Next Article in Journal
Optimizing N Application for Forage Sorghum to Maximize Yield, Quality, and N Use Efficiency While Reducing Environmental Costs
Previous Article in Journal
Identification, Interaction, Expression, and Function of QTLs on Leaf Numbers with Single-Segment Substitution Lines in Rice
Previous Article in Special Issue
Powdery Mildew Fungus Oidium lycopersici Infected-Tomato Plants Attracts the Non-Vector Greenhouse Whitefly, Trialeurodes vaporariorum, but Seems Impair Their Development
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 12
10.3390/agronomy12122970
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mycorrhizal Effects on Active Components and Associated Gene Expressions in Leaves of Polygonum cuspidatum under P Stress

by
Ci Deng
1,
Rui-Ting Sun
1,†,
Qiang Ma
2,*,
Qing-He Yang
1,
Nong Zhou
3,
Abeer Hashem
4,
Al-Bandari Fahad Al-Arjani
4,
Elsayed Fathi Abd_Allah
5 and
Qiang-Sheng Wu
1,2,*
1
College of Horticulture and Gardening, Yangtze University, Jingzhou 434025, China
2
Chongqing Key Laboratory of Development and Utilization of Genuine Medicinal Materials in Three Gorges Reservoir Area, Chongqing Three Gorges Medical College, Chongqing 404120, China
3
College of Biology and Food Engineering, Chongqing Three Gorges University, Chongqing 404120, China
4
Botany and Microbiology Department, College of Science, King Saud University, P.O. Box. 2460, Riyadh 11451, Saudi Arabia
5
Plant Production Department, College of Food and Agricultural Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia
*
Authors to whom correspondence should be addressed.
†
Co-first author.
Agronomy 2022, 12(12), 2970; https://doi.org/10.3390/agronomy12122970
Submission received: 8 November 2022 / Revised: 22 November 2022 / Accepted: 23 November 2022 / Published: 25 November 2022
(This article belongs to the Special Issue Plant–Microbial Interactions and Application of Microbial Products in Agricultural Ecosystems)
Browse Figures
Versions Notes

Abstract

:
Arbuscular mycorrhizal fungi (AMF) participate in the process of plant secondary metabolism and thus affect the production of secondary metabolites. However, it is not clear whether and how AMF affect the growth and secondary metabolites of Polygonum cuspidatum, a medicinal plant rich in resveratrol and polygonin, under different phosphorus (P) levels. This study was performed to analyze the effects of Glomus mosseae on the growth, leaf gas exchange, P concentration, active ingredient concentrations, and expressions of associated genes of P. cuspidatum under P-deficient (0 mol/L P) and P-sufficient (0.2 mol/L P) conditions. The root mycorrhizal colonization rate of inoculated plants was 62.53–73.18%. G. mosseae improved shoot and root biomass as well as leaf P levels to some extent, but the improvement was more prominent under P-sufficient than P-deficient conditions. The fungal colonization also significantly increased leaf photosynthetic rate, stomatal conductance, transpiration rate, and intercellular CO2 concentration, which was more prominent under P-deficient rather than P-sufficient conditions. P addition promoted the concentration of active medicinal components in leaves, especially in uninoculated plants. G. mosseae distinctly raised leaf chrysophanol, emodin, polydatin, and resveratrol concentrations, which was more prominent under P-deficient conditions. However, physcion was raised by G. mosseae only under P-sufficient conditions. AMF and P addition up-regulated expressions of PcCRS1, along with the up-regulation of PcRS11 by P addition and PcRS11 and PcSTS by AMF under P-sufficient conditions. It is concluded that an adequate P fertilizer and AMF facilitate the production of active medicinal components in P. cuspidatum, associated with expressions of associated genes such as PcCRS1.

1. Introduction

Phosphorus (P) plays an indispensable role in plant growth, as demonstrated by it not only promoting chlorophyll synthesis, but also by it participating in electron transfer, energy metabolism, photosynthetic phosphorylation, and carbon assimilation [1,2,3,4]. However, P deficiency often occurs during plant growth [5] because of the poor solubility and slow diffusion of phosphate in the soil, as well as its easy fixation by iron oxide and alumina in the soil, resulting in very low P levels [6]. Therefore, it is urgent to promote plant growth under low P soil conditions.
Soil arbuscular mycorrhizal fungi (AMF) can form a mutually beneficial arbuscular mycorrhizal symbiosis with about 80% of terrestrial plant roots [7], where it helps roots to absorb nutrients and water and to coordinate physiological metabolisms, among which the improvement of P nutrition and secondary metabolism is particularly prominent [8,9]. The supply of P fertilizer improved the yield and quality of essential oils in Foeniculum vulgare plants [10]. Soil P levels affected the role of mycorrhizal symbiosis on plants to some extent [11]. However, AMF, but not P fertilizer, promoted essential oil levels in oregano plants [12]. The interactive effect of AMF with P fertilizer was confirmed by Tan et al. [13], who reported that the combination of low P levels and Glomus mosseae inoculation raised artemisinin accumulation in Artemisia annua, while the combination of high P levels and G. mosseae inoculation showed inhibitory effects. On the contrary, in Anadenanthera colubrina, AMF had positive benefits on the levels of various secondary metabolites such as total phenols and total flavonoids, even under high P supply conditions [14]. Therefore, the interaction between P and AMF in regulating secondary metabolites in medicinal plants seems to be very complex and needs to be studied in depth.
Polygonum cuspidatum Sieb. Et Zucc is a perennial herb that is of interest because of its active substances [15]. Among its secondary metabolites, resveratrol as a naturally polyphenolic antioxidant [16], is found in a relatively high level in P. cuspidatum among many plants [17]. Resveratrol synthase (RS), stilbene synthase (STS), resveratrol backbone stilbene synthase (PCRS), and polyketide stilbene synthase1 (CRS) are involved in resveratrol synthesis in P. cuspidatum [18,19]. STS is only present in certain plants for resveratrol synthesis [20]. In addition, other secondary metabolites of P. cuspidatum such as rhodopsin, polydatin, physcion, and emodin exhibit various medicinal properties, and are widely used in pharmaceutical and nutraceutical industries [21]. Therefore, it is important to improve medicinal component levels of P. cuspidatum. However, most of P. cuspidatum is grown in mountainous areas of China, where soil P levels are relatively low [22,23]. It is unclear whether and how AMF inoculation and P interact to affect plant growth and medicinal component levels in P. cuspidatum.
Since both AMF and P fertilizer supply can promote the level of secondary metabolites in P. cuspidatum, it is unclear whether this benefit is more dependent on AMF or P fertilizer and whether it depends on the expression of related genes in the pathway of secondary metabolites caused by AMF. The objective of this study was to analyze the effects of AMF inoculation on leaf gas exchange, plant growth, active component levels, and expressions of resveratrol-associated enzyme genes in leaves of P. cuspidatum under low and appropriate P conditions, in anticipation of revealing the benefits and potential mechanisms of P and AMF in promoting the active medicinal components of P. cuspidatum.

2. Materials and Methods

2.1. Experimental Design

The study consisted of the following factors: (i) P treatments, including appropriate P level (0.2 mol/L P) (Ap) and low P level (0 mol/L P) (Lp); and (ii) inoculation treatments, including G. mosseae inoculation (G+) and non-inoculation (G−). A total of four treatments (ApG+, ApG−, LpG+, and LpG−) were performed in this experiment, each with eight replicates, in a completely randomized block arrangement.

2.2. Experimental Set-Up

P. cuspidatum with four leaves growing in autoclaved soil was transplanted into a plastic pot (height: 18 cm; upper diameter: 21 cm; base diameter: 12 cm) where 2.05 kg of sulfuric acid-eluting sand was pre-filled. For the G+ treatment, 150 g of G. mosseae inoculum was supplied per pot, while the G− treatment received 150 g of autoclaved fungal inoculum per pot, accompanied by 2 mL of 30 μm filtered solution of the same inoculum. The G. mosseae strain, preserved in our laboratory, was isolated from the rhizosphere of Incarvillea younghusbandii, identified in morphological levels, and trapped with white clover as the host for 12 weeks. The fungal inoculum thus consisted of fungal-colonized root segments, spores, and hyphae, in which the number of spores was 19 spore/g. After inoculation treatments, these seedlings were acclimated indoors for 4 days before being placed in an environmentally controlled greenhouse, in which the environmental conditions were as described by Sun et al. [24]. Plants were kept watered with distilled water at the rate of 100 mL/pot per day. Three weeks later, P treatment was started, using Hoagland nutrient solution adjusted for P levels. Substrate P levels were set at 0 mol/L and 0.2 mol/L in 3-day intervals at 70 mL of nutrient solution per pot, referring to the results of Song et al. [25]. For a total of 17 times, different strengths of P solution were administered. The potted plants were maintained for 12 weeks and then harvested.

2.3. Variable Measurement

Leaf gas exchange (photosynthetic rate, transpiration rate, intercellular CO2 concentration, and stomatal conductance) was measured using a Li-6400 (LI-COR Inc., Lincoln, NE, USA) portable photosynthesis system from 9:00 to 10:00 am on the harvested day of P. cuspidatum (a sunny day), with the top 3rd of the leaf [26]. Then, the plants were removed from plastic pots and divided into shoots and roots. A small number of leaves were treated with liquid nitrogen and stored at −75 °C for gene expression assay. Twelve root segments of approximately 1-cm length were cut from the root of each plant and stained using 0.05% (w/v) of trypan blue in lactic acid phenol solutions [27]. Root mycorrhizas were observed microscopically, and the degree of AMF colonization was estimated as the percentage of the length of the AMF-colonized root segments versus the total length of the observed root segments. The rest of the material was treated at 105 °C for 3 min and then at 75 °C for drying to constant weight [28]. The respective dry weight was determined. Leaf P concentrations were determined using a colorimetric method outlined by Cavell [29] by grinding leaves, passing them through a 2 mm sieve, and then digesting them with H2SO4-H2O2.
Total chlorophyll concentration in leaves was calculated by the colorimetric method, based on the extraction with 80% acetone solution [30]. Total soluble protein concentration in leaves was measured by the protocol of Bradford [31], using bovine serum albumin as a standard.
A 0.1 g dried leaf sample (Φ < 2 mm) was incubated with 10 mL of 80% methanol for half an hour under sonicated conditions, and centrifuged at 4500× g for 10 min. The supernatant was collected as the solution to be measured and analyzed on a HPLC (LC-20A, Shimadzu, Kyoto, Japan), where the chromatographic conditions were an Agela Venusil XBP C18(L) column (4.6 × 250 mm, 5 μm) with acetonitrile (A) and 0.1% formic acid (B) as the mobile phase, a 1.0 mL/min flow rate, a 10 μL injection volume, a detection wavelength of 290 nm, and a column temperature of 75 °C.
Total RNA of the leaves was extracted using a Quick RNA isolation kit (ZH120, Huayueyang, Beijing, China) and then reversely transcribed into cDNA as per a TRUE 1st Strand cDNA Synthesis Kit with gDNA Eraser kit (PC5402, Aidlad, Beijing, China). Four related genes in the resveratrol synthesis pathway including RS, STS, PCRS11, and CRS1 were selected. Their specific primers were designed by Primer premier 5.0 and were shown in Table 1. qRT-PCR assays were performed as per the method of Sun et al. [23], combined with 2×AceQ qPCR SYBR Green Master Mix (Aidlab, Beijing, China). Actin was used as an internal reference control. Relative gene expression was estimated in terms of a comparative method [32] using LpG− treatment as the standard.

2.4. Statistical Analysis

The obtained data were evaluated using two-way analysis of variance by SAS® software (9.1.3v), and Duncan’s multiple-range tests were performed to compare significant differences among treatments at the 0.05 level.

3. Results

3.1. Changes in Root Mycorrhizal Colonization and Biomass Production

No signs of AMF colonization were seen in the roots of uninoculated plants with G. mosseae grown in autoclaved substrates, while mycorrhizal colonization was seen in the inoculated roots, where the degree of AMF colonization was 62.53 ± 6.65% under Lp and 73.18 ± 7.76% under Ap.
In addition, compared with Lp treatment, Ap treatment significantly raised shoot and root biomass: it was 29% and 35% higher in uninoculated plants and 71% and 123% higher in inoculated plants, respectively (Figure 1). Inoculation with G. mosseae dramatically raised shoot biomass under Lp and Ap by 41% and 32%, respectively, along with 94% higher root biomass under Ap only. P supply and AMF inoculation significantly interacted to influence root biomass (Table 2).
Of all the treatments, co-application of P supply and AMF inoculation presented the best improved effect on shoot and root biomass production.

3.2. Changes in Leaf P Concentrations

P supply significantly increased leaf P concentrations in both inoculated and uninoculated plants (Figure 2). Although a 31% higher P concentration occurred in inoculated plants versus uninoculated plants under Lp, the difference was not significant. AMF inoculation only significantly increased leaf P concentrations under Ap by 37%. Leaf P concentrations were more dependent on AMF inoculation under Ap conditions than under Lp conditions.

3.3. Changes in Leaf Gas Exchange

The photosynthetic rate and transpiration rate were increased by Ap in both inoculated and uninoculated plants, compared with Lp (Figure 3a,b). In addition, Ap significantly increased stomatal conductance in inoculated plants as well as intercellular CO2 concentration in uninoculated plants, compared with Lp (Figure 3c,d). Compared to the uninoculated treatment, AMF inoculation significantly increased leaf photosynthetic rate, transpiration rate, stomatal conductance, and intercellular CO2 concentration: 88%, 69%, 100%, and 39% higher under Lp conditions and 67%, 12%, 75%, and 13% higher under Ap conditions, respectively (Figure 3a–d). Transpiration rate, stomatal conductance, and intercellular CO2 concentration were significantly affected by the interaction of AMF inoculation and P supply (Table 2). In conclusion, AMF inoculation promoted leaf gas exchange, with a higher effect under Lp than under Ap.

3.4. Changes in Total Chlorophyll and Total Soluble Protein in Leaves

P addition significantly increased leaf total chlorophyll and total soluble protein concentrations, independent of AMF inoculation (Figure 4a,b). In addition, compared to the uninoculated treatment, inoculation with AMF significantly increased leaf total chlorophyll and total soluble protein concentrations: 44% and 44% higher under Lp conditions and 22% and 8% higher under Ap conditions, respectively. P supply and AMF inoculation collectively stimulated leaf total chlorophyll and total soluble protein concentrations.

3.5. Changes in Active Components in Leaves

A total of five active components were found in leaves of P. cuspidatum, with the exception of alloe-emodin, which was below the detection line (Figure 5a,b). Ap treatment significantly increased chrysophanol, emodin, polydatin, and resveratrol levels in leaves of uninoculated plants as well as physcion, polydatin, and resveratrol levels in inoculated plants, compared with Lp (Figure 6a–e). Under Lp conditions, inoculation with AMF significantly increased chrysophanol, emodin, polydatin, and resveratrol levels in leaves by 180%, 122%, 32%, and 110%, respectively, compared with the uninoculated treatment. Similarly, under Ap conditions, AMF inoculation significantly increased chrysophanol, emodin, physcion, polydatin, and resveratrol levels in leaves by 88%, 64%, 81%, 17%, and 72%, respectively, compared with the uninoculated treatment. In addition, physcion and resveratrol levels were significantly affected by the interaction of AMF and P (Table 2). In short, improved active components in leaves were more dependent on AMF inoculation than P supply.

3.6. Changes in Expressions of Resveratrol-Associated Enzyme Genes

Ap treatment significantly increased chrysophanol, emodin, polydatin, and resveratrol concentrations in leaves of uninoculated plants as well as physcion, polydatin, and resveratrol concentrations in inoculated plants, compared with Lp (Figure 7a–d). Under Lp conditions, inoculation with AMF significantly increased chrysophanol, emodin, polydatin, and resveratrol concentrations in leaves by 180%, 122%, 32%, and 110%, respectively, compared with the uninoculated treatment. Similarly, under Ap conditions, AMF inoculation significantly increased chrysophanol, emodin, physcion, polydatin, and resveratrol in leaves by 88%, 64%, 81%, 17%, and 72%, respectively, compared with the uninoculated treatment. In addition, physcion and resveratrol concentrations were significantly affected by the interaction of AMF inoculation and P supply (Table 2).

4. Discussion

In this study, it was observed that Ap treatment significantly increased the degree of G. mosseae colonization in roots, compared with Lp treatment. Many studies have showed that low P treatment promote the root AMF colonization degree [33]. In fact, there are root hairs and extraradical mycorrhizal hyphae on the root surface, and they have a certain competitive relationship in nutrient absorption [34]. Therefore, the response of mycorrhizal fungi to P may be related to the root hair status of P. cuspidatum.
Shoot and root biomass of P. cuspidatum was affected by P supply and AMF, and the 0.2 mol/L P level promoted the biomass production of P. cuspidatum (Figure 1), indicating that P is an essential mineral element for their growth [35]. On the other hand, G. mosseae also improved shoot and root biomass of P. cuspidatum (Figure 1), which was more prominent at the 0.2 mol/L P level. However, under the conditions of 0 M P, G. mosseae only promoted shoot biomass, but had no significant effect on root biomass, which indicates that P. cuspidatum may be more dependent on root hair under the condition of low P. The improvement of plant growth under mycorrhization is due to the fact that mycorrhizal plants showed higher total leaf chlorophyll levels than non-mycorrhizal plants (Figure 4a), regardless of substrate P levels. In fact, AMF can enhance the adaptive ability of host plants to various environmental stresses, including nutrient deficiency, and positively regulate plant growth [36]. AMF inoculation under drought stress promoted the growth of Glycyrrhiza uralensis plants and also increased glycyrrhizinate levels in roots [37,38].
In this study, AMF treatment profoundly promoted the concentration of leaf P under Ap conditions but not under Lp conditions (Figure 2). This is in agreement with the results of Shao et al. [38] who inoculated AMF in tea plants under P deficient conditions. Such results may be because in this study, under Lp conditions, the growth substrate was treated with 0 mM P and almost no P, leading to the fact that the mycorrhizal fungi did not show significant effects, but still increased P by 31%. However, under Ap conditions, mycorrhizal plants promoted P concentrations in P. cuspidatum, associated with extraradical mycorrhizal hyphae, released phosphatases, and increased expressions of phosphate transporter genes [39,40].
Both P supply and AMF inoculation could improve leaf gas exchange in P. cuspidatum, but the effect of AMF was more prominent (Figure 3). The improved effect of AMF under Lp conditions was higher than that under Ap conditions. Zou et al. [41] found that in Betula alonoides AMF colonization distinctly increased leaf gas exchange parameters, thus improving the absorption efficiency of N and P of the host. Similar results are consistent with the improvement of leaf gas exchange variables by inoculation of Piriformospora indica (an endophytic fungus) on P. cuspidatum [23]. The improvement of P nutrition can enhance the efficiency of plant photosynthate transfer and promote the growth of roots and arbuscular mycorrhizae, which is directly related to the improvement of plant growth [42].
The concentration of active medicinal ingredients is the main criterion to determine the quality of P. cuspidatum. In this experiment, P fertilizer could promote the concentration of the active medicinal components in leaves of P. cuspidatum, and the more prominent effect was found in uninoculated plants (Figure 6), indicating that mycorrhizal plants were more dependent on AMF than P fertilizer. On the other hand, AMF colonization also dramatically raised chrysophanol, emodin, polydatin, and resveratrol levels, along with a higher improved effect under Lp versus Ap conditions (Figure 6), suggesting the prominent promotion of active component production in P. cuspidatum by AMF colonization under low P level conditions. Therefore, AMF inoculation in P-deficient soils was more effective in increasing medicinal component levels. A study by He et al. [43] on Scutellaria baicalensis also showed that G. mosseae inoculation significantly increased baicalin concentrations, and the best effect was obtained with mycorrhizal fungi under 0.15 g P/kg (a relatively low P level) conditions. Similarly, in Artemisia annua, G. mosseae promoted artemisinin accumulation under low P level conditions, followed by an inhibitive effect under high P level conditions [13]. In Paris polyphylla var. yunnanensis, AMF inoculation promoted the concentration of different steroidal saponins in rhizomes, but it depended on the AMF species used [44]. These results suggest that the effect of AMF on a particular secondary metabolite of medicinal plants depends on the combination with AMF species and substrate P levels.
In the process of symbiosis with host plants, AMF regulates associated gene expression in many secondary metabolic pathways, and then affects the production of secondary metabolites in host plants [45]. P addition up-regulated the expressions of PcRS, PcRS11, and PcCRS1 in uninoculated plants and PcRS11 and PcCRS1 in inoculated plants, accompanied by the inhibition of PcRS expression in inoculated plants (Figure 7), indicating that P addition was dependent on mycorrhizal colonization for the expression of key genes in resveratrol synthesis pathways. Under Ap conditions, AMF colonization up-regulated the expression of PcSTS, PcRS11, and PcCRS1, while under Lp conditions, the expression of PcRS and PcCRS1 was up-regulated by AMF (Figure 7), indicating the importance of this gene in the increase in resveratrol levels by mycorrhizal fungi. AMF promotes the synthesis of terpenoids by promoting the efficiency of P uptake by plants from the soil, which in turn promotes the synthesis of pyrophosphate compounds (isopentene pyrophosphate and dimethyl allyl pyrophosphate) and finally the synthesis of terpenoids [33,46].

5. Conclusions

G. mosseae inoculation dramatically improved plant growth, leaf gas exchange, and P levels of P. cuspidatum, dependent on the level of substrate P. To our knowledge, this work revealed for the first time that P. cuspidatum plants were more dependent on AMF than P fertilizer for promoting the concentration of active medicinal components in leaves. The improved magnitude by AMF colonization on medicinal components was higher under P-deficient conditions than under P-sufficient conditions. AMF-modulated increases in active medicinal components were associated with expressions of associated genes, especially PcCRS1. How mycorrhiza activates the expression of PcCRS1 in this process is unclear and remains to be studied. Transcriptome sequencing can be used to further screen relevant differentially expressed genes and determine whether this gene expression is specifically induced by AMF and the expression characteristics in arbuscule-contained root cortex cells. It is necessary to pay more attention to the input of suitable P fertilizer and increase the number of AMF populations and the degree of root colonization in P. cuspidatum.

Author Contributions

Conceptualization, Q.-S.W. and Q.M.; methodology, R.-T.S. and N.Z.; data curation and statistical analysis, C.D., R.-T.S. and Q.-H.Y.; investigation, C.D. and R.-T.S.; writing—original draft preparation, R.-T.S. and C.D.; writing—review and editing, Q.M., A.H., A.-B.F.A.-A., E.F.A. and Q.-S.W.; supervision, Q.-S.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the open funding in Chongqing Key Laboratory of Development and Utilization of Genuine Medicinal Materials in Three Gorges Reservoir Area, Chongqing Three Gorges Medical College (KFKT2022008), the Science and Technology Research Projects of Chongqing Education Commission (grant nos. KJQN202102705), and 2021 Undergraduate Innovation and Entrepreneurship Training Program of Yangtze University (Yz2021329). The authors would like to extend their sincere appreciation to the Researchers Supporting Project Number (RSP-2021/134), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data supporting the findings of this study are included in this article.

Acknowledgments

The authors would like to extend their sincere appreciation to the Researchers Supporting Project Number (RSP-2021/134), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Xing, D.; Wu, Y. Effect of phosphorus deficiency on photosynthetic inorganic carbon assimilation of three climber plant species. Bot. Stud. 2014, 55, 60. [Google Scholar] [CrossRef] [Green Version]
  2. Carstensen, A.; Herdean, A.; Schmidt, S.B.; Sharma, A.; Spetea, C.; Pribil, M.; Husted, S. The impacts of phosphorus deficiency on the photosynthetic electron transport chain. Plant Physiol. 2018, 177, 271–284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Amarh, F.; Voegborlo, R.B.; Essuman, E.K.; Agorku, E.S.; Kortei, N.K. Effects of soil depth and characteristics on phosphorus adsorption isotherms of different land utilization types phosphorus adsorption isotherms of soil. Soil Till. Res. 2021, 213, 105139. [Google Scholar] [CrossRef]
  4. Cheng, X.-F.; Xie, M.-M.; Li, Y.; Liu, B.-Y.; Liu, C.-Y.; Wu, Q.-S.; Kuča, K. Effects of field inoculation with arbuscular mycorrhizal fungi and endophytic fungi on fruit quality and soil properties of Newhall navel orange. Appl. Soil Ecol. 2021, 170, 104308. [Google Scholar] [CrossRef]
  5. He, H.; Peng, Q.; Wang, X.; Fan, C.; Pang, J.; Lambers, H.; Zhang, X. Growth, morphological and physiological responses of alfalfa (Medicago sativa) to phosphorus supply in two alkaline soils. Plant Soil 2017, 416, 565–584. [Google Scholar] [CrossRef]
  6. Turrión, M.-B.; Bueis, T.; Lafuente, F.; López, O.; José, E.S.; Eleftheriadis, A.; Mulas, R. Effects on soil phosphorus dynamics of municipal solid waste compost addition to a burnt and unburnt forest soil. Sci. Total Environ. 2018, 642, 374–382. [Google Scholar] [CrossRef]
  7. Saeed, M.; Khan, I.; Hameed, A.; Ullah, I.; Chaudhry, M.S.; Naveed-Ul-Haq, A.; Kaleem, S. Arbuscular mycorrhizal fungi (AMF) and soil chemical heterogeneity significantly alters nutritional value of tomato fruit. Pak. J. Bot. 2021, 54. [Google Scholar] [CrossRef]
  8. He, J.D.; Dong, T.; Wu, H.H.; Zou, Y.N.; Wu, Q.S.; Kuča, K. Mycorrhizas induce diverse responses of root TIP aquaporin gene expression to drought stress in trifoliate orange. Sci. Hortic. 2019, 243, 64–69. [Google Scholar] [CrossRef]
  9. Meena, M.; Narjary, B.; Sheoran, P.; Jat, H.; Joshi, P.; Chinchmalatpure, A.; Yadav, G.; Yadav, R. Changes of phosphorus fractions in saline soil amended with municipal solid waste compost and mineral fertilizers in a mustard-pearl millet cropping system. Catena 2018, 160, 32–40. [Google Scholar] [CrossRef]
  10. Kapoor, R.; Giri, B.; Mukerji, K.G. Improved growth and essential oil yield and quality in Foeniculum vulgare mill on mycorrhizal inoculation supplemented with P-fertilizer. Bioresour. Technol. 2004, 93, 307–311. [Google Scholar] [CrossRef]
  11. Zhang, S.B.; Wang, Y.S.; Yin, X.F.; Liu, J.B.; Wu, F.X. Development of arbuscular mycorrhizal (AM) fungi and their influences on the absorption of N and P of maize at different soil phosphorus application levels. J. Plant Nutr. Fert. 2017, 23, 649–657. [Google Scholar] [CrossRef]
  12. Khaosaad, T.; Vierheilig, H.; Nell, M.; Zitterl-Eglseer, K.; Novák, J. Arbuscular mycorrhiza alter the concentration of essential oils in oregano (Origanum sp., Lamiaceae). Mycorrhiza 2006, 16, 443–446. [Google Scholar] [CrossRef]
  13. Tan, W.D.; Shen, M.J.; Qiu, H.J.; Zeng, F.L.; Huang, J.H.; Huang, R.S.; Luo, W.G.; Liu, Y.X. Effects of different phosphorus treatments on arbuscular mycorrhizal formation, growth and artemisinin content of Artemisia annua. J. South. Agric. 2013, 44, 1303–1307. [Google Scholar]
  14. Pedone-Bonfim, M.V.; A Lins, M.; Coelho, I.R.; Santana, A.S.; Silva, F.S.; Maia, L.C. Mycorrhizal technology and phosphorus in the production of primary and secondary metabolites in cebil (Anadenanthera colubrina (Vell.) Brenan) seedlings. J. Sci. Food Agric. 2012, 93, 1479–1484. [Google Scholar] [CrossRef]
  15. Kurita, S.; Kashiwagi, T.; Ebisu, T.; Shimamura, T.; Ukeda, H. Content of resveratrol and glycoside and its contribution to the antioxidative capacity of Polygonum cuspidatum (Itadori) harvested in Kochi. Biosci. Biotechnol. Biochem. 2014, 78, 499–502. [Google Scholar] [CrossRef]
  16. Salehi, B.; Mishra, A.P.; Nigam, M.; Sener, B.; Kilic, M.; Sharifi-Rad, M.; Fokou, P.V.T.; Martins, N.; Sharifi-Rad, J. Resveratrol: A double-edged sword in health benefits. Biomedicines 2018, 6, 91. [Google Scholar] [CrossRef] [Green Version]
  17. Shaheen, H.M.; Alsenosy, A.A. Nuclear factorkappa B inhibition as a therapeutic target of nutraceuticals in arthritis, osteoarthritis, and related inflammation. In Bioactive Food as Dietary Interventions for Arthritis and Related Inflammatory Diseases, section editionl; Watson, R.R., Preedy, V.R., Eds.; Academic Press: London, UK, 2019; pp. 437–453. [Google Scholar]
  18. Hao, D.; Ma, P.; Mu, J.; Chen, S.; Xiao, P.; Peng, Y.; Huo, L.; Xu, L.; Sun, C. De novo characterization of the root transcriptome of a traditional Chinese medicinal plant Polygonum cuspidatum. Sci. China Life Sci. 2012, 55, 452–466. [Google Scholar] [CrossRef] [Green Version]
  19. Jiang, J.; Xi, H.; Dai, Z.; Lecourieux, F.; Yuan, L.; Liu, X.; Patra, B.; Wei, Y.; Li, S.; Wang, L. VvWRKY8 represses stilbene synthase genes through direct interaction with VvMYB14 to control resveratrol biosynthesis in grapevine. J. Exp. Bot. 2018, 70, 715–729. [Google Scholar] [CrossRef]
  20. Kiselev, K.V. Perspectives for production and application of resveratrol. Appl. Microbiol. Biotechnol. 2011, 90, 417–425. [Google Scholar] [CrossRef]
  21. Wang, D.-G.; Liu, W.-Y.; Chen, G.-T. A simple method for the isolation and purification of resveratrol from Polygonum cuspidatum. J. Pharm. Anal. 2013, 3, 241–247. [Google Scholar] [CrossRef] [Green Version]
  22. Ren, L.F.; Zhang, W.H.; Li, Y.S. Effect of phosphorus deficiency on physiological properties of Medicago falcata. Acta Pratacult. Sin. 2012, 21, 242–249. [Google Scholar]
  23. Sun, R.-T.; Zhang, Z.-Z.; Feng, X.-C.; Zhou, N.; Feng, H.-D.; Liu, Y.-M.; Harsonowati, W.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.-S. Endophytic fungi accelerate leaf physiological activity and resveratrol accumulation in Polygonum cuspidatum by up-regulating expression of associated genes. Agronomy 2022, 12, 1220. [Google Scholar] [CrossRef]
  24. Sun, R.-T.; Feng, X.-C.; Zhang, Z.-Z.; Zhou, N.; Feng, H.-D.; Liu, Y.-M.; Hashem, A.; Al-Arjani, A.-B.F.; Abd_Allah, E.F.; Wu, Q.-S. Root endophytic fungi regulate changes in sugar and medicinal compositions of Polygonum cuspidatum. Front. Plant Sci. 2022, 13, 818909. [Google Scholar] [CrossRef] [PubMed]
  25. Song, A.Q.; Tong, F.P.; Yi, A.Q.; Ding, J.; Li, G.; Huang, Z. Rooting out of bottles and fertilization on leaves experiment on tissue culture of Ploygonum cuspidatum sieb et zucc. Hunan For. Sci. Technol. 2006, 33, 27–30. [Google Scholar] [CrossRef]
  26. AbdElgawad, H.; El-Sawah, A.M.; Mohammed, A.E.; Alotaibi, M.O.; Yehia, R.S.; Selim, S.; Saleh, A.M.; Beemster, G.T.S.; Sheteiwy, M.S. Increasing atomspheric CO2 differentially supports arsenite stress mitigating impact of arbuscular mycorrhizal fungi in wheat. Chemosphere 2022, 296, 134044. [Google Scholar] [CrossRef]
  27. Phillips, J.M.; Hayman, D.S. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 1970, 55, 158–161. [Google Scholar] [CrossRef]
  28. Ibrahim, H.M.; El-Sawah, A.M. The mode of integration between Azotobacter and Rhizobium affect plant growth, yield, and physiological responses of pea (Pisum sativum L.). J. Soil Sci. Plant Nutr. 2022, 22, 1238–1251. [Google Scholar] [CrossRef]
  29. Cavell, A.J. The colorimetric determination of phosphorus in plant materials. J. Sci. Food Agric. 1955, 6, 479–480. [Google Scholar] [CrossRef]
  30. Lichtenthaler, H.K.; Wellburn, A.R. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Analysis 1983, 11, 591–592. [Google Scholar] [CrossRef] [Green Version]
  31. Bradford, M.M. A rapid and sensitive method for the quantification of microgram quantities of proteins utilizing the principle of protein–dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  32. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  33. Wu, Q.-S.; Li, Y.; Zou, Y.-N.; He, X.-H. Arbuscular mycorrhiza mediates glomalin-related soil protein production and soil enzyme activities in the rhizosphere of trifoliate orange grown under different P levels. Mycorrhiza 2014, 25, 121–130. [Google Scholar] [CrossRef]
  34. Wu, Q.-S.; Liu, C.-Y.; Zhang, D.-J.; Zou, Y.-N.; He, X.-H.; Wu, Q.-H. Mycorrhiza alters the profile of root hairs in trifoliate orange. Mycorrhiza 2015, 26, 237–247. [Google Scholar] [CrossRef]
  35. Sun, R.-T.; Zhang, Z.-Z.; Liu, M.-Y.; Feng, X.-C.; Zhou, N.; Feng, H.-D.; Hashem, A.; Abd_Allah, E.F.; Harsonowati, W.; Wu, Q.-S. Arbuscular mycorrhizal fungi and phosphorus supply accelerate main medicinal component production of Polygonum cuspidatum. Front. Microbiol. 2022, 13, 1006140. [Google Scholar] [CrossRef]
  36. Zhang, L.; Feng, G.; Declerck, S. Signal beyond nutrient, fructose, exuded by an arbuscular mycorrhizal fungus triggers phytate mineralization by a phosphate solubilizing bacterium. ISME J. 2018, 12, 2339–2351. [Google Scholar] [CrossRef] [Green Version]
  37. Xie, W.; Hao, Z.; Yu, M.; Wu, Z.; Zhao, A.; Li, J.; Zhang, X.; Chen, B. Improved phosphorus nutrition by arbuscular mycorrhizal symbiosis as a key factor facilitating glycyrrhizin and liquiritin accumulation in Glycyrrhiza uralensis. Plant Soil 2018, 439, 243–257. [Google Scholar] [CrossRef]
  38. Xie, W.; Hao, Z.; Zhou, X.; Jiang, X.; Xu, L.; Wu, S.; Zhao, A.; Zhang, X.; Chen, B. Arbuscular mycorrhiza facilitates the accumulation of glycyrrhizin and liquiritin in Glycyrrhiza uralensis under drought stress. Mycorrhiza 2018, 28, 285–300. [Google Scholar] [CrossRef]
  39. Shao, Y.-D.; Hu, X.-C.; Wu, Q.-S.; Yang, T.-Y.; Srivastava, A.; Zhang, D.-J.; Gao, X.-B.; Kuča, K. Mycorrhizas promote P acquisition of tea plants through changes in root morphology and P transporter gene expression. South Afr. J. Bot. 2020, 137, 455–462. [Google Scholar] [CrossRef]
  40. Cao, M.A.; Liu, R.C.; Xiao, Z.Y.; Hashem, A.; Abd_Allah, E.F.; Alsayed, M.F.; Harsonowati, W.; Wu, Q.S. Symbiotic fungi alter the acquisition of phosphorus in Camellia oleifera through regulating root architecture, plant phosphate transporter gene expressions and soil phosphatase activities. J. Fungi 2022, 8, 800. [Google Scholar] [CrossRef]
  41. Zou, H.; Wang, C.S.; Zeng, J. Effect of native mycorrhizal fungi on photosynthetic physiology of Betula alnoides clones seedlings. J. Centr. South Univ. For. Technol. 2019, 39, 1–7. [Google Scholar] [CrossRef]
  42. Kapoor, R.; Sharma, D.; Bhatnagar, A. Arbuscular mycorrhizae in micropropagation systems and their potential applications. Sci. Hortic. 2008, 116, 227–239. [Google Scholar] [CrossRef]
  43. He, C.; He, X.L.; Ma, L.; Chen, W.Y. Effects of inoculation AM fungi and phosphate application on growth and photosynthetic characteristics of Scuteliaria baiealensis. Acta Agric. Bor. Occid. Sin. 2014, 23, 180–184. [Google Scholar] [CrossRef]
  44. Nong, Z.; Ding, B.; Feng, Y.; Qi, W.-H.; Zhang, H.; Guo, D.-Q.; Xiang, J. Effects of mycorrhizal colonization and medicine quality of Paris polyphylla var. yunnanensis inoculated by different foreign AM fungi species. China J. Chin. Mater. Med. 2015, 40, 3158–3167. [Google Scholar] [CrossRef]
  45. Sun, R.-T.; Zhang, Z.-Z.; Zhou, N.; Srivastava, A.; Kuča, K.; Abd_Allah, E.F.; Hashem, A.; Wu, Q.-S. A review of the interaction of medicinal plants and arbuscular mycorrhizal fungi in the rhizosphere. Not. Bot. Horti Agrobot. Cluj-Napoca 2021, 49, 12454. [Google Scholar] [CrossRef]
  46. Wang, X.F.; Zhang, X.; Zhao, R.H.; Yu, J.; Gu, W.; Li, R.; Cao, G.H.; He, S. Effect and mechanism of arbuscular mycorrhizal fungi in herbs. Chin. J. Exp. Tradit. Med. Form. 2020, 26, 217–226. [Google Scholar] [CrossRef]
Agronomy 12 02970 g001 550
Figure 1. Changes in shoot and root biomass of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters in the bars indicate significant differences between treatments at the 0.05 level. Abbreviations: LpG−, plants inoculated without G. mosseae in low P levels; LpG+, plants inoculated with G. mosseae in low P levels; ApG−, plants inoculated without G. mosseae in appropriate P levels; ApG+, plants inoculated with G. mosseae in appropriate P levels.
Figure 1. Changes in shoot and root biomass of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters in the bars indicate significant differences between treatments at the 0.05 level. Abbreviations: LpG−, plants inoculated without G. mosseae in low P levels; LpG+, plants inoculated with G. mosseae in low P levels; ApG−, plants inoculated without G. mosseae in appropriate P levels; ApG+, plants inoculated with G. mosseae in appropriate P levels.
Agronomy 12 02970 g001
Agronomy 12 02970 g002 550
Figure 2. Changes in leaf P concentrations of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters in the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Figure 2. Changes in leaf P concentrations of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters in the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Agronomy 12 02970 g002
Agronomy 12 02970 g003 550
Figure 3. Changes in leaf photosynthetic rate (a), transpiration rate (b), stomatal conductance (c), and intercellular CO2 concentrations (d) of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters on the bars indicate significant differences between treatments at the 0.05 level. See Figure 1 for abbreviations.
Figure 3. Changes in leaf photosynthetic rate (a), transpiration rate (b), stomatal conductance (c), and intercellular CO2 concentrations (d) of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters on the bars indicate significant differences between treatments at the 0.05 level. See Figure 1 for abbreviations.
Agronomy 12 02970 g003
Agronomy 12 02970 g004 550
Figure 4. Changes in leaf total chlorophyll (a) and total soluble protein (b) concentrations of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters on the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Figure 4. Changes in leaf total chlorophyll (a) and total soluble protein (b) concentrations of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters on the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Agronomy 12 02970 g004
Agronomy 12 02970 g005 550
Figure 5. HPLC chromatograms in the determination of standard sample (a) and leaf sample (b). Among them, 1, 2, 3, 4, 5, and 6 in the figure represent polydatin, resveratrol, aloe-emodin, emodin, chrysophanol, and physcion, respectively.
Figure 5. HPLC chromatograms in the determination of standard sample (a) and leaf sample (b). Among them, 1, 2, 3, 4, 5, and 6 in the figure represent polydatin, resveratrol, aloe-emodin, emodin, chrysophanol, and physcion, respectively.
Agronomy 12 02970 g005
Agronomy 12 02970 g006 550
Figure 6. Changes in concentrations of leaf chrysophanol (a), emodin (b), physcion (c), polydatin (d), and resveratrol (e) of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters in the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Figure 6. Changes in concentrations of leaf chrysophanol (a), emodin (b), physcion (c), polydatin (d), and resveratrol (e) of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters in the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Agronomy 12 02970 g006
Agronomy 12 02970 g007 550
Figure 7. Changes in expressions of leaf PcRS (a), PcSTS (b), PcRS11 (c), and PcCRS1 (d) of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters on the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Figure 7. Changes in expressions of leaf PcRS (a), PcSTS (b), PcRS11 (c), and PcCRS1 (d) of Polygonum cuspidatum inoculated with Glomus mosseae in low and approximate P levels. Different letters on the bars indicate significant (p < 0.05) differences between treatments. See Figure 1 for abbreviations.
Agronomy 12 02970 g007
Table
Table 1. Primer sequences of the genes used in the present study for qRT-PCR.
Table 1. Primer sequences of the genes used in the present study for qRT-PCR.
GenesGene IDForward Sequence (5′→3′)Reverse Sequence (5′→3′)
PcCRS1DQ459350.1TGAGCGAGTACGGGAATTTGCCTTCTCCAGTCGTCTTCTTAC
PcRS11EF117977.1GATGAGATGATGAAGGCACAAACGGAAGTAGAAGTCGGGAAAGTC
PcRSDQ900615.1GAGATGACGAAGGCACTAACAGGAAGTAGAAGTCGGGAAAGTC
PcSTSEU647245.1GAAGAGATGATGAAGGCACAAACGGAAGTAGAAGTCGGGAAAGTC
PcActinMK288156.1TACAATGAGCTTCGGGTTGCGCTCTTTGCAGTTTCCAGCT
Table
Table 2. Interacted significance of variables.
Table 2. Interacted significance of variables.
VariablesP TreatmentsAMF InoculationInteractionVariablesP TreatmentsAMF
Inoculation		Interaction
Shoot biomass0.00360.00101.0000Chrysophanol0.0323<0.00010.2126
Root biomass<0.0001<0.00010.0005Emodin0.0303<0.00010.1846
P concentrations0.00040.00320.3621Physcion<0.00010.00010.0030
Photosynthetic rate<0.0001<0.00010.2598Polydatin<0.00010.00300.8879
Transpiration rate<0.0001<0.00010.0007Resveratrol0.5037<0.0001<0.0001
Stomatal conductance<0.0001<0.00010.0301PcRS0.00150.0004<0.0001
Intercellular CO2 level0.1799<0.00010.0170PcSTS0.07520.00200.2602
Total chlorophyll<0.00010.00060.9461PcRS11<0.00010.01210.2445
Total soluble protein<0.00010.00700.1698PcCRS10.00060.00490.9583
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Deng, C.; Sun, R.-T.; Ma, Q.; Yang, Q.-H.; Zhou, N.; Hashem, A.; Al-Arjani, A.-B.F.; Abd_Allah, E.F.; Wu, Q.-S. Mycorrhizal Effects on Active Components and Associated Gene Expressions in Leaves of Polygonum cuspidatum under P Stress. Agronomy 2022, 12, 2970. https://doi.org/10.3390/agronomy12122970

AMA Style

Deng C, Sun R-T, Ma Q, Yang Q-H, Zhou N, Hashem A, Al-Arjani A-BF, Abd_Allah EF, Wu Q-S. Mycorrhizal Effects on Active Components and Associated Gene Expressions in Leaves of Polygonum cuspidatum under P Stress. Agronomy. 2022; 12(12):2970. https://doi.org/10.3390/agronomy12122970

Chicago/Turabian Style

Deng, Ci, Rui-Ting Sun, Qiang Ma, Qing-He Yang, Nong Zhou, Abeer Hashem, Al-Bandari Fahad Al-Arjani, Elsayed Fathi Abd_Allah, and Qiang-Sheng Wu. 2022. "Mycorrhizal Effects on Active Components and Associated Gene Expressions in Leaves of Polygonum cuspidatum under P Stress" Agronomy 12, no. 12: 2970. https://doi.org/10.3390/agronomy12122970

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop