Marker-Assisted Backcross Breeding for Improvement of Submergence Tolerance and Grain Yield in the Popular Rice Variety ‘Maudamani’
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Breeding Program
2.2. Genomic DNA Isolation, Polymerase Chain Reaction and Marker Analysis
2.3. Screening for Submergence Tolerance
2.4. Evaluation of the Pyramided Lines for Various Traits
3. Results
3.1. Development of Improved Lines
3.1.1. Validation of Donor and Recipient Parents for the Target Traits
3.1.2. Marker-Assisted Selection in BC1F1 Generation
3.1.3. Marker-Assisted Selection in BC2F1 Generation
3.1.4. Marker-Assisted Selection in BC3F1 and BC3F2 Generations
3.2. Analysis of Recipient Genome Recovery on the Carrier Chromosomes in the Pyramided Lines
3.3. Evaluation of the Pyramided Lines for Submergence Tolerance
3.4. Evaluation of Pyramided Lines for Agro-Morphologic, Yield Components and Grain Quality Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BC1F1 | Backcross generation 1 |
| BC2F1 | Backcross generation 2 |
| BC3F1 | Backcross generation 3 |
| GC | Gel consistency |
| QTL | Quantitative trait loci |
| MSS | Maudamani Swarna-Sub1 |
| Sub1 | Submergence tolerance |
| RBD | Randomized block design |
References
- Pradhan, S.K.; Pandit, E.; Pawar, S.; Baksh, S.Y.; Mukherjee, A.K.; Mohanty, S.P. Development of flash-flood tolerant and durable bacterial blight resistant versions of mega rice variety ‘Swarna’ through marker-assisted backcross breeding. Sci. Rep. 2019, 9, 12810. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Food and Agriculture Organization. Food and Agriculture Organization of the United Nations. Rice Mark. Monit. 2017, 20, 1–38. [Google Scholar]
- Pradhan, S.K.; Barik, S.R.; Sahoo, J.; Pandit, E.; Nayak, D.K.; Pani, D.R.; Anandana, A. Comparison of Sub1 markers and their combinations for submergence tolerance and analysis of adaptation strategies of rice in rainfed lowland ecology. Comptes Rendus Biol. 2015, 338, 650–659. [Google Scholar] [CrossRef]
- Pradhan, S.K.; Chakraborti, M.; Chakraborty, K.; Behera, L.; Meher, J.; Subudhi, H.N.; Mishra, S.K.; Pandit, E.; Reddy, J.N. Genetic Improvement of Rainfed Shallow-lowland Rice for Higher Yield and Climate Resilience. In Rice Research for Enhancing Productivity, Profitability and Climate Resilience; Pathak, H., Nayak, A.K., Jena, M., Singh, O.N., Samal, P., Sharma, S.G., Eds.; ICAR-National Rice Research Institute: Cuttack, India, 2018; pp. 107–121. Available online: https://icar-nrri.in/wp-content/uploads/2019/02/Rice_Research_book_nrri.pdf (accessed on 19 May 2021).
- Ashikari, M.; Sakakibara, H.; Lin, S.; Yamamoto, T.; Takashi, T.; Nishimura, A.; Angeles, E.R.; Qian, Q.; Kitano, H.; Matsuoka, M. Cytokinin oxidase regulates rice grain production. Science 2005, 309, 741–745. [Google Scholar] [CrossRef]
- Ikeda, K.; Ito, M.; Nagasawa, N.; Kyozuka, J.; Nagato, Y. Rice ABERRANT PANICLE ORGANIZATION 1, encoding an F-box protein, regulates meristem fate. Plant J. 2007, 51, 1030–1040. [Google Scholar] [CrossRef]
- Wang, E.; Wang, J.; Zhu, X.; Hao, W.; Wang, L.; Li, Q.; Zhang, L.; He, W.; Lu, B.; Lin, H.; et al. Controlofricegrain-fillingandyieldbyagenewithapotentialsignatureofdomestication. Nat. Genet. 2008, 40, 1370–1374. [Google Scholar] [CrossRef]
- Huang, X.; Qian, Q.; Liu, Z.; Sun, H.; He, S.; Luo, D.; Xia, G.; Chu, C.; Li, J.; Fu, X. Natural variation at the DEP1 locus enhances grain yield in rice. Nat. Genet. 2009, 41, 494–497. [Google Scholar] [CrossRef]
- Xue, W.; Xing, Y.; Weng, X.; Zhao, Y.; Tang, W.; Wang, L.; Zhou, H.; Yu, S.; Xu, C.; Li, X.; et al. Natural variation in Ghd7is an important regulator of heading date and yield potential in rice. Nat. Genet. 2008, 40, 761–767. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Xu, J.; Guo, H.; Jiang, L.; Chen, S.; Yu, C.; Zhou, Z.; Hu, P.; Zhai, H.; Wan, J. DTH8 suppresses flowering in rice, influencing plant height and yield potential simultaneously. Plant Physiol. 2010, 153, 1747–1758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, W.H.; Wang, P.; Chen, H.X.; Zhou, H.J.; Li, Q.P.; Wang, C.R.; Ding, Z.H.; Zhang, Y.S.; Yu, S.B.; Xing, Y.Z.; et al. A major QTL, Ghd8, plays pleiotropic roles in regulating grain productivity, plant height, and heading date in rice. Mol. Plant 2011, 4, 319–330. [Google Scholar] [CrossRef]
- Yuki, A.; Keiko, M.; Tsuyu, A.; Izumi, K.; Masahiro, Y.; Hidemi, K.; Yukimoto, I. The SMALL AND ROUND SEED1 (SRS1/DEP2) gene is involved in the regulation of seed size in rice. Genes Genet. Syst. 2010, 85, 327–339. [Google Scholar]
- Qiao, Y.L.; Piao, R.H.; Shi, J.X.; Lee, S.I.; Jiang, W.Z.; Kim, B.K.; Lee, J.; Han, L.; Ma, W.; Koh, H.J. Fine mapping and candidate gene analysis of dense and erect panicle 3, DEP3, which confers high grain yield in rice (Oryza sativa L.). Theor. Appl. Genet. 2011, 122, 1439–1449. [Google Scholar] [CrossRef] [PubMed]
- Song, X.-J.; Huang, W.; Shi, M.; Zhu, M.-Z.; Lin, H.-X. A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 2007, 39, 623–630. [Google Scholar] [CrossRef] [PubMed]
- Fan, C.; Xing, Y.; Mao, H.; Lu, T.; Han, B.; Xu, C.; Li, X.; Zhang, Q. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet. 2006, 112, 1164–1171. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Fan, C.; Xing, Y.; Jiang, Y.; Luo, L.; Sun, L.; Shao, D.; Xu, C.; Li, X.; Xiao, J.; et al. Natural variation in GS5 plays an important role in regulating grain size and yield in rice. Nat. Genet. 2011, 43, 1266–1269. [Google Scholar] [CrossRef] [PubMed]
- Shomura, A.; Izawa, T.; Ebana, K.; Ebitani, T.; Kanegae, H.; Konishi, S.; Yano, M. Deletion in a gene associated with grain size increased yields during rice domestication. Nat. Genet. 2008, 40, 1023–1028. [Google Scholar] [CrossRef]
- Weng, J.; Gu, S.; Wan, X.; Gao, H.; Guo, T.; Su, N.; Lei, C.; Zhang, X.; Cheng, Z.; Guo, X.; et al. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Res. 2008, 18, 1199–1209. [Google Scholar] [CrossRef]
- Li, X.; Qian, Q.; Fu, Z.; Wang, Y.; Xiong, G.; Zeng, D.; Wang, X.; Liu, X.; Teng, S.; Hiroshi, F.; et al. Control of tillering in rice. Nature 2003, 422, 618–621. [Google Scholar] [CrossRef]
- Zha, X.; Luo, X.; Qian, X.; He, G.; Yang, M.; Li, Y.; Yang, J. Over-expression of the rice LRK1 gene improves quantitative yield components. Plant Biotechnol. J. 2009, 7, 611–620. [Google Scholar] [CrossRef]
- Piao, R.; Jiang, W.; Ham, T.-H.; Choi, M.-S.; Qiao, Y.; Chu, S.-H.; Park, J.-H.; Woo, M.-O.; Jin, Z.; An, G.; et al. Map-based cloning of the ERECT PANICLE 3 gene in rice. Theor. Appl. Genet. 2009, 119, 1497–1506. [Google Scholar] [CrossRef]
- Jiao, Y.; Wang, Y.; Xue, D.; Wang, J.; Yan, M.; Liu, G.; Dong, G.; Zeng, D.; Lu, Z.; Zhu, X.; et al. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat. Genet. 2010, 42, 541–544. [Google Scholar] [CrossRef] [PubMed]
- Miura, K.; Ikeda, M.; Matsubara, A.; Song, X.-J.; Ito, M.; Asano, K.; Matsuoka, M.; Kitano, H.; Ashikari, M. OsSPL14 promotes panicle branching and higher grain productivity in rice. Nat. Genet. 2010, 42, 545–549. [Google Scholar] [CrossRef]
- Qiao, Y.; Lee, S.-I.; Piao, R.; Jiang, W.; Ham, T.-H.; Chin, J.-H.; Piao, Z.; Han, L.; Kang, S.-Y.; Koh, H.-J. Fine mapping and candidate gene analysis of the floury endosperm gene, FLO(a), in rice. Mol. Cells 2010, 29, 167–174. [Google Scholar] [CrossRef] [PubMed]
- She, K.-C.; Kusano, H.; Koizumi, K.; Yamakawa, H.; Hakata, M.; Imamura, T.; Fukuda, M.; Naito, N.; Tsurumaki, Y.; Yaeshima, M.; et al. A novel factor FLOURY ENDOSPERM2 is involved in regulation of rice grain size and starch quality. Plant Cell 2010, 22, 3280–3294. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, K.; Mackill, D.J. A major locus for submergence tolerance mapped on rice chromosome 9. Mol. Breed. 1996, 2, 219–224. [Google Scholar] [CrossRef]
- Chen, M.; Presting, G.; Barbazuk, W.B.; Goicoechea, J.L.; Blackmon, B.; Fang, G.; Kim, H.; Frisch, D.; Yu, Y.; Sun, S.; et al. An integrated physical and genetic map of the rice genome. Plant Cell 2002, 14, 537–545. [Google Scholar] [CrossRef]
- Neeraja, C.N.; Maghirang-Rodriguez, R.; Pamplona, A.; Heuer, S.; Collard, B.C.; Septiningsih, E.M.; Vergara, G.; Sanchez, D.; Xu, K.; Ismail, A.M.; et al. A marker-assisted backcross approach for developing submergence-tolerant rice cultivars. Theor. Appl. Genet. 2007, 115, 767–776. [Google Scholar] [CrossRef]
- Iftekharuddaula, K.M.; Newaz, M.A.; Salam, M.A.; Ahmed, H.U.; Mahbub, M.A.A.; Septiningsih, E.M.; Collard, B.C.Y.; Sanchez, D.L.; Pamplona, A.M.; Mackill, D.J. Rapid and high-precision marker assisted backcrossing to introgress the SUB1 QTL into BR11, the rainfed lowland rice mega variety of Bangladesh. Euphytica 2011, 178, 83–97. [Google Scholar] [CrossRef]
- Manivong, P.; Korinsak, S.; Siangliw, J.L.; Vanavichit, A.; Toojinda, T. Marker-assisted selection to improve submergence tolerance, blast resistance and strong fragrance in glutinous rice. Thai J. Genet. 2014, 7, 110–122. [Google Scholar]
- Khush, G.S.; Mackill, D.J.; Sidhu, G.S. Breeding Rice for Resistance to Bacterial Leaf Blight; IRRI: Manila, Philippines, 1989; pp. 207–217. [Google Scholar]
- Pradhan, S.K.; Pandit, E.; Pawar, S.; Naveenkumar, R.; Barik, S.R.; Mohanty, S.P.; Nayak, D.K.; Ghritlahre, S.K.; Rao, D.S.; Reddy, J.N.; et al. Linkage disequilibrium mapping for grain Fe and Zn enhancing QTLs useful for nutrient dense rice breeding. BMC Plant Biol. 2020, 20, 57. [Google Scholar] [CrossRef] [Green Version]
- Ookawa, T.; Hobo, T.; Yano, M.; Murata, K.; Ando, T.; Miura, H.; Asano, K.; Ochiai, Y.; Ikeda, M.; Nishitani, R.; et al. New approach for rice improvement using a pleiotropic QTL gene for lodging resistance and yield. Nat. Commun. 2010, 1, 132. [Google Scholar] [CrossRef] [Green Version]
- Xu, K.; Xu, X.; Fukao, T.; Canlas, P.; Maghirang-Rodriguez, R.; Heuer, S.; Ismail, A.M.; Bailey-Serres, J.; Ronald, P.C.; Mackill, D.J. Sub1A is an ethylene-response-factor-like gene that confers submergence tolerance to rice. Nature 2006, 442, 705–708. [Google Scholar] [CrossRef] [Green Version]
- Septiningsih, E.M.; Pamplona, A.M.; Sanchez, D.L.; Neeraja, C.N.; Vergara, G.V.; Heuer, S.; Ismail, A.M.; Mackill, D.J. Development of submergence tolerant rice cultivars: The Sub1 locus and beyond. Ann. Bot. 2009, 103, 151–160. [Google Scholar] [CrossRef] [Green Version]
- Dellaporta, S.L.; Wood, J.; Hicks, J.B. A plant DNA mini preparation: Version II. Plant Mol. Biol. Rep. 1983, 1, 19–21. [Google Scholar] [CrossRef]
- Pavalíce, A.; Hrda, S.; Flegr, J. Free Tree—freeware program for construction of phylogenetic trees on the basis of distance data and bootstrap/jackknife analysis of the tree robustness. Application in the RAPD analysis of genus Frenkelia. Folia Biol. (Pragua) 1999, 45, 97–99. [Google Scholar]
- Hampl, V.; Pavlicek, A.; Flegr, J. Construction and bootstrap analysis of DNA fingerprinting based phylogenetic trees with the freeware program FreeTree: Application to trichomonad parasites. Int. J. Syst. Evol. Microbiol. 2001, 51, 731–735. [Google Scholar] [CrossRef]
- Page, R.D. TreeView: An application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 1996, 12, 357–358. [Google Scholar] [PubMed] [Green Version]
- Van Berloo, R. GGT: Software for display of graphical genotypes. J. Hered. 1999, 90, 328–330. [Google Scholar] [CrossRef] [Green Version]
- Tan, Y.F.; Li, J.X.; Yu, S.B.; Xing, Y.Z.; Xu, C.G.; Zhang, Q. The three important traits for cooking and eating quality of rice grains are controlled by a single locus in an elite rice hybrid, Shanyou63. Theor. Appl. Genet. 1999, 99, 642–648. [Google Scholar] [CrossRef]
- Cagampang, G.B.; Perez, C.M.; Juliano, B.O. A gel consistency test for eating quality of rice. J. Sci. Food Agric. 1973, 24, 1589–1594. [Google Scholar] [CrossRef]
- Juliano, B.O. Rice quality screening with the Rapid ViscoAnalyser. In Applicntions of the Rapid ViscoAnalyser; Walker, C.E., Hazelton, J.L., Eds.; Newport Scientific: Sydney, Australia, 1996; p. 19. [Google Scholar]
- SAS Institute Inc. Statistical Analysis System, version 9.2.; SAS Institute Inc.: Cary, NC, USA, 2008. [Google Scholar]
- Pandit, E.; Tasleem, S.; Nayak, D.K.; Barik, S.R.; Mohanty, D.P.; Das, S.; Pradhan, S.K. Genome-wide association mapping reveals multiple QTLs governing tolerance response for seedling stage chilling stress in Indica rice. Front. Plant Sci. 2017, 8, 552. [Google Scholar] [CrossRef] [Green Version]
- Pandit, E.; Panda, R.K.; Sahoo, A.; Pani, D.R.; Pradhan, S.K. Genetic relationship and structure analyses of root growth angle for improvement of drought avoidance in early and mid-early maturing rice genotypes. Rice Sci. 2020, 27, 124–132. [Google Scholar] [CrossRef]
- Pradhan, S.K.; Pandit, E.; Pawar, S.; Bharati, B.; Chatopadhyay, K.; Singh, S.; Dash, P.; Reddy, J.N. Association mapping reveals multiple QTLs for grain protein content in rice useful for biofortification. Mol. Genet. Genom. 2019, 294, 963–983. [Google Scholar] [CrossRef]
- Pradhan, S.K.; Nayak, D.K.; Mohanty, S.; Behera, L.; Barik, S.R.; Pandit, E.; Lenka, S.; Anandan, A. Pyramiding of three bacterial blight resistance genes for broad-spectrum resistance in deepwater rice variety, Jalmagna. Rice 2015, 8, 19. [Google Scholar] [CrossRef]
- Sundaram, R.M.; Vishnupriya, M.R.; Biradar, S.K.; Laha, G.S.; Reddy, G.A.; Rani, N.S.; Sarma, N.P.; Sonti, R.V. Marker assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica 2008, 160, 411–422. [Google Scholar] [CrossRef]
- Pradhan, S.K.; Nayak, D.K.; Pandit, E.; Behera, L.; Anandan, A.; Mukherjee, A.K.; Lenka, S.; Barik, D.P. Incorporation of bacterial blight resistance genes into lowland rice cultivar through marker assisted backcross breeding. Phytopathology 2016, 6, 710–718. [Google Scholar] [CrossRef] [Green Version]
- Nayak, D.K.; Pandit, E.; Mohanty, S.; Barik, D.P.; Pradhan, S.K. Marker assisted selection in back cross progenies for transfer of bacterial leaf blight resistance genes into a popular lowland rice cultivar. Oryza 2015, 52, 163–168. [Google Scholar]
- Sonti, R.V. Bacterial leaf blight of rice: New insights from molecular genetics. Curr. Sci. 1998, 74, 206–212. [Google Scholar]
- Sanchez, A.C.; Brar, D.S.; Huang, N.; Li, Z.; Khush, G.S. Sequence tagged site markers-assisted selection for three bacterial blight resistance genes in rice. Crop Sci. 2000, 40, 792–797. [Google Scholar] [CrossRef]
- Singh, S.; Sidhu, J.S.; Huang, N.; Vikal, Y.; Li, Z.; Brar, D.S.; Dhaliwal, H.S.; Khush, G.S. Pyramiding three bacterial blight resistance genes (xa-5, xa-13 and Xa-21) using marker-assisted selection into indica rice cultivar PR-106. Theor. Appl. Genet. 2001, 102, 1011–1015. [Google Scholar] [CrossRef]
- Perez, L.M.; Redona, E.D.; Mendioro, M.S.; Vera Cruz, C.M.; Leung, H. Introgression of Xa4, Xa7 and Xa21 for resistance to bacterial blight in thermo-sensitive genetic male sterile rice (Oryzasativa L.) for the development of two-line hybrids. Euphytica 2008, 164, 627–636. [Google Scholar] [CrossRef]
- Dokku, P.; Das, K.M.; Rao, G.J.N. Pyramiding of four resistance genes of bacterial blight in Tapaswini, an elite rice cultivar, through marker-assisted selection. Euphytica 2013, 192, 87–96. [Google Scholar] [CrossRef]
- Pradhan, S.K.; Nayak, D.K.; Pandit, E.; Barik, S.R.; Mohanty, S.P.; Anandan, A.; Reddy, J.N. Characterization of morpho-quality traits and validation of bacterial blight resistance in pyramided rice genotypes under various hotspots of India. Aust. J. Crop. Sci. 2015, 9, 127–134. [Google Scholar]
- Das, G.; Rao, G.J.N. Molecular marker assisted gene stacking for biotic and abiotic stress resistance genes in an elite rice cultivar. Front. Plant Sci. 2015, 6, 698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Das, G.; Rao, G.J.; Varier, M.; Prakash, A.; Prasad, D. Improved Tapaswini having four BB resistance genes pyramided with six genes/QTLs, resistance/tolerance to biotic and abiotic stresses in rice. Sci. Rep. 2018, 8, 2413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pradhan, S.K.; Barik, S.R.; Nayak, D.K.; Pradhan, A.; Pandit, E.; Nayak, P.; Das, S.R.; Pathak, H. Genetics, Molecular Mechanisms and Deployment of Bacterial Blight Resistance Genes in Rice. Crit. Rev. Plant Sci. 2020, 39, 360–385. [Google Scholar] [CrossRef]
- Mohanty, S.P.; Kumbhakar, S.; Pandit, E.; Barik, S.R.; Mohanty, D.P.; Nayak, D.K.; Singh, N.R.; Pradhan, S.K. Molecular screening of yield component QTLs for strong culm, grain number and grain width using gene specific markers in indica-tropical japonica derived rice lines. Oryza 2016, 53, 136–143. [Google Scholar]
- Mohapatra, S.; Pandit, E.; Mohanty, S.P.; Barik, S.R.; Pawar, S.; Nayak, D.K.; Subudhi, H.N.; Das, L.; Pradhan, S.K. Molecular and phenotypic analyses of yield components QTLs in IR64 backcross progenies and popular high yielding rice varieties of India. Oryza 2018, 55, 271–277. [Google Scholar] [CrossRef]











| Sl No. | Trait | QTL | Chromosome | Position (Mb) | Primer Name | Primer Sequence | Reference |
|---|---|---|---|---|---|---|---|
| 1. | High grain number | Gn1a | 1 | 5.27 | Gn1a(F) | 5’ TGAGGATGCCGTGGAAGACGA 3’ | Ashikari et al. [5] |
| Gn1a (R) | 5’ TTCGTGTTCGCGCAGGACGT 3’ | ||||||
| 2. | Grain width | GW2 | 2 | 8.11 | GW2(F) | 5’ CCAATAAAGATGTCCATTCTGTTA 3’ | Song et al. [14] |
| GW2 (R) | 5’ GCTCTTCCTGTAACACATATTATG 3’ | ||||||
| 3. | Grain weight | GW5 | 5 | 27.4 | GW5 (F) | 5’ GCGTCGTCAGAGGTAGA 3’ | Weng et al. [18] |
| GW5 (R) | 5’ GACCTAACCCATCTCATTCCA 3’ | ||||||
| 4. | Strong culm | SCM 2 | 6 | 27.66 | SCM 2 (F) | 5’ ATTCAGATCAATAGGTTGAGTGT 3’ | Ookawa et al. [33] |
| SCM 2 (R) | 5’ TGCTATGTATATCCTATCGGTTC 3’ | ||||||
| 5. | Wealthy Farmers Panicle | OsSPL14 | 8 | 25.27 | OsSPL14(F) | 5’ CAAGGGTTCCAAGCAGCGTAA 3’ | Miura et al. [23] |
| OsSPL14(R) | 5’ TGCACCTCATCAAGTGAGAC 3’ | ||||||
| 6. | Submergence tolerance | Sub1 | 9 | 5.9 | Sub1-A203(F) | 5’ CTTCTTGCTCAACGACAACG 3’ | Pradhan et al. [3] Xu et al. [34] Septiningsih et al. [35] |
| Sub1-A203(R) | 5’ AGGCTCCAGATGTCCATGTC 3’ | ||||||
| Sub1-BC2(F) | 5’ AAAACAATGGTTCCATACGAGAC 3’ | ||||||
| Sub1-BC2(R) | 5’ GCCTATCAATGCGTGCTCTT 3’ | ||||||
| 5.7 | RM8300(F) | 5’ GCTAGTGCAGGGTTGACACA 3’ | |||||
| RM8300(R) | 5’ CTCTGGCCGTTTCATGGTAT 3’ |
| Chromosome | No. of Markers Tested | No. of Polymorphic Markers | Name of Polymorphic Markers |
|---|---|---|---|
| 1 | 48 | 4 | RM11694, RM10346, RM495, RM594 |
| 2 | 40 | 4 | RM1347, RM263, RM521, RM6374 |
| 3 | 40 | 5 | RM14723, RM426, RM1278, RM570, RM3392 |
| 4 | 40 | 5 | RM1113, RM2416, RM470, RM551, RM335 |
| 5 | 40 | 5 | RM440, RM430, RM334, RM7452, RM122 |
| 6 | 60 | 3 | RM20377, RM469, RM225 |
| 7 | 48 | 4 | RM432, RM336, RM429, RM8007 |
| 8 | 96 | 6 | RM337, RGNMS2900A, AUT22718, RGNMS2866, RGNMS2873, RM23444 |
| 9 | 72 | 5 | RM23668, RM23722, RM257, RM444, RM201 |
| 10 | 40 | 5 | RM6100, RM258, RM590, RM222, RM25181 |
| 11 | 40 | 6 | RM1812, RM167, RM1341, RM206, RM287, RM224 |
| 12 | 40 | 5 | RM235, RM7003, RM20A, RM1337, RM309 |
| Total | 644 | 57 |
| Generation | No. of Plants Scored | No. of Progenies Heterozygotes for 2 Target QTLs | Expected % of Recurrent Parent Genome to Selected Backcross Plants | Average Recipient Parent Genome Content (%) in the Backcross Progenies | Estimated Maximum % Genome Recovery of Recurrent Parent to Selected Backcross Progenies |
|---|---|---|---|---|---|
| BC1F1 | 132 | 14 | 75.0 | 76.26 | 81.25 |
| BC2F1 | 169 | 17 | 87.5 | 87.74 | 91.67 |
| BC3F1 | 144 | 12 | 93.25 | 94.88 | 96.87 |
| Serial Number | Pyramided and Parental Lines | Plan Height (cm) | Days to 50% Flowering | Panicles/Plant | Grains/Panicle | Total Spikelets/Panicle | No. of Primary Branches/Panicle | No.of Secondary Branches/Panicle | No.of Tertiary Branches/Panicle | 1000- seed weight (g) | Grain Length (mm) | Grain Breadth (mm) | Milling (%) | Head Rice Recovery (%) | Amylose Content (%) | Plot Yield (t/ha) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | MSS 128-102-97-68 | 102 c | 108 de | 10.73 b | 305 a | 370 abc | 12 c | 78 ab | 7 c | 20.31 a | 5.17 a | 2.61 abc | 68.4 a | 64.47 a | 24.23 ab | 8.747 c |
| 2 | MSS 128-102-97-117 | 104 abc | 110 b | 11.43 b | 316 a | 388 ab | 14 ab | 84 ab | 9 a | 21.25 a | 5.24 a | 2.47 c | 68.6 a | 64.3 a | 24.23 ab | 9.195 a |
| 3 | MSS 128-102-97-335 | 104 bc | 108 e | 11.6 b | 294 a | 354 c | 12 c | 76 ab | 8 bc | 21.02 ab | 5.24 a | 2.31 d | 67.7 a | 64.5 a | 24.13 ab | 8.664 c |
| 4 | MSS 128-102-97-436 | 105 abc | 108 de | 11.17 b | 287 a | 369 abc | 13 bc | 84 ab | 8 ab | 21.31 a | 5.17 a | 2.69 ab | 68.1 a | 63.86 a | 24.42 ab | 9.125 ab |
| 5 | MSS 128-102-97-601 | 103 c | 109 cd | 11.43 b | 297 a | 353 c | 12 c | 75 ab | 7 c | 20.93 ab | 5.17 a | 2.55 bc | 67.5 a | 64.43 a | 24.26 ab | 8.783 c |
| 6 | MSS 128-102-97-613 | 103 bc | 110 b | 11.47 b | 303 a | 357 bc | 12 c | 76 b | 7 c | 20.75 ab | 5.32 a | 2.66 ab | 67.5 a | 63.53 a | 24.19 ab | 8.314 d |
| 7 | MSS 128-102-97-617 | 105 abc | 110 bc | 10.57 b | 306 a | 359 bc | 13 bc | 83 ab | 8 ab | 20.93 ab | 5.3 a | 2.6 abc | 68.1 a | 63.67 a | 24.24 ab | 8.965 b |
| 8 | Swarna-Sub1 | 107 ab | 113 a | 13.93 a | 137 b | 176 d | 9 d | 21 c | 0 d | 20.01 b | 5.35 a | 2.27 d | 68.5 a | 63.73 a | 24.97 a | 6.129 e |
| 9 | Maudamani (recipient) | 108 a | 107 e | 8.86 c | 312 a | 394 a | 14 a | 87 a | 9 a | 21.52 a | 5.33 a | 2.73 a | 68.9 a | 64.63 a | 23.5 b | 8.69 c |
| LSD5% | 7.42 | 4.35 | 2.76 | 27.8 | 29.2 | 1.36 | 7.61 | 0.89 | 1.83 | 0.73 | 0.154 | 7.24 | 7.62 | 2.187 | 0.348 | |
| CV% | 3.26 | 0.95 | 10.58 | 9.82 | 9.78 | 10.3 | 10.3 | 9.38 | 4.61 | 6.36 | 8.196 | 6.68 | 9.32 | 6.833 | 11.634 | |
| Standard Error (SE) | 1.114 | 0.362 | 0.387 | 9.106 | 9.931 | 0.411 | 2.592 | 0.231 | 0.346 | 0.112 | 0.582 | 1.373 | 1.910 | 0.509 | 0.325 | |
| Mean | 104.67 | 109.22 | 11.243 | 285.6 | 347.44 | 12.41 | 74.47 | 7.037 | 21.007 | 5.254 | 2.542 | 68.14 | 64.126 | 24.23 | 8.51 | |
| Heritability (h2)% | 69.961 | 78.441 | 74.019 | 80.56 | 82.325 | 83.78 | 86.93 | 93.94 | 76.63 | 76.505 | 73.525 | 81.73 | 68.903 | 82.48 | 78.317 | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pandit, E.; Pawar, S.; Barik, S.R.; Mohanty, S.P.; Meher, J.; Pradhan, S.K. Marker-Assisted Backcross Breeding for Improvement of Submergence Tolerance and Grain Yield in the Popular Rice Variety ‘Maudamani’. Agronomy 2021, 11, 1263. https://doi.org/10.3390/agronomy11071263
Pandit E, Pawar S, Barik SR, Mohanty SP, Meher J, Pradhan SK. Marker-Assisted Backcross Breeding for Improvement of Submergence Tolerance and Grain Yield in the Popular Rice Variety ‘Maudamani’. Agronomy. 2021; 11(7):1263. https://doi.org/10.3390/agronomy11071263
Chicago/Turabian StylePandit, Elssa, Swapnil Pawar, Saumya Ranjan Barik, Shakti Prakash Mohanty, Jitendriya Meher, and Sharat Kumar Pradhan. 2021. "Marker-Assisted Backcross Breeding for Improvement of Submergence Tolerance and Grain Yield in the Popular Rice Variety ‘Maudamani’" Agronomy 11, no. 7: 1263. https://doi.org/10.3390/agronomy11071263
APA StylePandit, E., Pawar, S., Barik, S. R., Mohanty, S. P., Meher, J., & Pradhan, S. K. (2021). Marker-Assisted Backcross Breeding for Improvement of Submergence Tolerance and Grain Yield in the Popular Rice Variety ‘Maudamani’. Agronomy, 11(7), 1263. https://doi.org/10.3390/agronomy11071263

