OsCSN1 Regulates the Growth and Development of Rice Seedlings through the Degradation of SLR1 in the GA Signaling Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cultivation Conditions of Plant Materials
2.2. Vector Construction and Transformation of Rice
2.3. Detection of Mutations in T0 Plants
2.4. Transgene-Free Mutant Lines Development
2.5. Protein Extraction and Western Blot/Antibody Analysis
2.6. Real-Time RNA Separation and Quantitative Polymerase Chain Reaction
2.7. Analysis of Statistical
3. Results
3.1. Overview of the Structure and Function of CSN1
3.2. OsCSN1 Mutation Homozygous Transgene-Free Mutant Lines Development in T0 Plants
3.3. Under Dark Conditions, Oscsn1 Mutants Exhibit Photomorphogenic Growth of Rice
3.4. Oscsn1 Mutants Phenotype Comparison under Different Light Conditions
3.5. GA Biosynthesis Characterization of Oscsn1 Null Mutants at the Seedling Stage
3.6. OsCSN1 Affects Seedling Growth via CUL4-Based E3 Ligase
4. Discussion
4.1. The Functional Difference between OsCSN1 and AtCSN1 Subunits in the Seedling Period
4.2. OsCSN1 Plays a Role in GA Signaling
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ruban, A.V. Plants in light. Commun. Integr. Biol. 2009, 2, 50–55. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.W.; Shao, K.H.; Wang, S.J. Light-mediated modulation of helix angle and rate of seminal root tip movement determines root morphology of young rice seedlings. Plant Signal. Behav. 2016, 11, e1141861. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deng, X.W.; Caspar, T.; Quail, P.H. cop1: A regulatory locus involved in light-controlled development and gene expression in Arabidopsis. Genes Dev. 1991, 5, 1172–1182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, N.; Xu, D.; Li, J.; Deng, X.W. COP9 signalosome: Discovery, conservation, activity, and function. J. Integr. Plant Biol. 2020, 62, 90–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chamovitz, D.A.; Wei, N.; Osterlund, M.T.; Von Arnim, A.G.; Staub, J.M.; Matsui, M.; Deng, X.W. The COP9 complex, a novel multisubunit nuclear regulator involved in light control of a plant developmental switch. Cell 1996, 86, 115–121. [Google Scholar] [CrossRef] [Green Version]
- Wei, N.; Chamovitz, D.A.; Deng, X.W. Arabidopsis COP9 is a component of a novel signaling complex mediating light control of development. Cell 1994, 78, 117–124. [Google Scholar] [CrossRef]
- Lingaraju, G.M.; Bunker, R.d.; Cavadini, S.; Hess, D.; Hassiepen, U.; Renatus, M.; Fischer, E.S.; Thomä, N.H. Crystal structure of the human COP9 signalosome. Nature 2014, 512, 161–165. [Google Scholar] [CrossRef]
- Glickman, M.H.; Rubin, D.M.; Coux, O.; Wefes, I.; Pfeifer, G.; Cjeka, Z.; Baumeister, W.; Fried, V.A.; Finley, D. A subcomplex of the proteasome regulatory particle required for ubiquitin-conjugate degradation and related to the COP9-signalosome and eIF3. Cell 1998, 94, 615–623. [Google Scholar] [CrossRef] [Green Version]
- Faull, S.V.; Lau, A.; Martens, C.; Ahdash, Z.; Hansen, K.; Yebenes, H.; Schmidt, C.; Beuron, F.; Cronin, N.B.; Morris, E.P.; et al. Structural basis of Cullin 2 RING E3 ligase regulation by the COP9 signalosome. Nat. Commun. 2019, 10, 3814. [Google Scholar] [CrossRef] [Green Version]
- Delker, C.; Sonntag, L.; James, G.V.; Janitza, P.; Ibañez, C.; Ziermann, H.; Peterson, T.; Denk, K.; Mull, S.; Ziegler, J.; et al. The DET1-COP1-HY5 pathway constitutes a multipurpose signaling module regulating plant photomorphogenesis and thermomorphogenesis. Cell Rep. 2014, 9, 1983–1989. [Google Scholar] [CrossRef]
- Zhang, H.Y.; Lei, G.; Zhou, H.W.; He, C.; Liao, J.L.; Huang, Y.J. Quantitative iTRAQ-based proteomic analysis of rice grains to assess high night temperature stress. Proteomics 2017, 17, 1600365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hauvermale, A.L.; Ariizumi, T.; Steber, C.M. Gibberellin signaling: A theme and variations on DELLA repression. Plant Physiol. 2012, 160, 83–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, D.; Wu, M.; Li, B.; Bücker, B.; Keil, P.; Zhang, S.; Li, J.; Kang, D.; Liu, J.; Dong, J.; et al. The COP9 Signalosome regulates seed germination by facilitating protein degradation of RGL2 and ABI5. PLoS Genet. 2018, 14, e1007237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dohmann, E.M.; Levesque, M.P.; De, V.L.; Reichardt, I.; Jürgens, G.; Schmid, M.; Schwechheimer, C. The Arabidopsis COP9 signalosome is essential for G2 phase progression and genomic stability. Development 2008, 135, 2013–2022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menon, S.; Chi, H.; Zhang, H.; Deng, X.W.; Flavell, R.A.; Wei, N. COP9 signalosome subunit 8 is essential for peripheral T cell homeostasis and antigen receptor–induced entry into the cell cycle from quiescence. Nat. Immunol. 2007, 8, 1236–1245. [Google Scholar] [CrossRef]
- Lee, J.H.; Yi, L.; Li, J.; Schweitzer, K.; Borgmann, M.; Naumann, M.; Wu, H. Crystal structure and versatile functional roles of the COP9 signalosome subunit 1. Proc. Natl. Acad. Sci. USA 2013, 110, 11845–11850. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Li, W.; Piqueras, R.; Cao, K.; Deng, X.W.; Wei, N. Regulation of COP1 nuclear localization by the COP9 signalosome via direct interaction with CSN1. Plant J. 2009, 58, 655–667. [Google Scholar] [CrossRef]
- Li, W.; Zang, B.; Liu, C.; Lu, L.; Wei, N.; Cao, K.; Deng, X.W.; Wang, X. TSA1 interacts with CSN1/CSN and may be functionally involved in Arabidopsis seedling development in darkness. J. Genet. Genom. 2011, 38, 539–546. [Google Scholar] [CrossRef]
- Tsuge, T.; Matsui, M.; Wei, N. The subunit 1 of the COP9 signalosome suppresses gene expression through its N-terminal domain and incorporates into the complex through the PCI domain. J. Mol. Biol. 2001, 305, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Kang, D.; Feng, S.; Serino, G.; Schwechheimer, C.; Wei, N. CSN1 N-terminal–dependent activity is required for Arabidopsis development but not for Rub1/Nedd8 deconjugation of cullins: A structure-function study of CSN1 subunit of COP9 signalosome. Mol. Biol. Cell 2002, 13, 646–655. [Google Scholar] [CrossRef]
- Wang, X.; Feng, S.; Nakayama, N.; Crosby, W.L.; Irish, V.; Deng, X.W.; Wei, N. The COP9 signalosome interacts with SCFUFO and participates in Arabidopsis flower development. Plant Cell 2003, 15, 1071–1082. [Google Scholar] [CrossRef] [Green Version]
- Dohmann, E.M.N.; Nill, C.; Schwechheimer, C. DELLA proteins restrain germination and elongation growth in Arabidopsis thaliana COP9 signalosome mutants. Eur. J. Cell Biol. 2010, 89, 163–168. [Google Scholar] [CrossRef]
- Shi, B.; Hou, J.; Yang, J.; Han, I.J.; Tu, D.; Ye, S.; Yu, J.; Li, L. Genome-wide analysis of the CSN genes in land plants and their expression under various abiotic stress and phytohormone conditions in rice. Gene 2022, 850, 146905. [Google Scholar] [CrossRef]
- Huang, X.; Wang, X.; Jia, H.; Feng, S.; Cao, K.; Sun, C. Isolation and mapping of rFUS6, a rice orthologue of Arabidopsis thaliana FUS6. DNA Res. 1999, 6, 375–379. [Google Scholar] [CrossRef] [Green Version]
- Kang, D.; Wang, X.; Cao, K.; Sun, C.; Deng, X.W.; Wei, N. A gain-of-function phenotype conferred by over-expression of functional subunits of the COP9 signalosome in Arabidopsis. Plant J. 2000, 23, 597–608. [Google Scholar] [CrossRef] [Green Version]
- Peth, A.; Berndt, C.; Henke, W.; Dubiel, W. Downregulation of COP9 signalosome subunits differentially affects the CSN complex and target protein stability. BMC Biotechnol. 2007, 8, 27. [Google Scholar] [CrossRef] [Green Version]
- Gelvin, S.B. Agrobacterium-mediated plant transformation: The biology behind the “gene-jockeying” tool. Microbiol. Mol. Biol. Rev. 2003, 67, 16–37. [Google Scholar] [CrossRef] [Green Version]
- Yang, D.L.; Yao, J.; Mei, C.S.; Tong, X.H.; Zeng, L.J.; Li, Q.; Xiao, L.T.; Sun, T.P.; Li, J.; Deng, X.W.; et al. Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling cascade. Proc. Natl. Acad. Sci. USA 2012, 109, E1192–E1200. [Google Scholar] [CrossRef] [Green Version]
- Ueguchi-Tanaka, M.; Nakajima, M.; Katoh, E.; Ohmiya, H.; Asano, K.; Saji, S.; Xiang, H.Y.; Motoyuki, A.; Hidemi, K.; Isomaro, Y.; et al. Molecular interactions of a soluble gibberellin receptor, GID1, with a rice DELLA protein, SLR1, and gibberellin. Plant Cell 2007, 19, 2140–2155. [Google Scholar] [CrossRef] [Green Version]
- Serino, G.; Su, H.; Peng, Z.; Tsuge, T.; Wei, N.; Gu, H.; Deng, X.W. Characterization of the last subunit of the Arabidopsis COP9 signalosome: Implications for the overall structure and origin of the complex. Plant Cell 2003, 15, 719–731. [Google Scholar] [CrossRef]
- Petroski, M.D.; Deshaies, R.J. Function and regulation of cullin–RING ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 2005, 6, 9–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Higa, L.A.A.; Mihaylov, I.S.; Banks, D.P.; Zheng, J.; Zhang, H. Radiation-mediated proteolysis of CDT1 by CUL4–ROC1 and CSN complexes constitutes a new checkpoint. Nat. Cell Biol. 2003, 5, 1008–1015. [Google Scholar] [CrossRef] [PubMed]
- Staub, J.M.; Wei, N.; Deng, X.W. Evidence for FUS6 as a component of the nuclear-localized COP9 complex in Arabidopsis. Plant Cell 1996, 8, 2047–2056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, H.; Zhang, X.; Liu, L.; Fu, Q.; Zang, C.; Ding, Y.; Su, Y.; Xu, Z.; He, S.; Yang, X.; et al. Basis for metabolite-dependent Cullin-RING ligase deneddylation by the COP9 signalosome. Proc. Natl. Acad. Sci. USA 2020, 117, 4117–4124. [Google Scholar] [CrossRef]
Primer | Sequence (5′–3′) | Purpose |
---|---|---|
RG1 | GCTATTTCTAGCTCTAAAAC-TGCGCGCTGGGATCGAAGGCT–TGCCACGGATCATCTGC | Plasmid construction |
RG2 | GCTATTTCTAGCTCTAAAAC-CTTGATCTCGTCATACGCCAT–TGCCACGGATCATCTGC | Plasmid construction |
RG3 | GCTATTTCTAGCTCTAAAACGAAATACGCGCTCGACCAGGT–TGCCACGGATCATCTGC | |
U3p3-F | CAGGAAACAGCTATGACCATATTCAAGGGATCTTTAAAC | Plasmid construction |
JD-F3 | CGTCTCGTCTCGCACTCTCGCATCG | Mutant detection |
JD-R508 | CCTGTAGCCATTGAGCTCGCTCTCG | Mutant detection |
Hygjc2-F | GTCCGTCAGGACATTGTTGGAGCC | Mutant detection |
Hygjc2-R | GTCTCCGACCTGATGCAGCTCTCGG | Mutant detection |
RTCas9-F | AAGCCCATCAGAGAGCAGG | Mutant detection |
RTCas9-R | TGTCGCCTCCCAGCTGAG | Mutant detection |
G1 | TGCGCGCTGGGATCGAAGGCT | sgRNA |
G2 | CTTGATCTCGTCATACGCCA | sgRNA |
G3 | GAAATACGCGCTCGACCAGG | sgRNA |
GAPDHF | AAGCCAGCATCCTATGATCAGATT | q RT-PCR |
GAPDHR | CGTAACCCAGAATACCCTTGAGTTT | q RT-PCR |
Dye-ABI5F | TGGGATCTGGCATGGTCAAC | q RT-PCR |
Dye-ABI5R | TACATGGCGTTTACCGGTCC | q RT-PCR |
Dye-SLR1F | CATGCTTTCCGAGCTCAACG | q RT-PCR |
Dye-SLR1R | TGACAGTGGACGAGGTGGAA | q RT-PCR |
Dye-CUL4F | AGGACAGACAGTATCAGGTGGATGC | q RT-PCR |
Dye-CUL4R | TCCGATGGCTTGATTGGGAACTTG | q RT-PCR |
Dye-CSN2F | GAGCAGCTCTTGGTCTCACTCATTC | q RT-PCR |
Dye-CSN2R | CGACCTGTCACCACGTTCTAGTAAC | q RT-PCR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Musazade, E.; Liu, Y.; Ren, Y.; Wu, M.; Zeng, H.; Han, S.; Gao, X.; Chen, S.; Guo, L. OsCSN1 Regulates the Growth and Development of Rice Seedlings through the Degradation of SLR1 in the GA Signaling Pathway. Agronomy 2022, 12, 2946. https://doi.org/10.3390/agronomy12122946
Musazade E, Liu Y, Ren Y, Wu M, Zeng H, Han S, Gao X, Chen S, Guo L. OsCSN1 Regulates the Growth and Development of Rice Seedlings through the Degradation of SLR1 in the GA Signaling Pathway. Agronomy. 2022; 12(12):2946. https://doi.org/10.3390/agronomy12122946
Chicago/Turabian StyleMusazade, Elshan, Yanxi Liu, Yixuan Ren, Ming Wu, Hua Zeng, Shining Han, Xiaowei Gao, Shuhua Chen, and Liquan Guo. 2022. "OsCSN1 Regulates the Growth and Development of Rice Seedlings through the Degradation of SLR1 in the GA Signaling Pathway" Agronomy 12, no. 12: 2946. https://doi.org/10.3390/agronomy12122946
APA StyleMusazade, E., Liu, Y., Ren, Y., Wu, M., Zeng, H., Han, S., Gao, X., Chen, S., & Guo, L. (2022). OsCSN1 Regulates the Growth and Development of Rice Seedlings through the Degradation of SLR1 in the GA Signaling Pathway. Agronomy, 12(12), 2946. https://doi.org/10.3390/agronomy12122946