences of the 15 OsCBP60s and eight AtCBP60s were used to create a phylogenetic tree using neighbor-joining method with bootstrapping (500 replicates) in MEGA7 software and rooted with a moss CBP60 sequence (Figure 1). We have named OsCBP60s based on sequence homology with the Arabidopsis proteins (Table 1). The OsCBP60s were numbered according to their location on consecutive chromosomes but the gene numbers do not correlate to the chromosome numbers. If more than one gene was on the same chromosome, the numbering of gene members of a subgroup was continued in a consecutive manner.
The phylogenetic tree analysis identified two main clades with high reliability, which were further divided into sub-clades (Figure 1). Three rice proteins that grouped in clade I were designated as orthologs of AtCBP60b, c and d and named OsCBP60bcd-1, OsCBP60bcd-2 and OsCBP60bcd-3 (Figure 1). Proteins closely related to AtCBP60e and AtCBP60f were absent in rice. A total of 12 OsCBP60/SARD1-like proteins grouped in the immunity-related clade II with AtCBP60a, AtCBP60g and AtSARD1. One of these, designated as OsCBP60a, appears to be orthologous to AtCBP60a. The three proteins forming a branch with AtSARD1 have been named as SARD-like (SARDL): OsSARDL-1, OsSARDL-2 and OsSARDL-3. The remaining eight proteins form a diverse group with AtCBP60g, although the position of OsCBP60g-1/SARDL remained unclear based on bootstrap values. To gain a better understanding of the position of OsCBPO60g-1/SARDL, a phylogenetic tree of CBP60 homologs from Arabidopsis, rice and cotton was constructed using NJ and ME algorithms (data not shown). While the phylogenetic tree analysis grouped OsCBP60g-1/SARDL with CBP60gs from Arabidopsis and cotton, exon analysis of all OsCBP60 proteins showed that similar to OsSARDL proteins, OsCBP60g-1/SARDL has a shortened C-terminus (Figure 2). Pairwise sequence alignment indicated that OsCBP60g-1/SARDL shares greater similarity with OsSARDL as compared to OsCBP60g proteins. Due to this discrepancy, we have named this protein as OsCBP60g-1/SARDL. Figure 2 indicates that in contrast to OsCBP60g-1/SARDL, the rest of OsCBP60gs (OsCBP60g-2-8) gained new C-terminal exons (Figure 2).
OsCBP60g-1/OsSARDL and OsCBP60g-2 are located far apart on chromosome 3, while OsCBP60g-3 and OsCBp60g-4 are located close together on the chromosome 11 (Table 1). Four OsCBP60g genes (OsCBP60g-5 to OsCBP60g-8) are encoded on chromosome 12. Also located on chromosome 3 is OSCBP60a. The OsSARDL1-3 are located on chromosomes 1, 8 and 9, respectively. OsCBP60bcd-1 and OsCBP60bcd-2 are located on chromosome 2 and OsCBP60bcd-3 on chromosome 4.

3.2. Predicted CaM- and DNA-Binding Regions in OsCBP60 Proteins

CBP60 proteins, in general, function as CaM-regulated transcription factors and most members of the AtCBP60 family contain a CaM-binding domain (CBD) [28,45]. We first examined amino acid similarities between OsCBP60 and AtCBP60 proteins to tentatively identify CBD and DNA-binding domains (DBDs) in OsCBP60 proteins. Since the prediction of CBD is quite difficult as it does not have a signature sequence, the CBD in OsCBP60s was also predicted using two tools, Calmodulin target database and CaMELS (Table 1 and Supplementary Table S2).
Based on the high interaction site prediction scores through CaMELS and amino acid similarities with AtCBP60s, a CBD was identified in the C-termini of each OsCBP60bcd-1, 2 and 3 (Supplementary Table S2). The predicted CBDs in OsCBP60bcd-1, 2 and 3 showed a high level of conservation with each other as well as with AtCBP60b, c, d, e and f (Figure 3). Based on the search in Calmodulin target database, the CBD in OsCBP60a was predicted to be localised at the C-terminus of the protein, similar to the position identified in AtCBP60a (Table 1). Since the predicted CBD in OsCBP60a showed moderate amino acid similarity with the CBD in AtCBP60a (Figure 4a), the characteristic basic amphiphilic alpha helix found in CBDs [46], was identified by the Heliquest algorithm (Figure 4b). The positively charged amino acids in both proteins lie on one face of the helix while the hydrophobic residues lie on the other face, indicating that this region could serve as CBD in both proteins. Similar to AtSARD1 [26,28], a CBD was not predicted in the OsSARDL proteins (Table 1). Unlike the usual C-terminal localisation of CBD in most AtCBP60s, the CBD in AtCBP60g was identified in the N-terminus [26,31]. It is to be noted that the N-terminal localised CBD in AtCBP60 was identified through experimentation and not on the basis of sequence analysis. A CBD could not be identified in the OsCBP60g proteins. The rice proteins within this clade have highly variable N-terminal sequences with little or no homology to each other or to AtCBP60g (data not shown). For the same reason, Val-29 that is required for the binding of AtCBP60g to CaM [47], could not be identified in OsCBP60g proteins. Based on this information it is tentatively concluded that the OsCBP60g proteins lack a CBD.
The DBD in CBP60s is present within the highly conserved region in these proteins (Figure 5) and, to date, has been experimentally verified only in AtCBP60g and AtSARD1 [47]. A comparison of the previously identified DBD in AtCBP60g and AtSARD1 with the rice proteins indicated that while this region is most conserved amongst all OsCBP60, OsSARDL-1, 2, and 3 and OsCBP60g proteins exhibit high level of conservation with their Arabidopsis counterparts (Figure 5). Of the latter group, the DBDs in OsCBP60g-1/OsSARDL, OsCBP60g-5 and OsCBP60g-6 showed high degree of sequence similarity to the DBDs of AtSARD1 and AtCBP60g. Localisation predictions by BaCelLo indicated nuclear localisation for all OsCBP60 proteins with the exception of OsCBP60g-4 (Table 1), although an alternative prediction program CELLO (http://cello.life.nctu.edu.tw/) (accessed on 30 October 2021) located OsCBP60g-4 also in the nucleus. These results suggest that OsCBP60 function as transcription factors like their Arabidopsis orthologs.

3.3. OsCBP60 Gene Expression Changes in Response to Pathogen Infection

Since the role of AtCBP60g and AtSARD1 in immunity is well documented [26,27,31,47], we studied the expression of OsCBP60 genes in rice seedlings infected with M. oryzae and X. oryzae. OsPR1a, a marker gene for defense response in rice, was upregulated at all-time points (12, 24 and 48 h) post infection with M. oryzae and X. oryzae, serving as a positive control in this analysis (Figure 6 and Figure 7). Genes that were highly upregulated at 12 h post infection with M. oryzae included OsCBP60g-5 (~85-fold induction), followed by OsCBP60g-8 (~73-fold induction) and OsCBP60g-6 (~45-fold induction), while those expressed at the highest level at 48 h were OsCBP60g-7 (~39-fold induction) followed by OsCBP60g-8 (~32-fold induction) and OsCBP60a (~27-fold induction) (Figure 6). For OsCBP60g-5, 6, 8, the initial high induction at 12 h was reduced by 48 h of M. oryzae infection. It is possible that OsCBP60g-5, 6, 8, similar to AtCBP60g [48], respond to the initial Ca2+ signal that is generated during plant-pathogen interaction.
Genes that were highly upregulated at 12 h post infection with X. oryzae pv. oryzae included OsCBP60g-3 (~25-fold induction) followed by OsCBP60g-7 (~19-fold induction), OsCBP60bcd-2 (~13-fold induction), while those expressed at the highest level at 48 h were OsCBP60a (~28-fold induction), followed by OsCBP60g-7 (~24-fold induction) and OsSARDL-1 (~19-fold induction) (Figure 7). In case of OsCBP60a, OsSARDL-1, OsCBP60g-4 and OsSARDL-3, a steady increase in expression was observed from 12–48 h.
OsCBP60g-3, 4, 7, OsCBP60a and OsSARDL-3, all belonging to immunity cluster, were upregulated at all the time points studied for both pathogens. OsCBP60g-6, 8 and OsCBP60bcd-3 had opposing expression patterns in response to the bacterial and the fungal pathogens. The reason for these observations may lie in the fact that rice interactions with the two pathogens have both distinct as well as shared defense responses [49,50].

3.4. OsCBP60 Gene Expression Changes in Response to Phytohormones

Typically, SA and JA are considered to play key roles in plant defense responses [6,38,51]. The involvement of SA and JA in rice defense responses against M. oryzae and X. oryzae was strongly endorsed through extensive global gene expression analyses [50]. A growing body of evidence supports a role of BR in plant disease resistance [6,10]. We studied the expression of OsCBP60 genes, along with the expression of the defense marker gene OsPR1a, in rice seedlings treated with SA, JA and 24-epibrassinolide (EBR), a BR.
With the exception of OsCBP60g-5, all other OsCBP60s were upregulated to different levels in response to SA treatment (Figure 8). OsCBP60g-4 was maximally induced by SA (28 to 41-fold) at all-time points studied, followed by OsCBP60a (Figure 8). The induced expression of several OsCBP60s in response to M. oryzae, X. oryzae and SA treatment supports a role for these proteins in disease resistance in rice.
JA induced both up and down -regulation of OsCBP60 genes with OsCBP60g-6 and OsSARDL-2 showing maximum induction at ~ 23- and 20- fold, respectively, at 24 h post treatment. By contrast, OsCBP60g-5 and OsCBP60g-4 were downregulated by ~ 18 and 12- fold, respectively (Figure 9). The down-regulation by JA of OsCBP60g-4 and other OsCBP60 genes that were upregulated by SA is reminiscent of the antagonistic interactions between SA and JA signaling pathways.
In EBR-treated rice samples, all 15 OsCBP60 genes were upregulated to different levels (Figure 10). Maximum upregulation was observed for OsCBP60g-3 (~15-fold) followed by OsCBP60g-4 (~9-fold) and OsCBP60g-7 (~9-fold). These genes also showed prominent upregulation by pathogens (Figure 6 and Figure 7), and the former two by SA (Figure 8). Of the SARD-like genes, OsSARDL-1 was upregulated by pathogens, SA and EBR. Interestingly, four OsCBP60s, namely OsCBP60bcd-1, 3 and OsCBP60g-6, 7, were upregulated in both JA and EBR -treated rice seedlings (Figure 9 and Figure 10).

3.5. Analysis of Transcription Factor Binding Sites in Putative Promoter Regions of CBP60 Genes

In recent years, transcription factors (TFs) that regulate the expression of AtCBP60g and AtSADR1 have been identified. These include bZIP transcription factor family proteins TGACG-BINDING FACTOR 1 (TGA1) and TGA4 as positive regulators of both genes [53], and WRKY70 and CAMTA3 as negative regulators of AtSARD1 [54,55]. We identified TGACG motif as binding site for TGA1/TGA4, W-box [(T)TGAC(C/T)] for WRKY70, and the CAMTA [(A/C/G)CGCG(C/G/T)] motif in putative promoters regions (1000 bp and 2000 bp upstream of transcription start site) of Arabidopsis and rice CBP60 genes using PlantPAN 3.0 platform. In the 2000 bp upstream regions of Arabidopsis genes, 14 CAMTA-binding sites were identified in AtSARD1, followed by six sites in each AtCBP60c and AtCBP60e and three sites in AtCBP60g (Supplementary Table S3). In rice genes, maximum number of CAMTA-binding sites were identified in the putative promoter region of OsCBP60g-3 (12 sites) followed by OsSARDL-1 (nine sites), OsCBP60g-1/OsSARDL (six sites), OsCBP60g-4 (six sites), OsCBP60bcd-3 (five sites), OsCBP60g-6 (five sites), and OsCBP60g-7, OsCBP60g-8 and OsCBP60bcd-2 (four sites) (Supplementary Table S3).
Maximum number of TGACG motif (42) was identified in AtSARD1, followed by 13 sites in AtCBP60g, nine sites in AtCBP60f, six sites in AtCBP60a and two sites in AtCBP60d in the 2000 bp upstream regions of Arabidopsis genes (Supplementary Table S3). In rice genes, maximum number of TGACG motif were identified in the putative promoter region of OsCBP60g-3 (13 sites) followed by OsCBP60g-1/OsSARDL (eight sites), OsCBP60a (seven sites), OsCBP60g-5 (seven sites) and OsCBP60g-6 (five sites). The maximum number of W-box site was observed in AtCBP60e followed by AtCBP60g, AtCBP60f, AtCBP60c, AtCBP60d, AtSARD1, AtCBP60a and AtCBP60b. In rice genes, maximum enrichment of W-box was observed in OsCBP60g-3 (35), followed by OsCBP60g-4 (26), OsCBP60g-2 (23), OsCBP60g-6 (23), OsSARDL-1 (20), OsCBP60g-5 (13) and OsSARDL-3 (10). While the number of TF binding sites identified here is an overrepresentation, the identification of these sites mainly in OsCBP60g and OsSARD-Like genes indicates that the TFs involved in the regulation of these genes in rice may be similar to those identified in Arabidopsis.

3.6. Analysis of BZR1/BES1-Binding Sites in Putative Promoter Regions of OsCBP60 Genes

BR plays important roles in disease resistance [56] and works in part via Ca2+/CaM signalling to mount a BR response [57,58,59]. This together with the observation that EBR could induce OsCBP60 expression (Figure 10) led us to search for binding sites of BZR1 and BES1 in the putative promoter regions of OsCBP60 genes. BZR1 and BES1 are the main TFs of the BR signalling pathway that are involved in mounting a BR response [34,35]. The search for BES1-binding site (CANNTG) and BZR1-binding site (CGTG(T/C)G identified maximum enrichment of BES1 sites in OsSARDL-1 (14 sites) followed by OsCBP60a (13 sites), OsCBP60g-4 (12 sites) and OsCBP60bcd-1, 2, 3 (11 sites), and relatively lesser number of BZR1 sites in OsCBP60g-2 (2 sites) and a single site in OsSARDL-1, 2, OsCBP60g-1/OsSARDL, 3, 4, 8 and OsCBP60bcd-3. BES1-binding sites were also observed in promoter regions of AtCBP60e (12 sites), AtCBP60f (10 sites), AtCBP60d (eight sites), AtCBP60g (five) and AtSARD1 (five) (Supplementary Table S3). BZR1-binding sites were identified only in AtCBP60a (3 sites).

3.7. Promoter Mining of OsCBP60g-4

OsCBP60g-4 was upregulated in response to infection with both M. oryzae and X. oryzae (Figure 6 and Figure 7) and was strongly induced by SA (Figure 8) and to a lesser extent by EBR (Figure 10), suggesting a probable role in disease resistance. We further tested the expression of OsCBP60g-4 in M. oryzae and X. oryzae resistant and susceptible rice genotypes. Analysis of OsCBP60g-4 expression in leaf tissue of Rajendra Kasturi (an indica rice cultivar susceptible to rice blast), and IC-346004 (resistant to rice blast, containing R-genes Piz-5, Pi-9, Pitp(t), Pi-1, Pi-33, Pi-b, Pi27(t), Pi-ta) [60] seedlings grown under controlled conditions, identified ~3-fold higher expression of the gene in IC-346004 as compared to Rajendra Kasturi (Figure 11a). Additionally, OsCBP60g-4 was found to be maximally upregulated in the resistant genotype IRBB55, followed by the moderately resistant Tetap, at 6 h, 12 h and 48 h post infection with X. oryzae (Figure 11b). By contrast, in the susceptible genotype [Pusa Basmati-1 (PB-1)], the expression of OsCBP60g-4 was downregulated at 12 h and 24 h post infection.
To putatively identify regulatory single nucleotide polymorphisms (SNPs) affecting gene expression due to change/modification in TF binding sites (TFBSs), we mined the promoter sequences of OsCBP60g-4 from a susceptible and a resistant to M. oryzae rice genotype. The 1000 bp upstream regions of OsCBP60g-4 from Rajendra Kasturi, and from rice germplasm accession IC-346004, were sequenced. The sequences were compared with the reference sequence of Nipponbare (AP014967.1 obtained from NCBI). Multiple sequence alignments identified 12 SNPs of which seven SNPs were associated with known TF binding sites (Figure 12). Two SNPs which change the binding site of EIN3, a TF involved in ethylene signalling [61], were identified in the sequence of the susceptible cultivar Rajendra Kasturi. Other transition and transversion mutations alter B3 and NF-YB -binding sites, leading to the formation of potential TALE homeodomain and B3 binding sites, respectively, in the Rajendra Kasturi sequence (Figure 12). Comparison between the reference and resistant genotype IC-346004 sequences showed loss of two TCP-binding sites with formation of potential homeodomain and other TF -binding sites in the IC-346004 sequence, and potential conversion of an EIN3 site to B3-binding site (Figure 12). While these results do not provide evidence of a link between the higher expression of OsCBP60g-4 in the resistant IC-346004 vs. susceptible Rajendra Kasturi (Figure 11a) and the SNPs identified (Figure 12), they providde impetus for detailed functional analysis of OsCBP60 genes and their promoters to understand the significance of this gene family in biotic and abiotic stress tolerance.

4. Discussion

In plant immune systems, the immunogenic elicitors (PAMPs, MAMPs) arising from pathogens are recognised by receptor proteins localised at the plasma membrane, which then trigger cytosolic signalling events [62]. The increases in cytosolic Ca2+ within minutes of elicitor recognition is an early event in the signalling cascade that leads to the immune response [17,63,64]. In Arabidopsis leaves a significant increase in Ca2+ was seen to occur within two hours of infection with an avirulent bacteria [65]. The spatiotemporal patterns of Ca2+ changes at the cellular and tissue levels form the Ca2+ signatures, which are decoded by CBPs. CaM is the most researched Ca2+ sensor which can bind to TFs and regulate their activities, and it has been linked to SA-mediated response to pathogens [66]. One of the links between Ca2+/CaM and SA has been through CaM transcription activators (CAMTAs), which negatively regulate SA biosynthesis [55]. SA has been known since long to play a critical role in plant immunity [67]. SA levels increase both locally and systemically in response to pathogen infection, which sets in train the SA signalling-induced gene expression and immunity.
Another gene family, CBP60, linked with Ca2+/CaM and SA was identified in Arabidopsis. Members of this family, AtSARD1 and AtCBP60g, function as TFs and directly regulate the expression of isochorismate synthase 1 (ICS1), which encodes a crucial enzyme in SA biosynthesis [47]. The expression of AtSARD1 and AtCBP60g is repressed by CAMTAs, specifically by CAMTA3, leading to inhibition of SA synthesis [55]. Recent reports have also linked additional members of the AtCBP60 family, AtCBP60a and AtCBP60b with immune responses in Arabidopsis [25,29], highlighting the importance of the Ca2+/CaM-regulated CBP60 family in plant immunity.
PAMP induced Ca2+ influx is critical for disease resistance in rice [68], and a large number of Ca2+ sensors, including CaM and CaM-like (CML) proteins have been identified in the rice genome [69,70]. However, there is little information on CBPs in rice. A CAMTA gene, OsCBT, was isolated from a rice cDNA library constructed from fungal elicitor-treated rice suspension cells [71]. OsCBT was shown to be a negative regulator of defense-related gene expression [72]. A genome wide analysis of the CAMTA gene family in rice identified seven CAMTA genes, and, in silico analysis of their expression indicates potential functions in abiotic and biotic stress responses [73]. Very recently, Wang et al. [74] reported a CBP60 gene family of 19 members in the rice cultivar Zhonghua 11 (ZH11). In this study upregulation in response to chitin and pathogen infection of only a subset of genes was seen in rice seedlings grown from CaCl2-pretreated seeds.
In view of the importance of AtCBP60 genes in plant immunity [25,27,29,75], we carried out a search of CBP60 genes in rice. The 15 OsCBP60s candidates in rice showed an expanded and diversified immunity clade II but a reduced clade I comprising only three gene members (OsCBP60bcd1-3) as opposed to five members (AtCBP60b-f) in Arabidopsis. The immunity clade in rice maintained the previously identified three subfamilies—CBP60a, SARD1 and CBP60g [31]. Similar to AtSARD1 [26], OsSARD-like proteins lack a CBD, and similar to AtCBP60a, which is demonstrated to bind CaM [25], OsCBP60a appears to contain a CBD at its C-terminus (Figure 4). Unlike AtCBP60g, which contains a CBD at its N-termius [28], a CBD could not be identified in the highly expanded OsCBP60g subfamily. This raises the question of whether the OsCBP60g subfamily is evolving for functions unrelated to immunity or whether the immunity-related functions of this subfamily are independent of regulation by Ca2+/CaM. Although experimental verification is required to address the CaM binding ability of OsCBP60g proteins, the high level induction of OsCBP60g-3, 4, 5, 7 in response to pathogen infection (Figure 6 and Figure 7) strongly suggests that these proteins are involved in rice defense responses against pathogens. An extensive phylogenetic analysis of CBP60 members in 247 diverse land plant species led Zheng et al. [31] to suggest that either CaM-binding is not essential for CBP60g proteins for their immunity-related functions or that a CaM-binding adapter protein works with these proteins to regulate their immune-related activities. The identification of three OsSARD-like and eight OsCBP60g proteins in rice (Figure 1) is also in agreement with the observations made in the study of diverse angiosperm species, which concluded that the immune regulator subfamilies are evolving rapidly, likely due to pressure from fast evolving pathogens [31].
In Arabidopsis, AtCBP60g and AtSARD1 were experimentally shown to be located in the nucleus and to bind to gene promoters [47], and AtCBP60b to be recruited to the AtSARD1 promoter region [75]. Two sets of analyses made with OsCBP60 proteins in this study suggest that the rice proteins also function as TFs; (1) multiple sequence alignment indicated the presence and conservation to varying degrees of a DBD in OsCBP60g and OsSARD-like proteins, and (2) in silico localization analysis indicated that all OsCBP60s are localized to the nucleus.
In signalling events that mediate rice innate immunity, the host sensors transduce the signal through mitogen-activated protein kinase (MAPK) cascades and TFs to activate the expression of numerous genes, including pathogenesis-related (PR) genes [76,77,78], which are a hallmark component of innate immunity system in plants [79,80]. OsPR1a was strongly induced by X. oryzae with >45-fold induction at 48 h post pathogen infection (Figure 7), but to a much lower level by the fungal pathogen M. oryzae (Figure 6). This difference in the expression levels of OsPR1a in response to the two pathogens may lie in distinct temporal regulation of the gene by different signals. Previously, a study of OsPR1a expression at 36 h post infection, led the authors to conclude that OsPR1a is a rapid response gene to blast fungus infection [77]. The same study also reported OsPR1a expression to be induced by SA but suppressed by JA. We found OsPR1a expression to follow the same trend in response to SA and JA (Figure 8 and Figure 9), which authenticates the expression patterns we obtained for OsCBP60 genes.
The consistent upregulation of gene members belonging to the immunity subfamilies, albeit to different levels, in response to pathogens and SA strongly suggests that the OsCBP60 family is involved in rice defense responses. For example, OsCBP60a, CBP60g-3, -4, and OsSARDL-1 were induced by all three signals—fungal and bacterial pathogens and SA. Based on SA levels and gene expression in Arabidopsis mutants cpb60g and sard1, it was hypothesised that AtCBP60g plays a more significant role in the early defense response of the plant, while AtSARD1 functions at a later time [26]. The strong induction of OsCBP60g-5, -6 and -7 in response to M. oryzae infection and that of OsCBP60g -3 and -7 in response to X. oryzae at 12 h, as compared to the relatively lower level expression of SARD-like genes, could be taken to support the above stated hypothesis, but experimental verification will be required in the future to fully understand the co-operation between the OsCBP60g and OsSARD-like subfamilies.
SA and JA have both been shown to play roles in rice basal defense against fungal and bacterial pathogens [81]. However, there is little understanding of the role of SA biosynthesis in rice. Relative to Arabidopsis, rice accumulates high basal levels of SA, which do not undergo any significant changes in response to pathogen attack [82]. Nevertheless, a positive correlation exists between endogenous SA levels and the intensity of PAMP-triggered immunity, and mild increases in SA levels in rice confer broad range resistance without yield penalty [83]. Considering that pathogen-induced SA biosynthesis is co-ordinately regulated by AtCBP60g and AtSARD1 in Arabidopsis [27], how significant is the role of members of the expanded OsCBP60g and OsSARD-like subfamilies in SA biosynthesis is a question that will need to be addressed in the future.
The evidence for the growth hormone BR to play critical roles in plant immunity mechanisms continues to grow [10,84,85], including in rice [86]. BR regulates SA and JA biosynthesis and interacts with SA and JA signalling pathways [52,87,88,89]. The collective contribution and timing of these hormones during plant–pathogen interactions are crucial to determining plant immunity. The OsCBP60 genes responded to all three phytohormones. The upregulation of OsCBP60g-4, 3, OsCBP60a and OsSARDL-1 in order of fold-increases by SA, and the downregulation of the same and other OsCBP60 genes by JA is in line with the previously reported antagonistic interaction between SA and JA pathways [90]. The strong induction of OsCBP60g-6 and OsSARDL-2, followed by that of OsCBP60bcd-1, 3 by JA suggests that some members of the genes family may have evolved for conferring immunity via JA controlled defense signatures [91].
All OsCBP60 genes were found to be upregulated by EBR with highest induction in the following order: OsCBP60g-3, 4, 7, 1. Since the treatment with EBR was for 15 days, these expression patterns are likely to result from both primary and secondary responses of BR, with the latter likely involving SA and JA signalling. The presence of probable BES1- and BZR1-binding sites in the putative promoter regions of different OsCBP60 genes suggests that at least some of the genes may be direct targets of the two BR TFs.
In summary, the expanded and diversified CBP60 family in rice appears to be involved in immune system of this plant species through functioning as TFs whose activities may or may not be controlled by Ca2+/CaM. The combinatorial regulation of gene family members may be required to generate diverse expression patterns that may be effective against the several pathogens of rice.

5. Conclusions

A growing body of evidence suggests that the CBP60 family of proteins plays key roles in plant immune responses. The present study identified a 15 member CBP60 gene family in rice. The immunity-related clade II in rice comprises of 12 genes (OsCBP60a, OsCBP60g-1/OsSARDL, OsCBP60g-2-8 and OsSARDL1-3) as opposed to three genes (AtCBP60a, AtCBP60g and AtSARD1) in Arabidopsis, while the number of clade I genes in rice were reduced to three (OsCBP60bcd-1-3) from the five genes identified in Arabidopsis (AtCBP60b-f). In contrast to AtCBP60g, which has a CBD at its N-terminus, a CBD could not be identified in the OsCBP60g subfamily proteins. Although CaM-binding ability of OsCBP60g proteins needs experimental verification, it is possible that this group of proteins have evolved to function independently of Ca2+/CaM regulation. The upregulation of several members of the OsCBP60g subfamily, as well as of OsCBP60a and OsSARD-like in response to bacterial and fungal pathogens and SA and BR strongly suggests that OsCBP60 genes are involved in immune-related activities in rice. The significant expansion of immunity clade II, specifically of the OsCBP60g subfamily, suggests that the OsCBP60 gene family may be evolving for confering broad spectrum immunity in rice.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy12123060/s1, Supplementary Table S1: List of primers used for qRT-PCR analysis; Supplementary Table S2: Prediction of CBD in OsCBP60s; Supplementary Table S3: Analysis of transcription factor binding sites (TFBSs) in putative promoter sequences of OsCBP60s and AtCBP60s. The 1000 bp and 2000 bp upstream sequences of rice and Arabidopsis CBP60 genes were retrieved from Phytozome and TAIR, respectively. The CAMATA, TGACG and W-box binding sequences were identified using Plant PAN 3 software. The BES1 and BZR1 TFBSs were identified manually.

Author Contributions

B.D.P. and P.K. designed the research. D.K. and B.D.P. carried out research and analysed the data. H.M.N. generated the phylogenetic tree and helped in bioinformatics analysis. S.S. and B.D.P. did statistical analysis. B.D.P., P.K., D.K. and S.S. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The present work was supported by funds received from the Department of Atomic Energy (DAE), Board of Research in Nuclear Sciences (BRNS), Government of India (Grant No. 2013/20/35/BRNS1363).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

We acknowledge P.K. Singh, Institute of Agricultural sciences, BHU for providing germplasm accession IC-346004.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Romero, F.M.; Gatica-Arias, A. CRISPR/Cas9: Development and Application in Rice Breeding. Rice Sci. 2019, 26, 265–281. [Google Scholar] [CrossRef]
  2. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The Global Burden of Pathogens and Pests on Major Food Crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef]
  3. Fu, C. Genetic Improvement of Resistance to Blast and Bacterial Blight of the Elite Maintainer Line Rongfeng B in Hybrid Rice (Oryza sativa L.) by Using Marker-Assisted Selection. African J. Biotechnol. 2012, 11, 13104–13114. [Google Scholar] [CrossRef]
  4. Liu, W.; Wang, G.-L. Plant innate immunity in rice: A defense against pathogen infection. Nat. Sci. Rev. 2016, 3, 295–308. [Google Scholar] [CrossRef] [Green Version]
  5. Liu, T.; Song, T.; Zhang, X.; Yuan, H.; Su, L.; Li, W.; Xu, J.; Liu, S.; Chen, L.; Chen, T.; et al. Unconventionally Secreted Effectors of Two Filamentous Pathogens Target Plant Salicylate Biosynthesis. Nat. Commun. 2014, 5, 4686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Bari, R.; Jones, J.D.G. Role of Plant Hormones in Plant Defence Responses. Plant Mol. Biol. 2009, 69, 473–488. [Google Scholar] [CrossRef]
  7. Mohanta, T.K.; Bashir, T.; Hashem, A.; Abd_Allah, E.F.; Khan, A.L.; Al-Harrasi, A.S. Early Events in Plant Abiotic Stress Signaling: Interplay Between Calcium, Reactive Oxygen Species and Phytohormones. J. Plant Growth Regul. 2018, 37, 1033–1049. [Google Scholar] [CrossRef]
  8. Nguyen, H.; Thi Mai To, H.; Lebrun, M.; Bellafiore, S.; Champion, A. Jasmonates—the Master Regulator of Rice Development, Adaptation and Defense. Plants 2019, 8, 339. [Google Scholar] [CrossRef] [Green Version]
  9. Lozano-Durán, R.; Zipfel, C. Trade-off between Growth and Immunity: Role of Brassinosteroids. Trends Plant Sci. 2015, 20, 12–19. [Google Scholar] [CrossRef]
  10. Sahni, S.; Prasad, B.D.; Liu, Q.; Grbic, V.; Sharpe, A.; Singh, S.P.; Krishna, P. Overexpression of the Brassinosteroid Biosynthetic Gene DWF4 in Brassica Napus Simultaneously Increases Seed Yield and Stress Tolerance. Sci. Rep. 2016, 6, 28298. [Google Scholar] [CrossRef]
  11. Wang, J.; Shi, H.; Zhou, L.; Peng, C.; Liu, D.; Zhou, X.; Wu, W.; Yin, J.; Qin, H.; Ma, W.; et al. OsBSK1-2, an Orthologous of AtBSK1, Is Involved in Rice Immunity. Front. Plant Sci. 2017, 8, 908. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Zhang, W.; Zhu, K.; Wang, Z.; Zhang, H.; Gu, J.; Liu, L.; Yang, J.; Zhang, J. Brassinosteroids Function in Spikelet Differentiation and Degeneration in Rice. J. Integr. Plant Biol. 2019, 61, 943–963. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Yuan, D.P.; Zhang, C.; Wang, Z.Y.; Zhu, X.F.; Xuan, Y.H. RAVL1 Activates Brassinosteroids and Ethylene Signaling to Modulate Response to Sheath Blight Disease in Rice. Phytopathology 2018, 108, 1104–1113. [Google Scholar] [CrossRef] [Green Version]
  14. Yang, T.; Poovaiah, B. Calcium/Calmodulin-Mediated Signal Network in Plants. Trends Plant Sci. 2003, 8, 505–512. [Google Scholar] [CrossRef] [PubMed]
  15. Hetherington, A.M.; Brownlee, C. THE GENERATION OF Ca2+ SIGNALS IN PLANTS. Annu. Rev. Plant Biol. 2004, 55, 401–427. [Google Scholar] [CrossRef] [Green Version]
  16. Whalley, H.J.; Knight, M.R. Calcium Signatures Are Decoded by Plants to Give Specific Gene Responses. New Phytol. 2013, 197, 690–693. [Google Scholar] [CrossRef]
  17. DeFalco, T.A.; Bender, K.W.; Snedden, W.A. Breaking the Code: Ca2+ Sensors in Plant Signalling. Biochem. J. 2010, 425, 27–40. [Google Scholar] [CrossRef] [Green Version]
  18. Bouché, N.; Yellin, A.; Snedden, W.A.; Fromm, H. Plant-Specific Calmodulin-Binding Proteins. Annu. Rev. Plant Biol. 2005, 56, 435–466. [Google Scholar] [CrossRef]
  19. Virdi, A.S.; Singh, S.; Singh, P. Abiotic Stress Responses in Plants: Roles of Calmodulin-Regulated Proteins. Front. Plant Sci. 2015, 6, 809. [Google Scholar] [CrossRef] [Green Version]
  20. Tidow, H.; Nissen, P. Structural Diversity of Calmodulin Binding to Its Target Sites. FEBS J. 2013, 280, 5551–5565. [Google Scholar] [CrossRef]
  21. Andrews, C.; Xu, Y.; Kirberger, M.; Yang, J.J. Structural Aspects and Prediction of Calmodulin-Binding Proteins. Int. J. Mol. Sci. 2020, 22, 308. [Google Scholar] [CrossRef] [PubMed]
  22. Zielinski, R.E. Calmodulin and Calmodulin-Binding Proteins in Plants. Annu. Rev. Plant Biol. 1998, 49, 697–725. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Poovaiah, B.W.; Du, L.; Wang, H.; Yang, T. Recent Advances in Calcium/Calmodulin-Mediated Signaling with an Emphasis on Plant-Microbe Interactions. Plant Physiol. 2013, 163, 531–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Wan, D.; Li, R.; Zou, B.; Zhang, X.; Cong, J.; Wang, R.; Xia, Y.; Li, G. Calmodulin-Binding Protein CBP60g Is a Positive Regulator of Both Disease Resistance and Drought Tolerance in Arabidopsis. Plant Cell Rep. 2012, 31, 1269–1281. [Google Scholar] [CrossRef] [PubMed]
  25. Truman, W.; Sreekanta, S.; Lu, Y.; Bethke, G.; Tsuda, K.; Katagiri, F.; Glazebrook, J. The CALMODULIN-BINDING PROTEIN60 Family Includes Both Negative and Positive Regulators of Plant Immunity. PLANT Physiol. 2013, 163, 1741–1751. [Google Scholar] [CrossRef] [Green Version]
  26. Wang, L.; Tsuda, K.; Truman, W.; Sato, M.; Nguyen, L.V.; Katagiri, F.; Glazebrook, J. CBP60g and SARD1 Play Partially Redundant Critical Roles in Salicylic Acid Signaling. Plant J. 2011, 67, 1029–1041. [Google Scholar] [CrossRef] [PubMed]
  27. Sun, T.; Zhang, Y.; Li, Y.; Zhang, Q.; Ding, Y.; Zhang, Y. ChIP-Seq Reveals Broad Roles of SARD1 and CBP60g in Regulating Plant Immunity. Nat. Commun. 2015, 6, 10159. [Google Scholar] [CrossRef] [Green Version]
  28. Wang, L.; Tsuda, K.; Sato, M.; Cohen, J.D.; Katagiri, F.; Glazebrook, J. Arabidopsis CaM Binding Protein CBP60g Contributes to MAMP-Induced SA Accumulation and Is Involved in Disease Resistance against Pseudomonas syringae. PLoS Pathog. 2009, 5, e1000301. [Google Scholar] [CrossRef] [Green Version]
  29. Li, L.-S.; Ying, J.; Li, E.; Ma, T.; Li, M.; Gong, L.-M.; Wei, G.; Zhang, Y.; Li, S. Arabidopsis CBP60b Is a Central Transcriptional Activator of Immunity. Plant Physiol. 2021, 186, 1645–1659. [Google Scholar] [CrossRef]
  30. Hu, G.; Hao, M.; Wang, L.; Liu, J.; Zhang, Z.; Tang, Y.; Peng, Q. The Cotton MiR477- CBP60A Module Participates in Plant Defense Against Verticillium dahlia. Mol. Plant-Microbe Interact. 2020, 33, 624–636. [Google Scholar] [CrossRef]
  31. Zheng, Q.; Majsec, K.; Katagiri, F. Pathogen-driven Coevolution across the CBP60 Plant Immune Regulator Subfamilies Confers Resilience on the Regulator Module. New Phytol. 2022, 233, 479–495. [Google Scholar] [CrossRef] [PubMed]
  32. Kim, Y.; Park, S.; Gilmour, S.J.; Thomashow, M.F. Roles of CAMTA Transcription Factors and Salicylic Acid in Configuring the Low-Temperature Transcriptome and Freezing Tolerance of Arabidopsis. Plant J. 2013, 75, 364–376. [Google Scholar] [CrossRef]
  33. Yu, Q.; Liu, Y.-L.; Sun, G.-Z.; Liu, Y.-X.; Chen, J.; Zhou, Y.-B.; Chen, M.; Ma, Y.-Z.; Xu, Z.-S.; Lan, J.-H. Genome-Wide Analysis of the Soybean Calmodulin-Binding Protein 60 Family and Identification of GmCBP60A-1 Responses to Drought and Salt Stresses. Int. J. Mol. Sci. 2021, 22, 13501. [Google Scholar] [CrossRef]
  34. Sun, Y.; Fan, X.-Y.; Cao, D.-M.; Tang, W.; He, K.; Zhu, J.-Y.; He, J.-X.; Bai, M.-Y.; Zhu, S.; Oh, E.; et al. Integration of Brassinosteroid Signal Transduction with the Transcription Network for Plant Growth Regulation in Arabidopsis. Dev. Cell 2010, 19, 765–777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Yu, X.; Li, L.; Zola, J.; Aluru, M.; Ye, H.; Foudree, A.; Guo, H.; Anderson, S.; Aluru, S.; Liu, P.; et al. A Brassinosteroid Transcriptional Network Revealed by Genome-Wide Identification of BESI Target Genes in Arabidopsis Thaliana. Plant J. 2011, 65, 634–646. [Google Scholar] [CrossRef] [PubMed]
  36. Bonman, J.M. Durable Resistance to Rice Blast. Oryza 1988, 25, 103–110. [Google Scholar]
  37. Jha, S.; Tank, H.G.; Prasad, B.D.; Chattoo, B.B. Expression of Dm-AMP1 in Rice Confers Resistance to Magnaporthe oryzae and Rhizoctonia solani. Transgenic Res. 2009, 18, 59–69. [Google Scholar] [CrossRef]
  38. Prasad, B.D.; Creissen, G.; Lamb, C.; Chattoo, B.B. Overexpression of Rice (Oryza sativa L.) OsCDR1 Leads to Constitutive Activation of Defense Responses in Rice and Arabidopsis. Mol. Plant-Microbe Interact. 2009, 22, 1635–1644. [Google Scholar] [CrossRef] [Green Version]
  39. Kumari, D.; Parasad, B.D.; Sahni, S.; Ghatak, A. Identification and Functional Characterization of Xanthomonas oryzae Pv. oryzae Isolates. Curr. J. Appl. Sci. Technol. 2020, 78–84. [Google Scholar] [CrossRef] [Green Version]
  40. Tran, T.T.; Pérez-Quintero, A.L.; Wonni, I.; Carpenter, S.C.D.; Yu, Y.; Wang, L.; Leach, J.E.; Verdier, V.; Cunnac, S.; Bogdanove, A.J.; et al. Functional Analysis of African Xanthomonas oryzae Pv. oryzae TALomes Reveals a New Susceptibility Gene in Bacterial Leaf Blight of Rice. PLOS Pathog. 2018, 14, e1007092. [Google Scholar] [CrossRef]
  41. Kauffman, H.E. An Improved Technique for Evaluating Resistance of Rice Varieties to Xanthomonas oryzae. Plant Dis. Rep. 1973, 57, 537–541. [Google Scholar]
  42. Yamada, S.; Kano, A.; Tamaoki, D.; Miyamoto, A.; Shishido, H.; Miyoshi, S.; Taniguchi, S.; Akimitsu, K.; Gomi, K. Involvement of OsJAZ8 in Jasmonate-Induced Resistance to Bacterial Blight in Rice. Plant Cell Physiol. 2012, 53, 2060–2072. [Google Scholar] [CrossRef]
  43. Prasad, B.D.; Sahni, S.; Krishna, P.; Kumari, D.; Mahato, A.K.; Jambhulkar, S.J.; Kumar, P.; Ranjan, T.; Pal, A.K. De Novo Transcriptome Assembly and Identification of Brassinosteroid Biosynthetic Pathway in Safflower. J. Plant Growth Regul. 2022, 41, 1854–1870. [Google Scholar] [CrossRef]
  44. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  45. Reddy, V.S.; Ali, G.S.; Reddy, A.S.N. Genes Encoding Calmodulin-binding Proteins in the Arabidopsis Genome* 210. J. Biol. Chem. 2002, 277, 9840–9852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. O’Neil, K.T.; DeGrado, W.F. How Calmodulin Binds Its Targets: Sequence Independent Recognition of Amphiphilic α-Helices. Trends Biochem. Sci. 1990, 15, 59–64. [Google Scholar] [CrossRef]
  47. Zhang, Y.; Xu, S.; Ding, P.; Wang, D.; Cheng, Y.T.; He, J.; Gao, M.; Xu, F.; Li, Y.; Zhu, Z.; et al. Control of Salicylic Acid Synthesis and Systemic Acquired Resistance by Two Members of a Plant-Specific Family of Transcription Factors. Proc. Natl. Acad. Sci. USA 2010, 107, 18220–18225. [Google Scholar] [CrossRef] [Green Version]
  48. Yuan, P.; Jauregui, E.; Du, L.; Tanaka, K.; Poovaiah, B. Calcium Signatures and Signaling Events Orchestrate Plant–Microbe Interactions. Curr. Opin. Plant Biol. 2017, 38, 173–183. [Google Scholar] [CrossRef]
  49. Li, Z.K.; Arif, M.; Zhong, D.B.; Fu, B.Y.; Xu, J.L.; Domingo-Rey, J.; Ali, J.; Vijayakumar, C.H.M.; Yu, S.B.; Khush, G.S. Complex Genetic Networks Underlying the Defensive System of Rice (Oryza sativa L.) to Xanthomonas oryzae Pv. oryzae. Proc. Natl. Acad. Sci. USA 2006, 103, 7994–7999. [Google Scholar] [CrossRef] [Green Version]
  50. Kong, W.; Ding, L.; Xia, X. Identification and Characterization of Genes Frequently Responsive to Xanthomonas oryzae pv. oryzae and Magnaporthe oryzae Infections in Rice. BMC Genomics 2020, 21, 21. [Google Scholar] [CrossRef]
  51. Robert-Seilaniantz, A.; Grant, M.; Jones, J.D.G. Hormone Crosstalk in Plant Disease and Defense: More Than Just JASMONATE-SALICYLATE Antagonism. Annu. Rev. Phytopathol. 2011, 49, 317–343. [Google Scholar] [CrossRef]
  52. Divi, U.K.; Rahman, T.; Krishna, P. Brassinosteroid-Mediated Stress Tolerance in Arabidopsis Shows Interactions with Abscisic Acid, Ethylene and Salicylic Acid Pathways. BMC Plant Biol. 2010, 10, 151. [Google Scholar] [CrossRef] [PubMed]
  53. Sun, T.; Busta, L.; Zhang, Q.; Ding, P.; Jetter, R.; Zhang, Y. TGACG-BINDING FACTOR 1 (TGA1) and TGA4 Regulate Salicylic Acid and Pipecolic Acid Biosynthesis by Modulating the Expression of Systemic Acquired Resistance Deficient 1 (SARD1) and CALMODULIN-BINDING PROTEIN 60g (CBP60g). New Phytol. 2018, 217, 344–354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Zhou, M.; Lu, Y.; Bethke, G.; Harrison, B.T.; Hatsugai, N.; Katagiri, F.; Glazebrook, J. WRKY70 Prevents Axenic Activation of Plant Immunity by Direct Repression of SARD1. New Phytol. 2018, 217, 700–712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Sun, T.; Huang, J.; Xu, Y.; Verma, V.; Jing, B.; Sun, Y.; Ruiz Orduna, A.; Tian, H.; Huang, X.; Xia, S.; et al. Redundant CAMTA Transcription Factors Negatively Regulate the Biosynthesis of Salicylic Acid and N-Hydroxypipecolic Acid by Modulating the Expression of SARD1 and CBP60g. Mol. Plant 2020, 13, 144–156. [Google Scholar] [CrossRef] [PubMed]
  56. Xiong, J.; Wan, X.; Ran., M.; Xu, X.; Chen, L.; Yang, F. Brassinosteroids Positively Regulate Plant Immunity via BRI1-EMS-SUPPRESSOR 1-Mediated GLUCAN SYNTHASE-LIKE 8 Transcription. Front. Plant Sci. 2022, 13, 854899. [Google Scholar] [CrossRef]
  57. Du, L.; Poovaiah, B.W. Ca2+/Calmodulin Is Critical for Brassinosteroid Biosynthesis and Plant Growth. Nature 2005, 437, 741–745. [Google Scholar] [CrossRef]
  58. Ranty, B.; Aldon, D.; Galaud, J.-P. Plant Calmodulins and Calmodulin-Related Proteins. Plant Signal. Behav. 2006, 1, 96–104. [Google Scholar] [CrossRef] [Green Version]
  59. Pallegar, P.; Priti Krishna, S. Functional Analysis of Two Brassinosteroid Responsive, Putative Calmodulin-Binding Proteins 60 (CBP60S) in Arabidopsis Thaliana Graduate Program in Biology. Ph.D. Thesis, The University of Western Ontario, London, ON, Canada, 2014. [Google Scholar]
  60. Singh, A.K.; Singh, P.K.; Arya, M.; Singh, N.K.; Singh, U.S. Molecular Screening of Blast Resistance Genes in Rice Using SSR Markers. Plant Pathol. J. 2015, 31, 12–24. [Google Scholar] [CrossRef] [Green Version]
  61. Mao, C.; Wang, S.; Jia, Q.; Wu, P. OsEIL1, a Rice Homolog of the Arabidopsis EIN3 Regulates the Ethylene Response as a Positive Component. Plant Mol. Biol. 2006, 61, 141–152. [Google Scholar] [CrossRef]
  62. Zhou, J.-M.; Zhang, Y. Plant Immunity: Danger Perception and Signaling. Cell 2020, 181, 978–989. [Google Scholar] [CrossRef]
  63. Hilleary, R.; Paez-Valencia, J.; Vens, C.; Toyota, M.; Palmgren, M.; Gilroy, S. Tonoplast-Localized Ca2+ Pumps Regulate Ca2+ Signals during Pattern-Triggered Immunity in Arabidopsis Thaliana. Proc. Natl. Acad. Sci. USA 2020, 117, 18849–18857. [Google Scholar] [CrossRef] [PubMed]
  64. Lecourieux, D.; Ranjeva, R.; Pugin, A. Calcium in Plant Defence-signalling Pathways. New Phytol. 2006, 171, 249–269. [Google Scholar] [CrossRef] [PubMed]
  65. Grant, M.; Brown, I.; Adams, S.; Knight, M.; Ainslie, A.; Mansfield, J. The RPM1 Plant Disease Resistance Gene Facilitates a Rapid and Sustained Increase in Cytosolic Calcium That Is Necessary for the Oxidative Burst and Hypersensitive Cell Death. Plant J. 2000, 23, 441–450. [Google Scholar] [CrossRef] [PubMed]
  66. Du, L.; Ali, G.S.; Simons, K.A.; Hou, J.; Yang, T.; Reddy, A.S.N.; Poovaiah, B.W. Ca2+/Calmodulin Regulates Salicylic-Acid-Mediated Plant Immunity. Nature 2009, 457, 1154–1158. [Google Scholar] [CrossRef] [PubMed]
  67. Vlot, A.C.; Dempsey, D.A.; Klessig, D.F. Salicylic Acid, a Multifaceted Hormone to Combat Disease. Annu. Rev. Phytopathol. 2009, 47, 177–206. [Google Scholar] [CrossRef] [Green Version]
  68. Wang, J.; Liu, X.; Zhang, A.; Ren, Y.; Wu, F.; Wang, G.; Xu, Y.; Lei, C.; Zhu, S.; Pan, T.; et al. A Cyclic Nucleotide-Gated Channel Mediates Cytoplasmic Calcium Elevation and Disease Resistance in Rice. Cell Res. 2019, 29, 820–831. [Google Scholar] [CrossRef] [PubMed]
  69. Boonburapong, B.; Buaboocha, T. Genome-Wide Identification and Analyses of the Rice Calmodulin and Related Potential Calcium Sensor Proteins. BMC Plant Biol. 2007, 7, 2229. [Google Scholar] [CrossRef] [Green Version]
  70. Chinpongpanich, A.; Phean-O-Pas, S.; Thongchuang, M.; Qu, L.-J.; Buaboocha, T. C-Terminal Extension of Calmodulin-like 3 Protein from Oryza sativa L.: Interaction with a High Mobility Group Target Protein. Acta Biochim. Biophys. Sin. 2015, 47, 880–889. [Google Scholar] [CrossRef] [Green Version]
  71. Choi, M.S.; Kim, M.C.; Yoo, J.H.; Moon, B.C.; Koo, S.C.; Park, B.O.; Lee, J.H.; Koo, Y.D.; Han, H.J.; Lee, S.Y.; et al. Isolation of a Calmodulin-Binding Transcription Factor from Rice (Oryza sativa L.). J. Biol. Chem. 2005, 280, 40820–40831. [Google Scholar] [CrossRef] [Green Version]
  72. Chung, J.-S.; Koo, S.C.; Jin, B.J.; Baek, D.; Yeom, S.-I.; Chun, H.J.; Choi, M.S.; Cho, H.M.; Lee, S.H.; Jung, W.-H.; et al. Rice CaM-Binding Transcription Factor (OsCBT) Mediates Defense Signaling via Transcriptional Reprogramming. Plant Biotechnol. Rep. 2020, 14, 309–321. [Google Scholar] [CrossRef]
  73. Gain, H.; Nandi, D.; Kumari, D.; Das, A.; Dasgupta, S.B.; Banerjee, J. Genome-wide Identification of CAMTA Gene Family Members in Rice (Oryza sativa L.) and in Silico Study on Their Versatility in Respect to Gene Expression and Promoter Structure. Funct. Integr. Genomics 2022, 22, 193–214. [Google Scholar] [CrossRef]
  74. Wang, Y.; Shen, C.; Jiang, Q.; Wan, Z.; Gao, C.; Wang, W. Seed priming with calcium chloride enhances stress tolerance in rice seedlings. Plant Sci. 2022, 323, 111381. [Google Scholar] [CrossRef] [PubMed]
  75. Huang, W.; Wu, Z.; Tian, H.; Li, X.; Zhang, Y. Arabidopsis CALMODULIN-BINDING PROTEIN 60b Plays Dual Roles in Plant Immunity. Plant Commun. 2021, 2, 100213. [Google Scholar] [CrossRef] [PubMed]
  76. Agrawal, G.K.; Rakwal, R.; Jwa, N.-S. Differential Induction of Three Pathogenesis-Related Genes, PR10, PR1b and PR5 by the Ethylene Generator Ethephon under Light and Dark in Rice (Oryza sativa L.) Seedlings. J. Plant Physiol. 2001, 158, 133–137. [Google Scholar] [CrossRef]
  77. Mitsuhara, I.; Iwai, T.; Seo, S.; Yanagawa, Y.; Kawahigasi, H.; Hirose, S.; Ohkawa, Y.; Ohashi, Y. Characteristic Expression of Twelve Rice PR1 Family Genes in Response to Pathogen Infection, Wounding, and Defense-Related Signal Compounds (121/180). Mol. Genet. Genomics 2008, 279, 415–427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  78. Matić, S.; Bagnaresi, P.; Biselli, C.; Orru’, L.; Amaral Carneiro, G.; Siciliano, I.; Valé, G.; Gullino, M.L.; Spadaro, D. Comparative Transcriptome Profiling of Resistant and Susceptible Rice Genotypes in Response to the Seedborne Pathogen Fusarium Fujikuroi. BMC Genomics 2016, 17, 608. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  79. Rasmussen, M.W.; Roux, M.; Petersen, M.; Mundy, J. MAP Kinase Cascades in Arabidopsis Innate Immunity. Front. Plant Sci. 2012, 3, 169. [Google Scholar] [CrossRef] [Green Version]
  80. Ali, S.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Chandrashekar, N.; Yadav, P.; Rawat, S.; Sultana, M.; Grover, A. Isolation and Characterization of Systemic Acquired Resistance Marker Gene PR1 and Its Promoter from Brassica Juncea. 3 Biotech 2018, 8, 10. [Google Scholar] [CrossRef]
  81. Yang, D.-L.; Yang, Y.; He, Z. Roles of Plant Hormones and Their Interplay in Rice Immunity. Mol. Plant 2013, 6, 675–685. [Google Scholar] [CrossRef] [Green Version]
  82. Silverman, P.; Seskar, M.; Kanter, D.; Schweizer, P.; Metraux, J.P.; Raskin, I. Salicylic Acid in Rice (Biosynthesis, Conjugation, and Possible Role). Plant Physiol. 1995, 108, 633–639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Zhang, Y.; Yu, Q.; Gao, S.; Yu, N.; Zhao, L.; Wang, J.; Zhao, J.; Huang, P.; Yao, L.; Wang, M.; et al. Disruption of the Primary Salicylic Acid Hydroxylases in Rice Enhances Broad-spectrum Resistance against Pathogens. Plant. Cell Environ. 2022, 45, 2211–2225. [Google Scholar] [CrossRef] [PubMed]
  84. Ortiz-Morea, F.A.; He, P.; Shan, L.; Russinova, E. It Takes Two to Tango—Molecular Links between Plant Immunity and Brassinosteroid Signalling. J. Cell Sci. 2020, 133. [Google Scholar] [CrossRef] [PubMed]
  85. Qi, G.; Chen, H.; Wang, D.; Zheng, H.; Tang, X.; Guo, Z.; Cheng, J.; Chen, J.; Wang, Y.; Bai, M.; et al. The BZR1-EDS1 ModuleRegulates Plant Growth-Defense Coordination. Mol. Plant 2021, 14, 2072–2087. [Google Scholar] [CrossRef]
  86. Ahmad, F.; Singh, A.; Kamal, A. Crosstalk of Brassinosteroids with Other Phytohormones under Various Abiotic Stresses. J. Appl. Biol. Biotechnol. 2018, 6. [Google Scholar] [CrossRef]
  87. Divi, U.K.; Rahman, T.; Krishna, P. Gene Expression and Functional Analyses in Brassinosteroid-Mediated Stress Tolerance. Plant Biotechnol. J. 2016, 14, 419–432. [Google Scholar] [CrossRef]
  88. Peres, A.; Soares, J.; Tavares, R.; Righetto, G.; Zullo, M.; Mandava, N.; Menossi, M. Brassinosteroids, the Sixth Class of Phytohormones: A Molecular View from the Discovery to Hormonal Interactions in Plant Development and Stress Adaptation. Int. J. Mol. Sci. 2019, 20, 331. [Google Scholar] [CrossRef] [Green Version]
  89. Pan, G.; Liu, Y.; Ji, L.; Zhang, X.; He, J.; Huang, J.; Qiu, Z.; Liu, D.; Sun, Z.; Xu, T.; et al. Brassinosteroids Mediate Susceptibility to Brown Planthopper by Integrating with the Salicylic Acid and Jasmonic Acid Pathways in Rice. J. Exp. Bot. 2018, 69, 4433–4442. [Google Scholar] [CrossRef] [Green Version]
  90. Hu, P.; Zhou, W.; Cheng, Z.; Fan, M.; Wang, L.; Xie, D. JAV1 Controls Jasmonate-Regulated Plant Defense. Mol. Cell 2013, 50, 504–515. [Google Scholar] [CrossRef] [Green Version]
  91. Gupta, A.; Bhardwaj, M.; Tran, L.-S.P. Jasmonic Acid at the Crossroads of Plant Immunity and Pseudomonas Syringae Virulence. Int. J. Mol. Sci. 2020, 21, 7482. [Google Scholar] [CrossRef]
Agronomy 12 03060 g001 550
Figure 1. Phylogenetic tree showing relationships of the CBP60 proteins of rice and Arabidopsis. AtCBP60 and OsCBP60 sequences were obtained from TAIR and Phytozome 11, respectively. Phylogenetic tree was generated by the neighbor-joining method using MEGA7 software after alignment of the CBP60 sequences using MUSCLE. The tree was rooted with the moss homologue Phpat.002G082900. Bootstrap values from 500 replicates are shown at each node. The scale bar indicates 0.1 amino acid substitutions per site. Clade I and II and their sub-clades are indicated on the right.
Figure 1. Phylogenetic tree showing relationships of the CBP60 proteins of rice and Arabidopsis. AtCBP60 and OsCBP60 sequences were obtained from TAIR and Phytozome 11, respectively. Phylogenetic tree was generated by the neighbor-joining method using MEGA7 software after alignment of the CBP60 sequences using MUSCLE. The tree was rooted with the moss homologue Phpat.002G082900. Bootstrap values from 500 replicates are shown at each node. The scale bar indicates 0.1 amino acid substitutions per site. Clade I and II and their sub-clades are indicated on the right.
Agronomy 12 03060 g001
Agronomy 12 03060 g002 550
Figure 2. Gene structure analysis comparing the exon-intron structure, and the position of predicted Calmodulin-binding domain (CBD) and DNA-binding domain (DBD) encoding regions of rice OsCBP60 proteins, with that of a root sequence from Physcomitrella patens. The figure was created using the Gene Structure Display Server (GSDS 2.0).
Figure 2. Gene structure analysis comparing the exon-intron structure, and the position of predicted Calmodulin-binding domain (CBD) and DNA-binding domain (DBD) encoding regions of rice OsCBP60 proteins, with that of a root sequence from Physcomitrella patens. The figure was created using the Gene Structure Display Server (GSDS 2.0).
Agronomy 12 03060 g002
Agronomy 12 03060 g003 550
Figure 3. Multiple sequence alignment of the predicted CBDs of AtCBP60b, c, d, e, and f and their putative rice orthologs OsCBP60bcd -1, 2, and 3. The alignment was carried out in CLUSTAL Omega and displayed using Boxshade. The underlined sequence indicates the CBD in Arabidopsis proteins. Black shading indicates residues conserved in over 50% of the sequences; grey shading indicates semi-conservative substitutions while no shading indicates the lack of any similarity.
Figure 3. Multiple sequence alignment of the predicted CBDs of AtCBP60b, c, d, e, and f and their putative rice orthologs OsCBP60bcd -1, 2, and 3. The alignment was carried out in CLUSTAL Omega and displayed using Boxshade. The underlined sequence indicates the CBD in Arabidopsis proteins. Black shading indicates residues conserved in over 50% of the sequences; grey shading indicates semi-conservative substitutions while no shading indicates the lack of any similarity.
Agronomy 12 03060 g003
Agronomy 12 03060 g004 550
Figure 4. Identification of a CBD in OsCBP60a. (a) Multiple sequence alignment (Clustal Omega) of the C-terminus localised CBD of AtCBP60a with the loosely conserved region in the C-termius of OsCBP60a protein. Identical amino acids are indicated by a star, strongly conserved groups by double dots, and weakly conserved groups by dots. The highlighted region in the CBD of AtCBP60a is predicted to form the amphipathic helix shown in (b). The overlined residues in AtCBP60a contribute to CBD as determined by mutagenesis [25], while the underlined region in OsCBP60a indicates the predicted CBD. (b) Prediction of amphipathic helix in AtCBP60a and OsCBP60a by the Heliquest algorithm. Both proteins show the presence of an amphiphilic alpha helix with majority of positively charged residues lying on one face of the helix.
Figure 4. Identification of a CBD in OsCBP60a. (a) Multiple sequence alignment (Clustal Omega) of the C-terminus localised CBD of AtCBP60a with the loosely conserved region in the C-termius of OsCBP60a protein. Identical amino acids are indicated by a star, strongly conserved groups by double dots, and weakly conserved groups by dots. The highlighted region in the CBD of AtCBP60a is predicted to form the amphipathic helix shown in (b). The overlined residues in AtCBP60a contribute to CBD as determined by mutagenesis [25], while the underlined region in OsCBP60a indicates the predicted CBD. (b) Prediction of amphipathic helix in AtCBP60a and OsCBP60a by the Heliquest algorithm. Both proteins show the presence of an amphiphilic alpha helix with majority of positively charged residues lying on one face of the helix.
Agronomy 12 03060 g004
Agronomy 12 03060 g005 550
Figure 5. Multiple sequence alignment of the DBDs of AtCBP60g and AtSARD1 proteins with similar regions of OsCBP60g and OsSARDL proteins. The boxed residues indicate the DBD in AtCBP60g and AtSARD1 [47]. The alignment was carried out in CLUSTAL Omega accessed and displayed using Boxshade. Black shading indicates residues conserved in over 50% of the sequences; grey shading indicates semi-conservative substitutions; and the unshaded residues show no similarity.
Figure 5. Multiple sequence alignment of the DBDs of AtCBP60g and AtSARD1 proteins with similar regions of OsCBP60g and OsSARDL proteins. The boxed residues indicate the DBD in AtCBP60g and AtSARD1 [47]. The alignment was carried out in CLUSTAL Omega accessed and displayed using Boxshade. Black shading indicates residues conserved in over 50% of the sequences; grey shading indicates semi-conservative substitutions; and the unshaded residues show no similarity.
Agronomy 12 03060 g005
Agronomy 12 03060 g006 550
Figure 6. Transcriptional response of OsCBP60 genes in rice seedlings infected with M. oryzae. Rice seedlings were infected with the spores of M. oryzae and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post infection. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a expression served as a positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Figure 6. Transcriptional response of OsCBP60 genes in rice seedlings infected with M. oryzae. Rice seedlings were infected with the spores of M. oryzae and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post infection. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a expression served as a positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Agronomy 12 03060 g006
Agronomy 12 03060 g007 550
Figure 7. Transcriptional response of OsCBP60 genes in rice seedlings infected with X. oryzae pv. oryzae. Rice seedlings were infected with X. oryzae and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post infection. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a expression served as a positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Figure 7. Transcriptional response of OsCBP60 genes in rice seedlings infected with X. oryzae pv. oryzae. Rice seedlings were infected with X. oryzae and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post infection. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a expression served as a positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Agronomy 12 03060 g007
Agronomy 12 03060 g008 550
Figure 8. Transcriptional response of OsCBP60 genes in rice seedlings treated with salicylic acid (SA). Rice seedlings were treated with SA (3 mM sodium salicylate) and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post treatment. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a expression served as a positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Figure 8. Transcriptional response of OsCBP60 genes in rice seedlings treated with salicylic acid (SA). Rice seedlings were treated with SA (3 mM sodium salicylate) and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post treatment. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a expression served as a positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Agronomy 12 03060 g008
Agronomy 12 03060 g009 550
Figure 9. Transcriptional response of OsCBP60 genes in rice seedlings treated with jasmonic acid (JA). Rice seedlings were treated with 100 µM JA and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post treatment. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a was used as a control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Figure 9. Transcriptional response of OsCBP60 genes in rice seedlings treated with jasmonic acid (JA). Rice seedlings were treated with 100 µM JA and transcript levels were analyzed by qRT-PCR at 12, 24 and 48 h post treatment. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. OsPR1a was used as a control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Agronomy 12 03060 g009
Agronomy 12 03060 g010 550
Figure 10. Transcriptional response of OsCBP60 genes in rice seedlings treated with brassinosteroid. Rice seedlings were grown for 15 days on MS medium supplemented with 1 µM EBR. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. Since EBR enhanced AtPR1 expression [52], OsPR1a expression was studied as a probable positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Figure 10. Transcriptional response of OsCBP60 genes in rice seedlings treated with brassinosteroid. Rice seedlings were grown for 15 days on MS medium supplemented with 1 µM EBR. Relative transcript abundance (expression value) is expressed as fold-change relative to the mock treatment. Since EBR enhanced AtPR1 expression [52], OsPR1a expression was studied as a probable positive control. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Agronomy 12 03060 g010
Agronomy 12 03060 g011 550
Figure 11. (a) Transcriptional response of OsCBP60g-4 in uninfected leaves of IC-346004 and Rajendra Kasturi rice seedlings grown under controlled conditions. Relative transcript abundance (Expression value) of OsCBP60g-4 is expressed as fold-change in IC-346004 relative to Rajendra Kasturi. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Different lower-case letters indicate statistically significant differences (p < 0.05) by one-way ANOVA-protected LSD test. (b) Transcriptional response of OsCBP60g-4 in leaves of rice genotypes Pusa Basmati-1, IRBB-55 and Tetap infected with X. oryzae pv. oryzae at 6, 12 and 24 h post infection. Relative transcript abundance (Expression value) is expressed as fold-change relative to the mock treatment. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Figure 11. (a) Transcriptional response of OsCBP60g-4 in uninfected leaves of IC-346004 and Rajendra Kasturi rice seedlings grown under controlled conditions. Relative transcript abundance (Expression value) of OsCBP60g-4 is expressed as fold-change in IC-346004 relative to Rajendra Kasturi. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Different lower-case letters indicate statistically significant differences (p < 0.05) by one-way ANOVA-protected LSD test. (b) Transcriptional response of OsCBP60g-4 in leaves of rice genotypes Pusa Basmati-1, IRBB-55 and Tetap infected with X. oryzae pv. oryzae at 6, 12 and 24 h post infection. Relative transcript abundance (Expression value) is expressed as fold-change relative to the mock treatment. Results are representative of three independent experiments. Error bars represent standard error (SE) of mean for three replicates. Superscripts with the same letter are not significantly different (p < 0.05) by one-way ANOVA-protected LSD test.
Agronomy 12 03060 g011
Agronomy 12 03060 g012 550
Figure 12. In silico analysis of the putative promoter regions of OsCBP60g-4 in M. oryzae resistant and susceptible rice genotypes. A 1000 bp upstream region of OsCBP60g-4 gene from each genotype, Rajendra Kasturi (indica rice genotype susceptible to M. oryzae) and IC-346004 (indica rice accession resistant to M. oryzae), was amplified and sequenced. Multiple sequence alignment of reference sequences (Nipponbare; AP014967.1) available in NCBI was performed to identify SNPs. The SNPs associated with TF binding sites are highlighted in different colours and shown in circles. The red colour stars (*) indicate conserved residues in both sequences.
Figure 12. In silico analysis of the putative promoter regions of OsCBP60g-4 in M. oryzae resistant and susceptible rice genotypes. A 1000 bp upstream region of OsCBP60g-4 gene from each genotype, Rajendra Kasturi (indica rice genotype susceptible to M. oryzae) and IC-346004 (indica rice accession resistant to M. oryzae), was amplified and sequenced. Multiple sequence alignment of reference sequences (Nipponbare; AP014967.1) available in NCBI was performed to identify SNPs. The SNPs associated with TF binding sites are highlighted in different colours and shown in circles. The red colour stars (*) indicate conserved residues in both sequences.
Agronomy 12 03060 g012
Table
Table 1. Full list of OsCBP60 gene loci with proposed systematic names, predicted subcellular localization, and location of CBD in OsCBP60 proteins.
Table 1. Full list of OsCBP60 gene loci with proposed systematic names, predicted subcellular localization, and location of CBD in OsCBP60 proteins.
S.No.Gene IDProposed NamePredicted Localisation aPredicted CBD (Consensus *)
1LOC_Os02g08120OsCBP60bcd-1NucleusC-terminus
2LOC_Os02g35470OsCBP60bcd-2NucleusC-terminus
3LOC_Os04g36660OsCBP60bcd-3NucleusC-terminus
4LOC_Os03g32160OsCBP60aNucleusC-terminus
5LOC_Os01g04280OsSARDL-1Nucleusnone
6LOC_Os08g27170OsSARDL-2Nucleusnone
7LOC_Os09g13890OsSARDL-3Nucleusnone
8LOC_Os03g18960OsCBP60g-1/OsSARDLNucleusnone
9LOC_Os03g56660OsCBP60g-2Nucleusnone
10LOC_Os11g44600OsCBP60g-3Nucleusnone
11LOC_Os11g44680OsCBP60g-4Chloroplastnone
12LOC_Os12g36110OsCBP60g-5Nucleusnone
13LOC_Os12g36910OsCBP60g-6Nucleusnone
14LOC_Os12g36920OsCBP60g-7Nucleusnone
15LOC_Os12g36940OsCBP60g-8Nucleusnone
a Subcellular localization predictions by BaCelLo tool. * Full details of CBD prediction results in Supplementary Table S1.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kumari, D.; Prasad, B.D.; Sahni, S.; Nonhebel, H.M.; Krishna, P. The Expanded and Diversified Calmodulin-Binding Protein 60 (CBP60) Family in Rice (Oryza sativa L.) Is Conserved in Defense Responses against Pathogens. Agronomy 2022, 12, 3060. https://doi.org/10.3390/agronomy12123060

AMA Style

Kumari D, Prasad BD, Sahni S, Nonhebel HM, Krishna P. The Expanded and Diversified Calmodulin-Binding Protein 60 (CBP60) Family in Rice (Oryza sativa L.) Is Conserved in Defense Responses against Pathogens. Agronomy. 2022; 12(12):3060. https://doi.org/10.3390/agronomy12123060

Chicago/Turabian Style

Kumari, Diksha, Bishun Deo Prasad, Sangita Sahni, Heather M. Nonhebel, and Priti Krishna. 2022. "The Expanded and Diversified Calmodulin-Binding Protein 60 (CBP60) Family in Rice (Oryza sativa L.) Is Conserved in Defense Responses against Pathogens" Agronomy 12, no. 12: 3060. https://doi.org/10.3390/agronomy12123060

APA Style

Kumari, D., Prasad, B. D., Sahni, S., Nonhebel, H. M., & Krishna, P. (2022). The Expanded and Diversified Calmodulin-Binding Protein 60 (CBP60) Family in Rice (Oryza sativa L.) Is Conserved in Defense Responses against Pathogens. Agronomy, 12(12), 3060. https://doi.org/10.3390/agronomy12123060

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop