Genome-Wide In Silico Analysis and Expression Profiling of Phosphoenolpyruvate Carboxylase Genes in Loquat, Apple, Peach, Strawberry and Pear
Abstract
:1. Introduction
2. Materials and Methods
2.1. Identification and Characterization of PEPC Genes
2.2. Phylogenetic Analyses
2.3. Gene Structure, Conserved Motif and Promoter Region Analysis of PEPC Genes
2.4. Syntenic Analysis of PEPCs in Five Rosaceae Species
2.5. Ka and Ks Calculation
2.6. RNA Isolation and Quantitative RT-PCR Analysis
3. Results
3.1. Identification and Characterization of PEPC Gene Family in Five Rosaceae Species
3.2. Phylogenetic Analysis of PEPC Genes in Five Rosaceae Species
3.3. Conserved Motif Analysis of PEPC Genes of Five Rosaceae Species
3.4. Promoter Region Analysis of PEPCs in Five Rosaceae Species
3.5. Syntenic Analysis of PEPC Genes in Five Rosaceae Species
3.6. Expression Patterns of PEPC genes in Five Rosacea Species
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Izui, K.; Matsumura, H.; Furumoto, T.; Kai, Y. PHOSPHO ENOL PYRUVATE CARBOXYLASE: A New Era of Structural Biology. Annu. Rev. Plant Biol. 2004, 55, 69–84. [Google Scholar] [CrossRef]
- O’Leary, B.; Park, J.; Plaxton, W.C. The remarkable diversity of plant PEPC (phosphoenolpyruvate carboxylase): Recent insights into the physiological functions and post-translational controls of non-photosynthetic PEPCs. Biochem. J. 2011, 436, 15–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Leary, B.; Fedosejevs, E.T.; Hill, A.T.; Bettridge, J.; Park, J.; Rao, S.K.; Leach, C.A.; Plaxton, W.C. Tissue-specific expression and post-translational modifications of plant- and bacterial-type phosphoenolpyruvate carboxylase isozymes of the castor oil plant, Ricinus communis L. J. Exp. Bot. 2011, 62, 5485–5495. [Google Scholar] [CrossRef] [Green Version]
- Cousins, A.B.; Baroli, I.; Badger, M.R.; Ivakov, A.; Lea, P.J.; Leegood, R.C.; von Caemmerer, S. The Role of Phospho enol pyruvate Carboxylase during C4 Photosynthetic Isotope Exchange and Stomatal Conductance. Plant Physiol. 2007, 145, 1006–1017. [Google Scholar] [CrossRef] [Green Version]
- Wang, N.; Zhong, X.; Cong, Y.; Wang, T.; Yang, S.; Li, Y.; Gai, J. Genome-wide Analysis of Phosphoenolpyruvate Carboxylase Gene Family and Their Response to Abiotic Stresses in Soybean. Sci. Rep. 2016, 6, 38448. [Google Scholar] [CrossRef] [PubMed]
- Pan, T.; Ali, M.M.; Gong, J.; She, W.; Pan, D.; Guo, Z.; Yu, Y.; Chen, F. Fruit Physiology and Sugar-Acid Profile of 24 Pomelo (Citrus grandis (L.) Osbeck) Cultivars Grown in Subtropical Region of China. Agronomy 2021, 11, 2393. [Google Scholar] [CrossRef]
- Ma, B.; Yuan, Y.; Gao, M.; Qi, T.; Li, M.; Ma, F. Genome-Wide Identification, Molecular Evolution, and Expression Divergence of Aluminum-Activated Malate Transporters in Apples. Int. J. Mol. Sci. 2018, 19, 2807. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Wei, X.; Ali, M.M.; Rizwan, H.M.; Li, B.; Li, H.; Jia, K.; Yang, X.; Ma, S.; Li, S.; et al. Changes in the Content of Organic Acids and Expression Analysis of Citric Acid Accumulation-Related Genes during Fruit Development of Yellow (Passiflora edulis f. flavicarpa) and Purple (Passiflora edulis f. edulis) Passion Fruits. Int. J. Mol. Sci. 2021, 22, 5765. [Google Scholar] [CrossRef]
- Meyer, S.; De Angeli, A.; Fernie, A.R.; Martinoia, E. Intra- and extra-cellular excretion of carboxylates. Trends Plant Sci. 2010, 15, 40–47. [Google Scholar] [CrossRef] [Green Version]
- Ryan, P.R.; Skerrett, M.; Findlay, G.P.; Delhaize, E.; Tyerman, S.D. Aluminum activates an anion channel in the apical cells of wheat roots. Proc. Natl. Acad. Sci. USA 1997, 94, 6547–6552. [Google Scholar] [CrossRef] [Green Version]
- Ma, B.; Liao, L.; Zheng, H.; Chen, J.; Wu, B.; Ogutu, C.; Li, S.; Korban, S.S.; Han, Y. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple. Plant Genome 2015, 8. [Google Scholar] [CrossRef] [Green Version]
- Sánchez, R.; Cejudo, F.J. Identification and Expression Analysis of a Gene Encoding a Bacterial-Type Phospho enol pyruvate Carboxylase from Arabidopsis and Rice. Plant Physiol. 2003, 132, 949–957. [Google Scholar] [CrossRef] [Green Version]
- Murmu, J.; Plaxton, W.C. Phosphoenolpyruvate carboxylase protein kinase from developing castor oil seeds: Partial purification, characterization, and reversible control by photosynthate supply. Planta 2007, 226, 1299–1310. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, T.; Izumi, T.; Banba, M.; Umehara, Y.; Kouchi, H.; Izui, K.; Hata, S. Characterization and Expression Analysis of Genes Encoding Phosphoenolpyruvate Carboxylase and Phosphoenolpyruvate Carboxylase Kinase of Lotus japonicus, a Model Legume. Mol. Plant-Microbe Interact. 2003, 16, 281–288. [Google Scholar] [CrossRef]
- Rontein, D.; Dieuaide-Noubhani, M.; Dufourc, E.J.; Raymond, P.; Rolin, D. The Metabolic Architecture of Plant Cells. J. Biol. Chem. 2002, 277, 43948–43960. [Google Scholar] [CrossRef] [Green Version]
- Sima, B.D.; Desjardins, Y. Sucrose supply enhances phosphoenolpyruvate carboxylase phosphorylation level in in vitro Solanum tuberosum. Plant Cell. Tissue Organ Cult. 2001, 67, 235–242. [Google Scholar] [CrossRef]
- Duff, S.; Chollet, R. In Vivo Regulation of Wheat-Leaf Phosphoenolpyruvate Carboxylase by Reversible Phosphorylation. Plant Physiol. 1995, 107, 775–782. [Google Scholar] [CrossRef] [Green Version]
- Engelmann, S.; Blesing, O.E.; Gowik, U.; Svensson, P.; Westhoff, P. Molecular evolution of C4 phosphoenolpyruvate carboxylase in the genus Flaveria? A gradual increase from C3 to C4 characteristics. Planta 2003, 217, 717–725. [Google Scholar] [CrossRef]
- Jiang, S.; An, H.; Xu, F.; Zhang, X. Chromosome-level genome assembly and annotation of the loquat (Eriobotrya japonica) genome. Gigascience 2020, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daccord, N.; Celton, J.-M.; Linsmith, G.; Becker, C.; Choisne, N.; Schijlen, E.; van de Geest, H.; Bianco, L.; Micheletti, D.; Velasco, R.; et al. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nat. Genet. 2017, 49, 1099–1106. [Google Scholar] [CrossRef]
- Chagné, D.; Crowhurst, R.N.; Pindo, M.; Thrimawithana, A.; Deng, C.; Ireland, H.; Fiers, M.; Dzierzon, H.; Cestaro, A.; Fontana, P.; et al. The Draft Genome Sequence of European Pear (Pyrus communis L. ‘Bartlett’). PLoS ONE 2014, 9, e92644. [Google Scholar] [CrossRef] [PubMed]
- Feria, A.B.; Bosch, N.; Sánchez, A.; Nieto-Ingelmo, A.I.; de la Osa, C.; Echevarría, C.; García-Mauriño, S.; Monreal, J.A. Phosphoenolpyruvate carboxylase (PEPC) and PEPC-kinase (PEPC-k) isoenzymes in Arabidopsis thaliana: Role in control and abiotic stress conditions. Planta 2016, 244, 901–913. [Google Scholar] [CrossRef] [PubMed]
- Finn, R.D.; Mistry, J.; Tate, J.; Coggill, P.; Heger, A.; Pollington, J.E.; Gavin, O.L.; Gunasekaran, P.; Ceric, G.; Forslund, K.; et al. The Pfam protein families database. Nucleic Acids Res. 2010, 38, D211–D222. [Google Scholar] [CrossRef] [PubMed]
- Eddy, S.R. Accelerated Profile HMM Searches. PLoS Comput. Biol. 2011, 7, e1002195. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.-H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef] [Green Version]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef] [Green Version]
- Gan, X.; Jing, Y.; Shahid, M.Q.; He, Y.; Baloch, F.S.; Lin, S.; Yang, X. Identification, phylogenetic analysis, and expression patterns of the SAUR gene family in loquat (Eriobotrya japonica). Turkish J. Agric. For. 2020, 44, 15–23. [Google Scholar] [CrossRef]
- Wang, D.; Zhang, Y.; Zhang, Z.; Zhu, J.; Yu, J. KaKs_Calculator 2.0: A Toolkit Incorporating Gamma-Series Methods and Sliding Window Strategies. Genom. Proteom. Bioinform. 2010, 8, 77–80. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- De Rossi, S.; Di Marco, G.; Bruno, L.; Gismondi, A.; Canini, A. Investigating the Drought and Salinity Effect on the Redox Components of Sulla coronaria (L.) Medik. Antioxidants 2021, 10, 1048. [Google Scholar] [CrossRef]
- Xu, L.; Xu, H.; Cao, Y.; Yang, P.; Feng, Y.; Tang, Y.; Yuan, S.; Ming, J. Validation of Reference Genes for Quantitative Real-Time PCR during Bicolor Tepal Development in Asiatic Hybrid Lilies (Lilium spp.). Front. Plant Sci. 2017, 8, 669. [Google Scholar] [CrossRef] [Green Version]
- Xue, C.; Guan, S.-C.; Chen, J.-Q.; Wen, C.-J.; Cai, J.-F.; Chen, X. Genome wide identification and functional characterization of strawberry pectin methylesterases related to fruit softening. BMC Plant Biol. 2020, 20, 13. [Google Scholar] [CrossRef]
- Lu, B.; Wang, Y.; Zhang, G.; Feng, Y.; Yan, Z.; Wu, J.; Chen, X. Genome-Wide Identification and Expression Analysis of the Strawberry FvbZIP Gene Family and the Role of Key Gene FabZIP46 in Fruit Resistance to Gray Mold. Plants 2020, 9, 1199. [Google Scholar] [CrossRef]
- Zhang, M.-Y.; Xue, C.; Hu, H.; Li, J.; Xue, Y.; Wang, R.; Fan, J.; Zou, C.; Tao, S.; Qin, M.; et al. Genome-wide association studies provide insights into the genetic determination of fruit traits of pear. Nat. Commun. 2021, 12, 1144. [Google Scholar] [CrossRef]
- Akhunov, E.D.; Sehgal, S.; Liang, H.; Wang, S.; Akhunova, A.R.; Kaur, G.; Li, W.; Forrest, K.L.; See, D.; Šimková, H.; et al. Comparative Analysis of Syntenic Genes in Grass Genomes Reveals Accelerated Rates of Gene Structure and Coding Sequence Evolution in Polyploid Wheat. Plant Physiol. 2012, 161, 252–265. [Google Scholar] [CrossRef] [Green Version]
- Verde, I.; Jenkins, J.; Dondini, L.; Micali, S.; Pagliarani, G.; Vendramin, E.; Paris, R.; Aramini, V.; Gazza, L.; Rossini, L.; et al. The Peach v2.0 release: High-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC Genom. 2017, 18, 225. [Google Scholar] [CrossRef] [Green Version]
- Cheng, H.; Li, J.; Zhang, H.; Cai, B.; Gao, Z.; Qiao, Y.; Mi, L. The complete chloroplast genome sequence of strawberry (Fragaria × ananassa Duch.) and comparison with related species of Rosaceae. PeerJ 2017, 5, e3919. [Google Scholar] [CrossRef] [Green Version]
- Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-Wide Analysis of the ERF Gene Family in Arabidopsis and Rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Zhou, H.; Ma, B.; Owiti, A.; Korban, S.S.; Han, Y. Divergent Evolutionary Pattern of Sugar Transporter Genes is Associated with the Difference in Sugar Accumulation between Grasses and Eudicots. Sci. Rep. 2016, 6, 29153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- García-Mauriño, S.; Monreal, J.; Alvarez, R.; Vidal, J.; Echevarría, C. Characterization of salt stress-enhanced phosphoenolpyruvate carboxylase kinase activity in leaves of Sorghum vulgare: Independence from osmotic stress, involvement of ion toxicity and significance of dark phosphorylation. Planta 2003, 216, 648–655. [Google Scholar] [CrossRef]
- González, M.-C.; Sánchez, R.; Cejudo, F.J. Abiotic stresses affecting water balance induce phosphoenolpyruvate carboxylase expression in roots of wheat seedlings. Planta 2003, 216, 985–992. [Google Scholar] [CrossRef]
- Sánchez, R.; Flores, A.; Cejudo, F.J. Arabidopsis phosphoenolpyruvate carboxylase genes encode immunologically unrelated polypeptides and are differentially expressed in response to drought and salt stress. Planta 2006, 223, 901–909. [Google Scholar] [CrossRef]
- Bandyopadhyay, A.; Datta, K.; Zhang, J.; Yang, W.; Raychaudhuri, S.; Miyao, M.; Datta, S.K. Enhanced photosynthesis rate in genetically engineered indica rice expressing pepc gene cloned from maize. Plant Sci. 2007, 172, 1204–1209. [Google Scholar] [CrossRef]
- Linlin, X.; Xin, Q.; Mingyue, Z.; Shaoling, Z. Genome-Wide analysis of aluminum-activated malate transporter family genes in six rosaceae species, and expression analysis and functional characterization on malate accumulation in Chinese white pear. Plant Sci. 2018, 274, 451–465. [Google Scholar] [CrossRef]
- Friedman, R.; Hughes, A.L. Pattern and Timing of Gene Duplication in Animal Genomes. Genome Res. 2001, 11, 1842–1847. [Google Scholar] [CrossRef]
- Moore, R.C.; Purugganan, M.D. The early stages of duplicate gene evolution. Proc. Natl. Acad. Sci. USA 2003, 100, 15682–15687. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Wang, X.; Paterson, A.H. Genome and gene duplications and gene expression divergence: A view from plants. Ann. N. Y. Acad. Sci. 2012, 1256, 1–14. [Google Scholar] [CrossRef]
- Zhou, H.; Qi, K.; Liu, X.; Yin, H.; Wang, P.; Chen, J.; Wu, J.; Zhang, S. Genome-wide identification and comparative analysis of the cation proton antiporters family in pear and four other Rosaceae species. Mol. Genet. Genom. 2016, 291, 1727–1742. [Google Scholar] [CrossRef]
- Ma, C.; Zhang, H.; Li, J.; Tao, S.; Qiao, X.; Korban, S.S.; Zhang, S.; Wu, J. Genome-wide analysis and characterization of molecular evolution of the HCT gene family in pear (Pyrus bretschneideri). Plant Syst. Evol. 2017, 303, 71–90. [Google Scholar] [CrossRef]
- Freeling, M. Bias in Plant Gene Content Following Different Sorts of Duplication: Tandem, Whole-Genome, Segmental, or by Transposition. Annu. Rev. Plant Biol. 2009, 60, 433–453. [Google Scholar] [CrossRef]
- Du, D.; Hao, R.; Cheng, T.; Pan, H.; Yang, W.; Wang, J.; Zhang, Q. Genome-Wide Analysis of the AP2/ERF Gene Family in Prunus mume. Plant Mol. Biol. Rep. 2013, 31, 741–750. [Google Scholar] [CrossRef]
- Guo, C.; Guo, R.; Xu, X.; Gao, M.; Li, X.; Song, J.; Zheng, Y.; Wang, X. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family. J. Exp. Bot. 2014, 65, 1513–1528. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Wang, Z.; Shi, Z.; Zhang, S.; Ming, R.; Zhu, S.; Khan, M.A.; Tao, S.; Korban, S.S.; Wang, H.; et al. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res. 2013, 23, 396–408. [Google Scholar] [CrossRef] [Green Version]
- Gregory, A.L.; Hurley, B.A.; Tran, H.T.; Valentine, A.J.; She, Y.-M.; Knowles, V.L.; Plaxton, W.C. In vivo regulatory phosphorylation of the phosphoenolpyruvate carboxylase AtPPC1 in phosphate-starved Arabidopsis thaliana. Biochem. J. 2009, 420, 57–65. [Google Scholar] [CrossRef] [Green Version]
- Xu, W.; Zhou, Y.; Chollet, R. Identification and expression of a soybean nodule-enhanced PEP-carboxylase kinase gene (NE-PpcK) that shows striking up-/down-regulation in vivo. Plant J. 2003, 34, 441–452. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.M.; Alam, S.M.; Anwar, R.; Ali, S.; Shi, M.; Liang, D.; Lin, Z.; Chen, F. Genome-Wide Identification, Characterization and Expression Profiling of Aluminum-Activated Malate Transporters in Eriobotrya japonica Lindl. Horticulturae 2021, 7, 441. [Google Scholar] [CrossRef]
Specie | Gene | Forward Primer (5′-3′) | TmF (°C) | Reverse Primer (5′-3′) | TmR (°C) |
---|---|---|---|---|---|
Eriobotrya japonica | EVM0016068.1 | GCAGTTCTTGGAACCTCTCG | 59.8 | CCAATTTCCAGATGCTTGGT | 57.8 |
EVM0004511.1 | TTGCTGATGGAAGCCTTCTT | 57.8 | TGAGACACGAGCCATTCTTG | 59.9 | |
EVM0023388.1 | GCAGTTCTTGGAACCTCTCG | 55.8 | CCAATTTCCAGATGCTTGGT | 57.8 | |
EVM0022212.1 | TGGAGCCTCTCGAACTTTGT | 58.9 | CATTCTTGCCTACGCTCCTC | 58.9 | |
EVM0004523.1 (actin) | GGAGCGTGGATATTCCTTCA | 57.8 | GCTGCTTCCATTCCAATCAT | 55.8 | |
Malus domestica | MD03G1242000 | AGGTCACAAGGGATGTTTGC | 57.8 | ACCGAGAATCACACGGTAGG | 59.9 |
MD09G1237900 | AACAGCCCCATCTGATGTTC | 57.8 | TGCTGCAGATAAACGACCAG | 57.8 | |
MD11G1261900 | GAACCCCGATTTGTCGAGTA | 57.8 | TGGAACCTTGTTTGTGTCCA | 55.8 | |
MD13G1049200 | AACCGCCTGGTTCTGTAATG | 57.8 | CCATGAGGTTACGCCACTTT | 57.8 | |
MD16G1050300 | TTTGCAGAAAGATGCACGAC | 59.8 | CCGAATATCCAACCATCACC | 57.8 | |
MD17G1230800 | AGGTCTTTGCTCCAAAAGCA | 58.8 | GGAGGAGTCCTTCGGATTTC | 59.9 | |
MD04G1127400 (actin) | CCGTGTTCCCTAGCATTGTT | 59.9 | CAGGAGCAACACGAAGTTCA | 60.0 | |
Prunus persica | Prupe.1G302700 | TTTGCAGAAAGATGCACGAC | 55.8 | TGCTGCAGTAAATCGTCCAG | 57.8 |
Prupe.3G118300 | GTTGAGCTTTTGCAACGTGA | 55.8 | TTCTTGCTTCCCATTGATCC | 55.8 | |
Prupe.4G166400 | ACCTCCCACTCCACAAGATG | 59.9 | GCAAACATCCCTTGTGACCT | 57.8 | |
Prupe.6G078800 (actin) | GGAGCGTGGTTATTCCTTCA | 60.1 | TGCAGATTCCATTCCAATCA | 60.0 | |
Fragaria ananassa | gene_214.28 | TCTTGCAGATTGCTGGACAC | 57.8 | TGGTCGAACAGTCACATGGT | 57.8 |
gene_117.42 | TCTTGCAGATTGCTGGACAC | 55.8 | ACCAGGGGCATACTCACTTG | 59.9 | |
gene_89.20 | CTTTTGCAGATTGCTGGACA | 57.8 | GTGGTCGAACAGTCACATGG | 58.7 | |
gene_201.40 | CTTTTGCAGATTGCTGGACA | 55.8 | TGGTCGAACAGTCACATGGT | 61.9 | |
gene_175.31 | GCCTGAGAAACAAAGGCAAG | 57.8 | TTTCACATGGCATTCACGTT | 59.9 | |
gene_78.22 | CGGCCTTTCTCTTGTGAGAC | 57.8 | TCTTCGGTTTTGGGAACATC | 59.7 | |
gene_170.27 | GGATCAATGGGAAGCAAGAA | 57.8 | GGTCCTCCTCCTCTTCCAAC | 55.8 | |
gene_121.5 | AAGGGACGTGTGCTTATTGG | 57.8 | GCTTGTCTCTCACGTCACCA | 57.8 | |
gene_206.27 | GCCTGAGAAACAAAGGCAAG | 59.9 | TTTCACATGGCATTCACGTT | 55.8 | |
gene_191.47 (actin) | TGAACTTCGTGTTGCTCCAG | 60.0 | ACACCATCCCCAGAGTCAAG | 60.0 | |
Pyrus communis | pycom03g18910 | TCTTGCAGATTGCTGGACAC | 57.8 | GCCGGTTTGTTTGATTCACT | 55.8 |
pycom09g15640 | AGATGGTGTTTGCCAAGGTC | 57.8 | AGGAGTCGCTGCCTCAAATA | 57.8 | |
pycom11g23090 | GCAGTTCTTGGAACCTCTCG | 59.9 | CCAATTTCCAGATGCTTGGT | 55.8 | |
pycom16g04410 | AAGTATCGGTCGTGGAGGTG | 59.9 | CCATGAGGTTACGCCACTTT | 57.8 | |
pycom17g23400 | TGGAGCCTCTCGAACTTTGT | 57.8 | TGCCTGTCTGATTCTTGTCG | 57.8 | |
pycom03g07780 (actin) | ACCACAGCTGAGCGAGAAAT | 60.0 | ATCATGGATGGCTGGAAGAG | 59.9 |
Specie | Gene | Chromosome | Start Site | End Site | CDS (bps) | Protein Length (A.A.) |
---|---|---|---|---|---|---|
Eriobotrya japonica | EVM0016068.1 | 4 | 5161178 | 5166849 | 2898 | 965 |
EVM0004511.1 | 11 | 26908874 | 26915091 | 2904 | 967 | |
EVM0023388.1 | 12 | 33650012 | 33656070 | 2898 | 965 | |
EVM0022212.1 | 13 | 5906340 | 5912227 | 2904 | 967 | |
Malus domestica | MD03G1242000 | 3 | 32684130 | 32689694 | 2904 | 967 |
MD09G1237900 | 9 | 30178715 | 30185128 | 2904 | 967 | |
MD11G1261900 | 11 | 37648686 | 37655099 | 2907 | 968 | |
MD13G1049200 | 13 | 3459038 | 3465974 | 3126 | 1041 | |
MD16G1050300 | 16 | 3556349 | 3563246 | 3126 | 1041 | |
MD17G1230800 | 17 | 27925312 | 27931528 | 2904 | 967 | |
Prunus persica | Prupe.1G302700 | 1 | 29707930 | 29715477 | 3141 | 1046 |
Prupe.3G118300 | 3 | 10180567 | 10184771 | 2163 | 720 | |
Prupe.4G166400 | 4 | 9660509 | 9667502 | 2898 | 965 | |
Fragaria ananassa | gene_214.28 | 9 | 21406659 | 21414433 | 2898 | 965 |
gene_117.42 | 10 | 11752557 | 11758791 | 2898 | 965 | |
gene_89.20 | 11 | 8888390 | 8894519 | 2898 | 965 | |
gene_201.40 | 12 | 20094738 | 20100872 | 2898 | 965 | |
gene_175.31 | 21 | 17493253 | 17499271 | 2886 | 961 | |
gene_78.22 | 22 | 7870362 | 7870362 | 2886 | 961 | |
gene_170.27 | 23 | 16996113 | 17001913 | 2886 | 961 | |
gene_121.5 | 23 | 12176565 | 12179454 | 2889 | 962 | |
gene_206.27 | 24 | 20617837 | 20624020 | 2886 | 961 | |
Pyrus communis | pycom03g18910 | 3 | 19727998 | 19732815 | 2898 | 965 |
pycom09g15640 | 9 | 15712657 | 15718139 | 2901 | 966 | |
pycom11g23090 | 11 | 26092435 | 26098317 | 3216 | 1071 | |
pycom16g04410 | 16 | 2776593 | 2783601 | 3435 | 1144 | |
pycom17g23400 | 17 | 21795080 | 21800220 | 2853 | 950 |
Gene | MW (kDa) | pI | Instability Index | Aliphatic Index | GRAVY | Introns | Exons |
---|---|---|---|---|---|---|---|
EVM0016068.1 | 110,093.82 | 6 | 48.17 | 91.77 | −0.377 | 10 | 10 |
EVM0004511.1 | 110,394.49 | 6.54 | 45.48 | 89.17 | −0.404 | 9 | 10 |
EVM0023388.1 | 110,081.82 | 6.04 | 46.83 | 90.87 | −0.391 | 10 | 10 |
EVM0022212.1 | 110,182.06 | 5.97 | 45.78 | 88.98 | −0.387 | 9 | 10 |
MD03G1242000 | 110,304.06 | 6 | 47.91 | 91.69 | −0.379 | 10 | 10 |
MD09G1237900 | 110,536.41 | 6.05 | 45.27 | 88.87 | −0.416 | 10 | 10 |
MD11G1261900 | 110,608.47 | 6 | 47.3 | 91.19 | −0.382 | 10 | 10 |
MD13G1049200 | 117,260.81 | 6.51 | 52.76 | 87.87 | −0.433 | 19 | 20 |
MD16G1050300 | 117,245.63 | 6.46 | 54.32 | 87.39 | −0.45 | 20 | 20 |
MD17G1230800 | 110,225.08 | 5.97 | 45.78 | 88.87 | −0.392 | 10 | 10 |
Prupe.1G302700 | 117,827.73 | 6.81 | 52.29 | 87.72 | −0.413 | 20 | 20 |
Prupe.3G118300 | 81,846.16 | 5.57 | 47.39 | 88.74 | −0.426 | 8 | 8 |
Prupe.4G166400 | 110,062.78 | 6.04 | 47.29 | 91.98 | −0.387 | 10 | 10 |
gene_214.28 | 110,219.73 | 5.7 | 46.74 | 89.56 | −0.387 | 10 | 10 |
gene_117.42 | 110,245.92 | 5.81 | 47.07 | 89.46 | −0.384 | 10 | 10 |
gene_89.20 | 110,216.86 | 5.89 | 46.99 | 89.56 | −0.392 | 10 | 10 |
gene_201.40 | 110,217.8 | 5.8 | 47.19 | 89.56 | −0.391 | 10 | 10 |
gene_175.31 | 109,447.16 | 5.86 | 45.34 | 88.92 | −0.391 | 10 | 10 |
gene_78.22 | 109,389.18 | 5.76 | 44.72 | 89.52 | −0.367 | 10 | 10 |
gene_170.27 | 109,374.06 | 5.86 | 45.07 | 88.71 | −0.389 | 10 | 10 |
gene_121.5 | 109,658.5 | 6.49 | 44.89 | 87.61 | −0.423 | 10 | 10 |
gene_206.27 | 109,402.08 | 5.86 | 45.11 | 88.71 | −0.389 | 10 | 10 |
pycom03g18910 | 110,058.82 | 6.04 | 46.84 | 91.88 | −0.376 | 9 | 10 |
pycom09g15640 | 110,386.36 | 6.24 | 45.1 | 89.27 | −0.411 | 9 | 10 |
pycom11g23090 | 122,259.06 | 6.15 | 49.43 | 91.99 | −0.323 | 10 | 11 |
pycom16g04410 | 129,170.71 | 7.8 | 54.34 | 89.66 | −0.4 | 20 | 20 |
pycom17g23400 | 108,062.61 | 5.79 | 44.36 | 90.46 | −0.354 | 10 | 10 |
Gene 1 | Gene 2 | Ka | Ks | Ka/Ks (ω) | Selection | Duplication Mode |
---|---|---|---|---|---|---|
MD09G1237900 | pycom09g15640 | 0.004976 | 0.036138 | 0.137707 | Purifying | Segmental |
MD17G1230800 | pycom17g23400 | 0.011043 | 0.056552 | 0.195266 | Purifying | Segmental |
gene_170.27 | gene_206.27 | 4.54E-04 | 0.030053 | 0.015101 | Purifying | Segmental |
gene_214.28 | gene_117.42 | 0.003619 | 0.023942 | 0.151148 | Purifying | Segmental |
gene_89.20 | gene_201.40 | 4.52E-04 | 0.001466 | 0.308365 | Purifying | Segmental |
EVM0016068.1 | pycom03g18910 | 0.003629 | 0.099771 | 0.036372 | Purifying | Segmental |
EVM0023388.1 | pycom11g23090 | 0.003855 | 0.064843 | 0.059445 | Purifying | Segmental |
MD16G1050300 | pycom16g04410 | 0.003784 | 0.051872 | 0.07294 | Purifying | Segmental |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhi, C.; Ali, M.M.; Alam, S.M.; Gull, S.; Ali, S.; Yousef, A.F.; Ahmed, M.A.A.; Ma, S.; Chen, F. Genome-Wide In Silico Analysis and Expression Profiling of Phosphoenolpyruvate Carboxylase Genes in Loquat, Apple, Peach, Strawberry and Pear. Agronomy 2022, 12, 25. https://doi.org/10.3390/agronomy12010025
Zhi C, Ali MM, Alam SM, Gull S, Ali S, Yousef AF, Ahmed MAA, Ma S, Chen F. Genome-Wide In Silico Analysis and Expression Profiling of Phosphoenolpyruvate Carboxylase Genes in Loquat, Apple, Peach, Strawberry and Pear. Agronomy. 2022; 12(1):25. https://doi.org/10.3390/agronomy12010025
Chicago/Turabian StyleZhi, Cao, Muhammad Moaaz Ali, Shariq Mahmood Alam, Shaista Gull, Sajid Ali, Ahmed F. Yousef, Mohamed A. A. Ahmed, Songfeng Ma, and Faxing Chen. 2022. "Genome-Wide In Silico Analysis and Expression Profiling of Phosphoenolpyruvate Carboxylase Genes in Loquat, Apple, Peach, Strawberry and Pear" Agronomy 12, no. 1: 25. https://doi.org/10.3390/agronomy12010025
APA StyleZhi, C., Ali, M. M., Alam, S. M., Gull, S., Ali, S., Yousef, A. F., Ahmed, M. A. A., Ma, S., & Chen, F. (2022). Genome-Wide In Silico Analysis and Expression Profiling of Phosphoenolpyruvate Carboxylase Genes in Loquat, Apple, Peach, Strawberry and Pear. Agronomy, 12(1), 25. https://doi.org/10.3390/agronomy12010025