Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED
Abstract
1. Introduction
2. Materials and Methods
2.1. Plants and Insects
2.2. Time of Application of PSB-06
2.3. Effect of PSB-06 on Plant Defense Pathways
2.3.1. Effects of PSB-06 on the SA and JA Pathways
2.3.2. Effects of PSB-06 on the Activities of Enzymes Related to Plant Defense
2.4. Effect of PSB-06 on Plant Photosynthesis-Related Pathways
2.4.1. Effects of PSB-06 on Plant Chlorophyll and Nitrogen Content
2.4.2. Effects of PSB-06 on Chlorophyll Development, Chlorophyll Metabolism and the Photosynthetic Gene Expression in Plants
2.5. The Indirect Effects of PSB-06 on the Acquisition and Transmission of B. tabaci MED
2.5.1. The Effect of PSB-06 on the Acquisition of B. tabaci MED
2.5.2. The Effect of PSB-06 on the Transmission of B. tabaci MED
2.6. Data Analysis
3. Results
3.1. Time of Application of PSB-06
3.2. Effect of PSB-06 on Plant Defense Pathways
3.2.1. Effects of PSB-06 on the Salicylic Acid and Jasmonic Acid Pathways
3.2.2. Effects of PSB-06 on the Activities of Enzymes Related to Plant Defense
3.3. Effect of PSB-06 on Plant Photosynthetic Pathways
3.3.1. Effects of PSB-06 on the Contents of Chlorophyll and Nitrogen
3.3.2. Effects of PSB-06 on the Development of Chlorophyll, Chlorophyll Metabolism and the Photosynthetic Gene Expression in Plants
3.4. The Indirect Effects of PSB-06 on the Acquisition and Transmission of ToCV by B. tabaci MED
3.4.1. The Effect of PSB-06 on the Acquisition of ToCV by B. tabaci MED
3.4.2. The Effect of PSB-06 on the Transmission of B. tabaci MED
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Qi, X.; Ren, Y.; Liang, P.; Wang, X. New insights in photosynthetic microbial fuel cell using anoxygenic phototrophic bacteria. Bioresour. Technol. 2018, 258, 310–317. [Google Scholar] [CrossRef] [PubMed]
- Gerhart, D. Forty-five years of developmental biology of photosynthetic bacteria. Photosynth. Res. 1996, 48, 325–352. [Google Scholar] [CrossRef] [PubMed]
- Gibson, J.; Stackebrandt, E.; Zablen, L.B.; Zablen, L.B.; Gupta, R.; Woese, C.R. A phylogenetic analysis of the purple photosynthetic bacteria. Curr. Microbiol. 1979, 3, 59–64. [Google Scholar] [CrossRef]
- Garcia-Chaves, M.C.; Cottrell, M.T.; Kirchman, D.L.; Ruiz-González, C.; Del Giorgio, P.A. Single-cell activity of freshwater aerobic anoxygenic phototrophic bacteria and their contribution to biomass production. ISME J. 2016, 10, 1579–1588. [Google Scholar] [CrossRef]
- Harada, N.; Nishiyama, M.; Otsuka, S.; Matsumoto, S. Effects of inoculation of phototrophic purple bacteria on grain yield of rice and nitrogenase activity of paddy soil in a pot experiment. Soil Sci. Plant Nutr. 2005, 51, 361–367. [Google Scholar] [CrossRef]
- Kobayashi, M.; Haque, M.Z. Contribution to nitrogen fixation and soil fertility by photosynthetic bacteria. Plant Soil 1971, 35, 443–456. [Google Scholar] [CrossRef]
- Cao, K.; Zhi, R.; Zhang, G. Photosynthetic bacteria wastewater treatment with the production of value-added products: A review. Bioresour. Technol. 2020, 299, 122648. [Google Scholar] [CrossRef] [PubMed]
- Zhai, Z.Y.; Du, J.; Chen, L.J.; Hamid, M.R.; Du, X.H.; Kong, X.T.; Cheng, J.; Tang, W.; Zhang, D.Y.; Su, P.; et al. A genetic tool for production of GFP-expressing Rhodopseudomonas palustris for visualization of bacterial colonization. AMB Express 2019, 9, 141. [Google Scholar] [CrossRef]
- Su, P.; Zhang, D.Y.; Zhang, Z.; Chen, A.; Hamid, M.R.; Li, C.G.; Du, J.; Cheng, J.E.; Tan, X.Q.; Zhen, L.M.; et al. Characterization of Rhodopseudomonas palustris population dynamics on tobacco phyllosphere and induction of plant resistance to Tobacco mosaic virus. Microb. Biotechnol. 2019, 12, 1453–1463. [Google Scholar] [CrossRef] [PubMed]
- Lakshmi, C.V.; Kumar, M.; Khanna, S. Biodegradation of chlorpyrifos in soil by enriched cultures. Curr. Microbiol. 2009, 58, 35–38. [Google Scholar] [CrossRef] [PubMed]
- Tallur, P.N.; Megadi, V.B.; Ninnekar, H.Z. Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1. Biodegradation 2008, 19, 77. [Google Scholar] [CrossRef] [PubMed]
- Basak, N.; Das, D. The prospect of purple Non-Sulfur (PNS) photosynthetic bacteria for hydrogen production: The present state of the Art. World J. Microbiol. Biotechnol. 2007, 23, 31–42. [Google Scholar] [CrossRef]
- Su, P.; Tan, X.Q.; Li, C.G.; Zhang, D.Y.; Cheng, J.E.; Zhang, S.B.; Zhou, X.G.; Yan, Q.P.; Peng, J.; Zhang, Z.; et al. Photosynthetic bacterium Rhodopseudomonas palustris GJ-22 induces systemic resistance against viruses. Microb. Biotechnol. 2017, 10, 612–624. [Google Scholar] [CrossRef]
- Wintermantel, W.M.; Wisler, G.C. Vector specificity, host range, and genetic diversity of Tomato chlorosis virus. Plant Dis. 2006, 90, 814–819. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Navas-Castillo, J. Tomato chlorosis virus, an emergent plant virus still expanding its geographical and host ranges. Mol. Plant Pathol. 2019, 20, 1307–1320. [Google Scholar] [CrossRef] [PubMed]
- Arruabarrena, A.; Rubio, L.; Gonzales-Arcos, M.; Maeso, D.; Fonseca, M.E.N.; Boiteux, L.S. First report of Tomato chlorosis virus infecting tomato crops in Uruguay. Plant Dis. 2014, 98, 1445. [Google Scholar] [CrossRef]
- Vargas, J.A.; Hammond, R.; Hernandez, E.; Barboza, N.; Mora, F.; Ramirez, P. First report of Tomato chlorosis virus infecting sweet pepper in Costa Rica. Plant Dis. 2011, 95, 1482. [Google Scholar] [CrossRef] [PubMed]
- Fiallo-olive, E.; Hamed, A.A.; Moriones, E.; Navas-Castillo, J. First report of Tomato chlorosis virus infecting tomato in Sudan. Plant Dis. 2011, 95, 1592. [Google Scholar] [CrossRef] [PubMed]
- Hirota, T.; Natsuaki, T.; Murai, T.; Nishigawa, H.; Niibori, K.; Goto, K.; Hartono, S.; Suastika, G.; Okuda, S. Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan. J. Gen. Plant Pathol. 2010, 76, 168–171. [Google Scholar] [CrossRef]
- Dalmon, A.; Bouyer, S.; Cailly, M.; Girard, M.; Lecoq, H.; Desbiez, C.; Jacquemond, M. First report of Tomato chlorosis virus and Tomato infectious chlorosis virus in tomato crops in France. Plant Dis. 2005, 89, 1243. [Google Scholar] [CrossRef]
- Gilbertson, R.L.; Batuman, O.; Webster, C.G.; Adkins, S. Role of the insect supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global spread of plant viruses. Annu. Rev. Virol. 2015, 2, 67–93. [Google Scholar] [CrossRef] [PubMed]
- Fortes, I.M.; Fernández-Muñoz, R.; Moriones, E. Host Plant Resistance to Bemisia tabaci to control damage caused in tomato plants by the emerging crinivirus Tomato chlorosis virus. Front. Plant Sci. 2020, 11, 585510. [Google Scholar] [CrossRef]
- Orfanidou, C.G.; Pappi, P.G.; Efthimiou, K.E.; Katis, N.I.; Maliogka, V.I. Transmission of Tomato chlorosis virus (ToCV) by Bemisia tabaci biotype Q and evaluation of four weed species as viral sources. Plant Dis. 2016, 100, 2043–2049. [Google Scholar] [CrossRef]
- Koh, R.H.; Song, H.G. Effects of application of Rhodopseudomonas sp. on seed germination and growth of tomato under axenic conditions. J. Microbiol. Biotechnol. 2007, 17, 1805–1810. [Google Scholar] [PubMed]
- Su, P.; Feng, T.Z.; Zhou, X.G.; Zhang, S.B.; Zhang, Y.; Cheng, J.; Luo, Y.H.; Peng, J.; Zhang, Z.; Lu, X.Y.; et al. Isolation of Rhp-PSP, a member of YER057c/YjgF/UK114 protein family with antiviral properties, from the photosynthetic bacterium Rhodopseudomonas palustris strain JSC-3b. Sci. Rep. 2015, 4, 16121. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.H.; Koh, R.H.; Song, H.G. Enhancement of growth and yield of tomato by Rhodopseudomonas sp. under greenhouse conditions. J. Microbiol. 2008, 46, 641–646. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Pan, H.; Xie, W.; Wu, Q.; Wang, S.; Liu, Y.; Fang, Y.; Chen, G.; Gao, X.W.; Zhang, Y.J. Plant virus differentially alters the plant’s defense response to its closely related vectors. PLoS ONE 2013, 8, e83520. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.B.; Chen, G.; Pan, H.P.; Xie, W.; Wu, Q.J.; Wang, S.L.; Liu, Y.; Zhou, X.G.; Zhang, Y.J. Plants pre-infested with viruliferous MED/Q cryptic species promotes subsequent bemisia tabaci infestation. Front. Microbiol. 2018, 9, 1404. [Google Scholar] [CrossRef]
- Chu, D.; Wan, F.H.; Zhang, Y.J.; Brown, J.K. Change in the biotype composition of Bemisia tabaci in Shandong province of China from 2005 to 2008. Environ. Entomol. 2010, 39, 1028–1036. [Google Scholar] [CrossRef]
- Tang, X.; Shi, X.B.; Zhang, D.Y.; Li, F.; Yan, F.; Zhang, Y.J.; Liu, Y.; Zhou, X.G. Detection and epidemic dynamic of ToCV and CCYV with MED and weed in Hainan of China. Virol. J. 2017, 14, 169. [Google Scholar] [CrossRef]
- Shi, X.B.; Tang, X.; Zhang, X.; Zhang, D.Y.; Li, F.; Yan, F.; Zhang, Y.J.; Zhou, X.G.; Liu, Y. Transmission efficiency, preference and behavior of Bemisia tabaci MEAM1 and MED under the influence of Tomato chlorosis virus. Front. Plant Sci. 2017, 8, 2271. [Google Scholar] [CrossRef]
- Shi, X.B.; Wang, X.Z.; Zhang, D.Y.; Zhang, Z.H.; Zhang, Z.; Cheng, J.; Zheng, L.M.; Zhou, X.G.; Tan, X.Q.; Liu, Y. Silencing of odorant-binding protein gene OBP3 using RNA interference reduced virus transmission of Tomato chlorosis virus. Int. J. Mol. Sci. 2019, 20, 4969. [Google Scholar] [CrossRef]
- Lett, J.M.; Hoareau, M.; Reynaud, B.; Saison, A.; Hostachy, B.; Lobin, K.; Benimadhu, S.P. First report of Tomato chlorosis virus in tomato on Mauritius island. Plant Dis. 2009, 93, 111. [Google Scholar] [CrossRef]
- Luo, L.Y.; Wang, P.; Zhai, Z.Y.; Su, P.; Tan, X.Q.; Zhang, D.Y.; Zhang, Z.; Liu, Y. The effects of Rhodopseudomonas palustris PSB06 and CGA009 with different agricultural applications on rice growth and rhizosphere bacterial communities. AMB Express 2019, 9, 173. [Google Scholar] [CrossRef]
- Fiallo, O.E.; Espino, A.I.; Botella, G.M.; Gómez, G.E.; Reyes, C.J.A.; Navas, C.J. Tobacco: A new natural host of Tomato chlorosis virus in Spain. Plant Dis. 2014, 98, 1162. [Google Scholar] [CrossRef]
- Pentzold, S.; Jensen, M.K.; Matthes, A.; Olsen, C.E.; Petersen, B.L.; Clausen, H.; Moller, B.L.; Bak, S.; Zagrobelny, M. Spatial separation of the cyanogenic β-glucosidase ZfBGD2 and cyanogenic glucosides in the haemolymph of Zygaena larvae facilitates cyanide release. R. Soc. Opensci 2017, 4, 170262. [Google Scholar] [CrossRef]
- Mascia, T.; Santovito, E.; Gallitelli, D.; Cillo, F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010, 11, 805–816. [Google Scholar] [CrossRef]
- Zhou, S.; Cheng, X.; Li, F.; Feng, P.; Hu, G.; Chen, G.; Xie, Q.; Hu, Z. Overexpression of SlOFP20 in tomato affects plant growth, chlorophyll accumulation, and leaf senescence. Front. Plant Sci. 2019, 29, 1510. [Google Scholar]
- Maluta, N.K.P.; Lopes, J.R.S.; Fiallo-Olive, E.; Navas-Castillo, J.; Lourencao, A.L. Foliar spraying of tomato plants with systemic insecticides: Effects on feeding behavior, mortality and oviposition of Bemisia tabaci (Hemiptera: Aleyrodidae) and inoculation efficiency of Tomato chlorosis virus. Insects 2020, 11, 559. [Google Scholar]
- Carmo-Sousa, M.; Garcia, R.B.; Wulff, N.A.; Fereres, A.; Miranda, M.P. Drench application of systemic insecticides disrupts probing behavior of Diaphorina citri (Hemiptera: Liviidae) and inoculation of Candidatus Liberibacter asiaticus. Insects 2020, 11, 314. [Google Scholar]
- Castle, S.; Palumbo, J.; Merten, P.; Cowden, C.; Prabhaker, N. Effects of foliar and systemic insecticides on whitefly transmission and incidence of Cucurbit yellow stunting disorder virus. Pest. Manag. Sci. 2017, 73, 1462–1471. [Google Scholar] [CrossRef] [PubMed]
- Favara, G.M.; Bampi, D.; Molina, J.P.E.; Rezende, J.A.M. Kinetics of Systemic Invasion and Latent and Incubation Periods of Tomato severe rugose virus and Tomato chlorosis virus in Single and Co-Infections in Tomato Plants. Phytopathology 2019, 109, 480–487. [Google Scholar] [CrossRef] [PubMed]
- Esquivel-Farina, A.; Rezende, J.A.M.; Wintermantel, W.M.; Hladky, L.J.; Bampi, D. Tomato chlorosis virus natural infection rate of known-susceptible hosts and the influence of the host plant on the virus relationship with MEAM1. Plant. Dis. 2021, 105, 1390–1397. [Google Scholar] [CrossRef] [PubMed]
- Grayer, R.J.; Kokubun, T. ChemInform abstract: Plant-fungal interactions: The search for phytoalexins and other antifungal compounds from higher plants. Phytochemistry 2001, 56, 253–263. [Google Scholar] [CrossRef]
- Zhang, P.; Sun, F.F.; Cheng, X.; Li, X.J.; Mu, H.B.; Wang, S.C.; Geng, H.L.; Duan, J.Y. Preparation and biological activities of an extracellular polysaccharide from Rhodopseudomonas palustris. Int. J. Biol. Macromol. 2019, 131, 933–940. [Google Scholar] [CrossRef]
- Maurhofer, M.; Reimmann, C.; Schmidli-Sacherer, P.; Heeb, S.; Haas, D.; Defago, G. Salicylic acid biosynthetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of systemic resistance in tobacco against Tobacco necrosis virus. Phytopathology 1998, 88, 678–684. [Google Scholar] [CrossRef]
- Amutharaj, P.; Sekar, C.; Natheer, S.E. Development and use of different formulations of Pseudomonas fluorescens siderophore for the enhancement of plant growth and induction of systemic resistance against Pyricularia Oryzae in lowland rice. Int. J. Pharm. Bio. Sci. 2013, 4, B831–B838. [Google Scholar]
- Gamez, R.M.; Rodriguez, F.; Vidal, N.M.; Ramirez, S.; Vera Alvarez, R.; Landsman, D.; Marino-Ramírez, L. Banana (Musa acuminata) transcriptome profiling in response to rhizobacteria: Bacillus amyloliquefaciens Bs006 and Pseudomonas fluorescens Ps006. BMC Genom. 2019, 20, 378. [Google Scholar] [CrossRef]
- Li, R.; Weldegergis, B.T.; Li, J.; Jung, C.; Qu, J.; Sun, Y.; Qian, H.; Tee, C.; van Loon, J.J.; Dicke, M.; et al. Virulence factors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance. Plant Cell 2014, 26, 4991–5008. [Google Scholar] [CrossRef]
- Wu, Y.J.; Ma, L.Y.; Liu, Q.Z.; Sikder, M.M.; Vestergard, M.; Zhou, K.Y.; Wang, Q.; Yang, X.E.; Feng, Y. Pseudomonas fluorescens promote photosynthesis, carbon fixation and cadmium phytoremediation of hyperaccumulator Sedum alfredii. Sci. Total Environ. 2020, 726, 138554. [Google Scholar]
- Chen, B.; Luo, S.; Wu, Y.; Ye, J.; Wang, Q.; Xu, X.; Pan, F.; Khan, K.Y.; Feng, Y.; Yang, X. The effects of the endophytic bacterium pseudomonas fluorescens Sasm05 and IAA on the plant growth and cadmium uptake of sedum alfredii hance. Front. Microbiol. 2017, 8, 2538. [Google Scholar] [CrossRef] [PubMed]
- Martin-Rivilla, H.; Garcia-Villaraco, A.; Ramos-Solano, B.; Gutierrez-Manero, F.J.; Lucas, J.A. Improving flavonoid metabolism in blackberry leaves and plant fitness by using the bioeffector Pseudomonas fluorescens N 21.4 and its metabolic elicitors: A biotechnological approach for a more sustainable crop. J. Agric. Food Chem. 2020, 68, 6170–6180. [Google Scholar] [CrossRef] [PubMed]
- Meng, L.; Fan, Z.; Zhang, Q.; Wang, C.; Gao, Y.; Deng, Y.; Zhu, B.; Zhu, H.; Chen, J.; Shan, W.; et al. BEL1-LIKE HOMEODOMAIN 11 regulates chloroplast development and chlorophyll synthesis in tomato fruit. Plant J. 2018, 94, 1126–1140. [Google Scholar] [CrossRef] [PubMed]
- Perveen, S.; Qu, M.; Chen, F.; Essemine, J.; Khan, N.; Lyu, M.A.; Chang, T.; Song, Q.; Chen, G.Y.; Zhu, X.G. Overexpression of maize transcription factor mEmBP-1 increases photosynthesis, biomass, and yield in rice. J. Exp. Bot. 2020, 71, 4944–4957. [Google Scholar] [CrossRef]





| Gene | Description | Primer Sequence (5′-3′) |
|---|---|---|
| mt COI | amplification of mt COI | F: CTGAATATCGRCGAGGCATTCC |
| R: TTGATTTTTTGGTCATCCAGAAGT | ||
| HSP70h | ToCV RT-PCR | F: GGTTTGGATTTTGGTACTACATTCAGT |
| R: AAACTGCCTGCATGAAAAGTCTC | ||
| ToCV-q | ToCV qPCR | F: TTGTTCCTCTTTGGGTTTC |
| R: CGAATCTCCCTGGGTATC | ||
| ACT | tomato plant reference gene | F: AGGCAGGATTTGCTGGTGATGATGCT |
| R: ATACGCATCCTTCTGTCCCATTCCGA | ||
| UBI | tomato plant reference gene | F: TCGTAAGGAGTGCCCTAATGCTGA |
| R: CAATCGCCTCCAGCCTTGTTGTAA | ||
| Actin | B. tabaci reference gene | F: CGCTGCCTCCACCTCATT |
| R: ACCGCAAGATTCCATACCC | ||
| EF-1α | B. tabaci reference gene | F: TAGCCTTGTGCCAATTTCCG |
| R: CCTTCAGCATTACCGTCC | ||
| CHLH | qPCR | F: GCTTTGGACCCACAGGCTAT |
| R: CTGTGCCAACGACTCTCCAT | ||
| CHLM | qPCR | F: AAGAAGGTGCCATTGTATCAG |
| R: CCATCCAAACTCTCCAAGTC | ||
| POR | qPCR | F: GCATCACATTTGCCTCCCTA |
| R: GAGTTCTTGTTCCAGCTCCAGTAC | ||
| PAO | qPCR | F: CGAAATTGGCTTAGACGGCAT |
| R: ATCTGTCCATCATCTGGCGTT | ||
| PPH | qPCR | F: TGAGGTAACAGAACACCCTGC |
| R: TCATTCGACACCCAGTCAGTG | ||
| SGR1 | qPCR | F: ACTAGAAGGAAATGCAAGAAGAATCA |
| R: GCAACTTTCCTGGATGCTTTTC | ||
| Cab7 | qPCR | F: TAGACTTGCTATGTTAGCCGTTATG |
| R: TTCTGCTTCTCACTTGGGACTG | ||
| rbcS | qPCR | F: TGCTCAGCGAAATTGAGTACCTAT |
| R: AACTTCCACATGGTCCAGTATCTG | ||
| LHCA1 | qPCR | F: GATGCCGGTCTACGTTGGAG |
| R: AATCCAAAATCTCCGGGGGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, D.; Yue, H.; Chen, J.; Wei, Y.; Zhang, Z.; Zeng, J.; Zhang, Z.; Zhou, X.; Zheng, L.; Gao, Y.; et al. Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED. Agronomy 2022, 12, 2631. https://doi.org/10.3390/agronomy12112631
Lu D, Yue H, Chen J, Wei Y, Zhang Z, Zeng J, Zhang Z, Zhou X, Zheng L, Gao Y, et al. Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED. Agronomy. 2022; 12(11):2631. https://doi.org/10.3390/agronomy12112631
Chicago/Turabian StyleLu, Dingyihui, Hao Yue, Jianbin Chen, Yan Wei, Zhanhong Zhang, Jun Zeng, Zhuo Zhang, Xuguo Zhou, Limin Zheng, Yang Gao, and et al. 2022. "Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED" Agronomy 12, no. 11: 2631. https://doi.org/10.3390/agronomy12112631
APA StyleLu, D., Yue, H., Chen, J., Wei, Y., Zhang, Z., Zeng, J., Zhang, Z., Zhou, X., Zheng, L., Gao, Y., Peng, J., Shi, X., Liu, Y., & Zhang, D. (2022). Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED. Agronomy, 12(11), 2631. https://doi.org/10.3390/agronomy12112631

