Next Article in Journal
Maceration Time Affects the Efficacy of Borage Extracts as Potential Biostimulant on Rocket Salad
Previous Article in Journal
Effects of Damaged Levels and Pruning of Peach and Japanese Apricot Trees by Hailstorms on the Performance
Previous Article in Special Issue
Effect of Trichoderma spp. and Fertilization on the Flowering of Begonia × tuberhybrida Voss. ‘Picotee Sunburst’
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 11
Issue 11
10.3390/agronomy11112180
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Application of Barley Tweaky Spike Mutants for the Study of Effects of Plant Immunity-Related Substances

by
Raimondas Šiukšta
1,*,
Virginija Vaitkūnienė
1,2,
Rimutė Mačkinaitė
3 and
Vytautas Rančelis
1
1
Institute of Biosciences, Life Sciences Centre, Vilnius University, Saulėtekio Ave. 7, LT-10257 Vilnius, Lithuania
2
Botanical Garden of Vilnius University, Vilnius University, Kairėnai Str. 43, LT-10239 Vilnius, Lithuania
3
Nature Research Centre, Institute of Botany, Žaliųjų ežerų Str. 49, LT-12200 Vilnius, Lithuania
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(11), 2180; https://doi.org/10.3390/agronomy11112180
Submission received: 20 September 2021 / Revised: 22 October 2021 / Accepted: 26 October 2021 / Published: 28 October 2021
(This article belongs to the Special Issue Application of Biological Stimulants in Horticultural Crops)
Browse Figures
Versions Notes

Abstract

:
Barley developmental mutants tweaky spike (tw) with disturbed auxin pathways possess a unique feature of an increased level of mouldy germinating grains (MGG), which serves as a convenient model to investigate the effects of plant immunity-related substances. The effects of the auxin 2,4-dichlorophenoxyacetic acid (2,4-D), auxin inhibitors, salicylic acid (SA), and trans-cinnamic acid (TCA) were studied using the tw-WT system in surface-sterilized and unsterilized germinating grains under high rates of natural infection. Significant differences among the allelic tw mutants were revealed at the natural MGG level and in response to 2,4-D, SA, and TCA. The most effective means against MGG were sterilization and TCA. 2,4-D inhibited root growth in tw and tw2 mutants, occurring only in unsterilized and not sterilized germinating grains, while the opposite was observed for TCA and SA. The tw mutations influenced variations in the seed-borne fungal spectra, decreasing the frequency of Bipolaris sorokiniana and increasing Fusarium spp. Hypochlorite-based surface sterilization methods should be used with caution in studies where the action of exogenous 2,4-D will be analysed in germinating grains. Auxin pathway disturbances specific for pleiotropic tw mutants are generally restricted to organogenesis but not to germination events.

1. Introduction

Grain contamination with fungi and their produced mycotoxins is not only a problem for organic producers but also for conventional agriculture [1]. For barley, special attention is required for malt and beer contamination with mycotoxins and their proper control and avoidance [2].
A group of barley pleiotropic tweaky spike (tw)-type mutants (tw, tw1, tw2) possess a specific tweaked spike structure (Figure S1) and an irregular transformation of lodicules, which are grass-specific floral organs, intoreproductive or chimeric organs. They are also characterized by higher susceptibility to Claviceps purpurea and Ustilago nuda, and increased levels of germinating grain moulding [3,4]. The higher susceptibility of tw-type mutants to fungal pathogens may be explained by their polar spike architecture with the semi-sterile lower part of a spike and overdeveloped multi-rowed upper part, in which flowers with ectopically developed extra floral organs become partially opened during the grain development stage, making it more accessible to external fungal spores and rainwater [3]. Nevertheless, the increased level of mouldy germinating grains (MGG) is unique and deserves further study. Grain infection by fungal pathogens is among the main sources of plant infection [5,6], and grain-borne fungi cause significant grain yield and quality losses via toxin production due to the resulting decrease in the germination rate and the increased number of abnormal and affected seedlings [7]. Although the mechanisms leading to MGG of barley tw-type mutants are poorly studied, this phenomenon can still be employed as a convenient and simple model to test the effects of plant immunity-related substances, making barley tw-type mutants a suitable genetic system for an MGG-based assay.
Our recent studies have related the tw phenotype to disrupted auxin physiology [8,9], providing a pretext to study the role of auxin in the MGG phenomenon. Depending on lifestyle, phytopathogens develop means for controlling plant growth by modulating endogenous auxin synthesis and signalling [10]. Moreover, endophytic auxin-producing fungi may improve plant growth, suppress seed-borne infections, and enhance resistance to abiotic stresses [11,12]. On the other hand, plants evolve mechanisms to repress auxin signalling during pathogen infection as a defence strategy [13,14]. The downregulation of auxin signalling is part of the pathogen-induced host immune response [15]. Mutations in genes responsible for auxin synthesis and signalling are most often used to study the role of auxin in response to pathogen infection. Through the use of these mutations, significant differences in plant auxin–pathogen relationships have been demonstrated for the infection stage [16], different species of the same fungal genus or the same fungus on different plants [17].
The present study aimed to relate the increased levels of MGG in tw mutants with disturbances in the auxin pathway and to employ MGG as an assay to test the effects of potential modifying factors against pathogen manifestation in germinating grains. The effects of grain sterilization and various treatments, including synthetic auxin 2,4-dichlorophenoxyacetic acid (2,4-D), auxin transport inhibitor 9-hydroxyfluorene-9-carboxylic acid (HFCA), antiauxin p-chlorophenoxyisobutyric acid (PCIB), phytohormone salicylic acid (SA), and its precursor trans-cinnamic acid (TCA), were studied on MGG and root growth inhibition, the most pronounced indicator of response to 2,4-D [18], using three allelic tw-type mutants (tw, tw1, tw2). In previous studies, the tw-type mutants were used to study the effects of the antioxidants ascorbic acid and glutathione [19] and SA [20] on MGG frequency and root growth, and the transgenerational transmission of the effects of SA treatment [21]. In the present study, the effects of exogenous 2,4-D, auxin inhibitors, SA, and TCA on MGG and root growth, were compared using a palette of various tweaky-type mutants and WT. The influence of tw-type mutations on the frequency of Bipolaris and Fusarium, two predominant genera of fungi found in the internal tissues of all tested barley genotypes, is also emphasized.

2. Materials and Methods

2.1. Plant Material and Growth Conditions

The plant material used for the study was propagated in an experimental field at the Botanical Garden of Vilnius University, using 2 × 2 m2 plots per genotype, 600–800 plants per plot. All the plant material had been cultivated for many years without pesticide exposure to retain the natural diversity and frequency of plant pathogens.
Recessive allelic tweaky spike-type mutants, tw, tw1 and tw2, were induced by chemical mutagenesis using ethylene imine in the barley cv. Auksiniai II, which has the same genetic background, was used as the Wild type (WT) (Figure S1). During the early phase of stabilization (F4-F6), tw1 and tw2 mutants underwent a period of genetic instability, which led to complete or incomplete reversions to the WT phenotype (tw → Tw), resulting in a large collection of revertants. In the case of incomplete reversion, some revertants preserved several tw-specific features, such as higher protein content in grains and increased resistance to lodging [22]. In the present study, six revertants (N1, N13 and C1—from tw1, N46, C6 and C7—from tw2) were used for the additional comparison of internal grain fungi.
Two other tweaky-type mutants, tweaky N18 (twN18) and tweaky and missing kernels (twmk), were also included in the analysis of 2,4-D effects on MGG and root growth. Both mutants were obtained from the USDA-ARS National Small Grains Collection (Aberdeen, ID, USA) and possess tweaked spikes, but their susceptibility to fungal infections is unknown. The complementation test revealed twN18 and twmk mutants to belong to complementation groups other than the allelic tw-type mutants [23]. The grains used in the present study for the MGG analysis were selected from different years of growth, and stored at +4 °C in the dark until the analysis was performed. The years of reproduction are indicated in the legends of Figures 3–5 and the footers of Tables S3–S5.

2.2. Mouldy Germinating Grain (MGG) Test

All manipulations were performed under sterile conditions. The seed material was divided into two groups: (1) nonsterilized, deionized water-imbibed grains to evaluate the natural infection level and (2) grains surface-sterilized with a water-diluted commercial bleach ACE solution (1:1, v/v) for 15 min and then washed with sterile water three times for 2 min. The grains were then soaked in solutions of synthetic auxin 2,4-D (50–800 mg L−1), the auxin transport inhibitor 9-hydroxyfluorene-9-carboxylic acid (HFCA) or antiauxin p-chlorophenoxyisobutyric acid (PCIB) (200 μM), phytohormone SA or its precursor TCA (0.25–1.0 mM) for 12 h, rewashed with autoclaved water and placed in Petri dishes (ten grains per dish) with three layers of wet filter paper. The frequencies of MGG, germination rate, and root length were determined after five days of growing at 25 °C in the dark. Mouldy grains were scored and removed from the Petri dishes every day to prevent infection of the neighbouring grains. All the experiments were performed in three independent replicates, ten Petri dishes with 10 grains per dish (i.e., 100 grains in total) were used per treatment. For root length measurements, roots of 30 germinating grains were measured in total (i.e., 10 germinating grains per experimental replicate). The concentrations of the compounds were selected from small-scale experiments and our previous studies [8,9]. 2,4-D was manufactured by Alfa Aesar (Germany), and all the other compounds were obtained from Sigma-Aldrich (USA).

2.3. Identification of Internal Fungi in Barley Grains

The pure culture method was applied for the detection of fungi inside the seeds [24]. The grains were sterilized with 3% NaClO for 2 min and washed with sterile water three times for 2 min. The grains were then dried with sterile filter paper, placed on Petri dishes containing malt extract agar (MEA) medium (2%) and streptomycin (250 mg L−1), and maintained at 24 °C for seven days in the dark. The fungi were identified according to their morphological and cultural characteristics as described by Mačkinaitė [25].

2.4. Investigation of Effects of Meal on B. sorokiniana Growth

To study the potential inhibitory effects of meal from WT or allelic mutants tw, tw1, and tw2 under the background of SA or TCA, pure cultures of B. sorokiniana were isolated from sterilized barley grains using a single spore technique and deposited in the collection of the Institute of Botany, Nature Research Centre, Vilnius, Lithuania. The isolate of B. sorokiniana was reidentified by a taxon-specific polymerase chain reaction. Briefly, genomic DNA was extracted from 50 mg of wet mycelium using Fungi/Yeast Genomic DNA Isolation Kit (Norgen Biotek Corporation, Thorold, Canada) following the manufacturer’s recommendations. Species-specific PCR was carried out according to [26] using the Green PCR Master Mix (Thermo Scientific™, USA) and species-specific primer pair (FW 5′GGTCCGAGACAACCAACAA3′ and RV 5′AAAGAAAGCGGTCGACGTAA3′). The 600 bp species-specific SCAR PCR product was electrophoresed in 1.2% agarose gel containing ethidium bromide (0.5 μg mL−1) in 1× Tris–Borate–EDTA buffer.
Meals from WT and different tw-type mutants (60 g L−1) and SA or TCA (0–1 mM) were added directly to the MEA medium before autoclaving. The diameter of B. sorokiniana colonies was measured after seven days of incubation at 24 °C in the dark.

2.5. Statistical Analysis

The results are representative of three independent experiments performed at least in triplicate and are shown as the mean values ± standard error (SE) of the mean in the tables and figures. The assumption of data normality was assessed through the Shapiro–Wilk test using Past (version 3.26) software. Since at least some of the data sets did not follow a normal distribution, a nonparametric Kruskal–Wallis rank-sum (omnibus) test was performed using Statistica 64 (version 12.0) software. Dunn’s test with Benjamini–Hochberg (FDR) adjustment was used as a post hoc test to examine the differences between the sterilized and unsterilized grains or multiple pairwise comparisons of different treatments and the control.

3. Results

3.1. The Action of 2,4-D, SA and TCA on MGG and Root Growth of Allelic Tweaky Spike Mutants

Naturally, grain sterilization before germination is an effective treatment against MGG. In most cases studied, the MGG level was significantly lower in surface-sterilized grains than in unsterilized grains under the same experimental conditions, and independent of the plant genotype and the studied 2,4-D concentrations (Figure 1a and Figure 2a, Tables S1a and S2a).
In the range of 10–50 mg L−1, an appreciable inhibitory effect of 2,4-D on the root growth of allelic tw-type mutants depended on (1) the plant genotype and (2) the sterilization status of grains (Figure 1b and Table S1b). In most cases, 2,4-D significantly inhibited root growth only in unsterilized germinating grains of all tested genotypes, including the nonallelic twN18 and twmk mutants. The twmk mutant was the most sensitive to 2,4-D among all tested tweaky-type mutants. In contrast, 2,4-D-induced root growth inhibition in sterilized germinating grains mostly in a nonsignificant manner (Figure 1b and Table S1b).
The tested lower 2,4-D concentrations (10–50 mg L−1) revealed an interesting dependence of 2,4-D-induced root growth inhibition on grain sterilization status; consequently, the effect of elevated 2,4-D concentrations was investigated in further experiments. In the range of 50–800 mg L−1 2,4-D, a significant effect of 2,4-D on MGG was observed only in unsterilized grains of WT (p = 0.0026), in which 2,4-D increased the level of MGG (Figure 2a and Table S2a), while in the range of 10–50 mg L−1 2,4-D, a significant increase in MGG was observed only in sterilized grains of the tw2 genotype (p = 0.024; Figure 1a and Table S1a).
In contrast to the effect of the lower concentrations, the higher concentrations (50–800 mg L−1) of 2,4-D induced a significant decrease in root length independent of the plant genotype and the grain sterilization conditions, and the inhibitory effect of 2,4-D on root growth was dose-dependent (Figure 2b,c and Table S2b). The root growth of the tw and tw2 allelic mutants, but not the tw1 allelic mutant, was weaker than that of WT germinating grains. An unsterilized grain background better revealed the inhibitory effect of 2,4-D on the germination rate, which was uniform independent of the plant genotype. In turn, grain sterilization revealed better differences among allelic mutants in the response to 2,4-D according to the germination rate (Table S2c). In general, 2,4-D in the range of 50–800 mg L−1 inhibited root length independent of the plant genotype (Figure 2c), while in the range of 10–50 mg L−1 2,4-D, differences between WT and tw-type mutants and among allelic tw mutants themselves were observed (Figure 1).
Despite the proposed opposite effects to the action of 2,4-D, the auxin inhibitors HFCA and PCIB did not show a significant effect on MGG, except PCIB in sterilized grains of the tw2 mutant, in which the MGG level decreased (Figure 2a and Table S2a). However, both auxin inhibitors suppressed root growth similarly to 2,4-D (Figure 2c and Table S2b).
Theoretically, the effects of TCA and SA are supposed to be opposite to those of 2,4-D, and TCA decreased the frequency of MGG in unsterilized germinating grains of the WT and all allelic tw-type mutants (Figure 3 and Table S3).
However, in sterilized germinating grains, TCA decreased MGG at a significant level only in the allelic tw mutant, while SA decreased MGG at a significant level only in unsterilized grains of the tw2 mutant (Figure 3 and Table S3a). Similar to 2,4-D, SA and TCA also inhibited root growth, but only in the allelic mutant tw2 (Figure 3b and Table S3b). Neither compound showed any effect on the grain germination rate (Table S3c).

3.2. Fungi Spectrum in the Internal Grain Tissues of Barley tw-Type Mutants and Revertants

To reveal the possible differences in the fungal diversity in surface-sterilized mouldy germinating grains of tested barley genotypes, the spectrum of fungi species was investigated. Among the fungi that frequently reside in the internal tissues of barley grains, B. sorokiniana prevailed in all the tested plant genotypes (Figure 4 and Table S4). In addition to the WT, tw1 and tw2 mutants, the fungi spectra were also studied in several revertants that arose during the phase of stabilization of tw1 and tw2 mutants. The revertant studies allowed for a broader understanding of the differences between tw-type mutants and the WT.
In the grains of the tw1 and tw2 mutants, the B. sorokiniana frequency was lower than that in the WT strain, but the difference was only statistically significant in tw1. Interestingly, the level of B. sorokiniana was only significantly lower in grains of revertant N1 compared to WT (p < 0.05) and remained the same as in grains of its parental mutant tw1. Such a tendency was not observed. A similar tendency was also observed in other revertants, except for the compactoid (C)-type revertants from tw2, but only in an insignificant manner. However, a decrease in the Bipolaris proportion occurred at the expense of the increasing Fusarium portion in the fungi spectra, and the observed effect was statistically significant (Figure 4). Comparable results were also obtained after analysing the fungi spectra in the internal grain tissues in our previous studies [22]. This finding provided a pretext for studying the effects of grain meals made from the different tw-type allelic mutants and the WT on B. sorokiniana growth.

3.3. The Impact of Meals from Grains of tw-Type Mutants on the Colony Growth of Bipolaris sorokiniana

The growth of B. sorokiniana colonies on MEA media supplemented with meals prepared from the grounded dry grains of allelic mutants tw, tw1, and tw2 was compared with B. sorokiniana growth on MEA medium containing meals from the grains of WT. Additionally, the effects of the SA and TCA concentrations were investigated on such media (Figure 5). The meals from the allelic tw mutants significantly decreased the growth of B. sorokiniana colonies. In most cases, a further statistically significant decrease in Bipolaris colony growth occurred only after TCA but not SA addition. SA decreased the growth of B. sorokiniana in a concentration-dependent manner only in tw2. TCA also showed a strong inhibitory effect on B. sorokiniana growth on MEA media with meals from the WT. Even the lowest concentration of TCA, 0.05 mM, significantly decreased the growth of Bipolaris colonies, and a further increase in TCA concentration did not enhance its inhibitory effect on B. sorokiniana growth in WT media (Figure 5).

4. Discussion

Multi-year studies of tw-type mutants have revealed the significant variation in MGG expression observed in the seed material from different years and statistically significant differences in MGG levels between the allelic tw-type mutants (Table 1). Naturally, among the most important factors that influence the occurrence of fungal diseases is weather conditions during the growing season [27,28,29]. However, another source of such variations may lie in the highly variable expressivity of the tw phenotype. One of the main characteristics of tw-type mutants is the irregular transformations of lodicules, grass-specific floral organs, to sterile reproductive organs, which partially open the flowers and physically facilitate the penetration of pathogen spores and water into the developing grain [3]. Depending on the years, the fraction of aberrant flowers of mutants tw, tw1, and tw2 fluctuates in the ranges of 63–80%, 29–48% and 32–90% (respectively) [unpublished data], and such expressivity variations in flower structure from year to year can directly influence the quality of grains from different years.
The present study revealed a smaller than expected effect of the exogenous synthetic auxin 2,4-D and both auxin inhibitors HFCA and PCIB on MGG frequency in tw-type mutants, considering their dramatic rescue effects on variations in spike and floral structure (respectively), which were revealed in our previous works [8,9]. Such a negligible effect of 2,4-D and both auxin inhibitors on MGG frequency of different tweaky-type mutants, strongly suggests that auxin pathway disturbances in tw-type mutants are generally restricted to the spike and floral structure but not to germination events.
A notable feature of the grain material used in the present study is the pesticide-free production mode, which was applied for many years. Under the background of high natural infection, the most effective means against the moulding of germinating grains is widely used grain surface sterilization [31,32,33], which was effective independently of the plant genotype and seed material from different years. However, a comparison of sterilized and unsterilized seed material appeared to be an effective strategy for the auxin–pathogen relationship study. A significant increase in the MGG level was only determined after 2,4-D treatment of unsterilized WT grains (Figure 1a, Table S1a), while the inhibitory effects of salicylic acid and especially trans-cinnamic acid on the MGG frequency were also statistically significant only for unsterilized germinating grains of the tested plant genotypes (Figure 3a). Comparison of sterilized and unsterilized grains in the MGG assay also revealed differences among the allelic mutants tw, tw1, and tw2 in response to 2,4-D. Allelic differences in the pathogen response related to auxin action are poorly studied. Stotz et al. [34] determined differences among allelic mutants in the transcriptional repressor auxin response factor 2 (arf2) gene in response to the ascomycete Sclerotinia sclerotiorum. From the multi-year studies of tw-type mutants, it was concluded that tw2 is the most sensitive to MGG (Table 1). Comparison of sterilized and unsterilized grains in the present analysis also confirmed tw2 to be the most responsive to 2,4-D in the MGG assay (Figure 1 and Figure 2).
The increase in MGG frequency after 2,4-D treatment in some cases of the present study (Figure 1a and Figure 2a) coincides with the known auxin effects on phytopathogens. Endogenous auxin was demonstrated to enhance the invasion of biotrophs and to inhibit the development of necrotrophs [13,35,36,37]. In contrast, exogenously applied auxin, in general, showed the opposite effect when the invasion of nectrotrophs was escalated after auxin application [38,39]. The predominant internal fungi in all tested barley genotypes belonged to the Bipolaris and Fusarium genera (Figure 4), both of which are considered hemibiotrophic, exhibiting a brief biotrophic phase before switching to the dominant necrotrophic phase [40,41]. This conclusion is also supported by the inhibitory effects of SA and TCA on MGG revealed in the present study. It was demonstrated that SA suppresses pathogen growth in plants through the repression of auxin signalling [42,43]; therefore, the SA and auxin pathways act in a mutually antagonistic manner during plant defence responses [13,35,44,45]. TCA, one of the precursors of SA, also has antifungal properties and is considered a natural protective substance against phytopathogens [46,47]. TCA was long considered an auxin transport inhibitor, but recent works have suggested that another isomer, cis-cinnamic acid, but not TCA, is a potent inhibitor of auxin efflux, hence the exact physiological activity of TCA has remained a matter of debate [48].
The effects of tweaky spike mutations on fungi spectra are also notable. In internal grain tissues of all tested barley genotypes, the prevailing fungus in the spectra was Bipolaris sorokiniana (teleomorph: Cochliobolus sativus) (Figure 4). This agrees with recent publications on fungal spectra in barley grains in the Baltic region [49,50]. B. sorokiniana causes severe diseases and significant yield losses mainly in warm humid growing regions; nevertheless, it has spread towards the Northern Hemisphere [6,51]. The present study shows that its spread strongly depends on the plant genotype. In both tw-type mutants and most revertants tested, a decrease in the B. sorokiniana proportion and an increase in the Fusarium spp. proportion occurred in the fungi spectra (Figure 4). This trend suggests that the grains of tw-type mutants contain substances that are unfavourable for B. sorokiniana growth. The following supposition was also confirmed by B. sorokiniana growing on media supplemented with meals from individual tw allelic mutants and the WT. A decrease in B. sorokiniana in the fungal spectra of tw-type mutants coincides with the growth inhibition of B. sorokiniana colonies on media with the addition of meals from all allelic tw mutants (Figure 2).
The present study showed that more appreciable conclusions on the action of the modifying factors could be made when the MGG assay is performed in parallel with the root growth test. The inhibition of root elongation of germinating grains is one of the earliest and most distinct symptoms exhibited in response to auxins, especially 2,4-D [18], but auxin promotes lateral root formation [13], and this auxin feature is related to pathogen invasion [17]. In the present study, significant differences in 2,4-D-induced root growth inhibition among the different allelic tw-type mutants were revealed only in the lower range (10–50 mg L−1) of 2,4-D concentrations (Figure 1b). Moreover, significant root length inhibition with 2,4-D in the allelic mutants tw and tw2 and the nonallelic mutant twN18 was only observed in unsterilized germinating grains, whereas in sterilized grains, root growth inhibition in these mutants was absent (Figure 1). While differences in MGG frequency between sterilized and unsterilized grains are naturally expected, the dependence of root growth after 2,4-D treatment on grain sterilization status was quite an unexpected phenomenon. Hypochlorite-based agents, including commercial bleach, are routinely used for surface sterilization of various plant materials [32,52]. Hypochlorite was proposed to react with the seed surface, forming a chlorine cover that is not completely removed by rinsing, and subsequently can be converted into highly toxic chloramines that easily penetrate plant tissues [32]. Furthermore, various salts are known to antagonize the phytotoxicity of several herbicides, including 2,4-D [53,54]. After surface sterilization with commercial bleach, nonremovable chlorine compounds can antagonise exogenously applied 2,4-D and subsequently diminish the effect of root growth inhibition in comparison to that of unsterilized 2,4-D-treated grains. This observation highlights the importance of comparing sterilized and unsterilized grain conditions in studies of plant-auxin–pathogen relationships where the action of exogenous auxin will be analysed in germinating grains since hypochlorite-based sterilization itself can lead to underestimation of the 2,4-D effect on root growth.

5. Conclusions

Our findings allow us to reach a number of conclusions. The effect of exogenous 2,4-D on barley MGG coincides with the role of auxin in the invasion of necrotrophs, but its effect on MGG was found to be lower, as may be expected based on the effects of 2,4-D on spike structure.
The effects of SA, TCA, and 2,4-D on MGG depended on the grain sterilization status.
The tweaky spike mutation caused variations in the fungi spectra in the germinating barley grains by decreasing the B. sorokiniana and increasing the Fusarium spp. proportions. This result agrees with the negative effects of meals from the tw2 mutant on B. sorokiniana growth.
The effect of low doses of 2,4-D on barley root growth depended on the grain sterilization status, suggesting hypochlorite-based surface sterilization methods should be used with caution in studies where the action of exogenous 2,4-D will be analysed in germinating grains.
A group of tw-type barley mutants is a convenient model for the investigation of immunity-related substances in barley MGG.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy11112180/s1, Table S1. Effects of 2,4-D over a 10–50 mg L−1 range on the frequency of mouldy germinating grains (a), root length (b) and grain germination rate (c) of barley tw mutants and the WT. (d) p values of differences between sterilized and unsterilized grains under different experimental conditions. Table S2. Effects of 2,4-D over the 50–800 mg L−1 range and the auxin inhibitors HFCA and PCIB on the frequency of mouldy germinating barley grains (a) root length (b) and grain germination rate (c) of tw mutants and the WT. (d) p values of differences between sterilized and unsterilized grains under different experimental conditions. Table S3. Effects of salicylic acid (SA) and trans-cinnamic acid (TCA) on the frequencies of mouldy germinating grains (a) root length (b) and germination rate (c) of barley tw mutants and the WT. (d) p values of differences between sterilized and unsterilized grains under different experimental conditions. Table S4. Frequency of fungi in the internal grain tissues of barley tw mutants, revertants and the WT. Figure S1. Spikes of barley genetic material used in the present study. From left: WT (cv. Auksiniai II), tweaky spike, tweaky N18, tweaky and missing kernel; and revertants: C, compactoid and N, normal spike shape.

Author Contributions

Conceptualization, R.Š. and V.R.; Investigation, R.Š., V.V. and R.M.; Methodology, R.Š., V.V. and R.M.; Supervision, V.R.; Visualization, R.Š.; Writing—original draft, R.Š. and V.R.; Writing—review & editing, R.Š., V.V., R.M. and V.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the Supplementary Material of this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pinotti, L.; Ottoboni, M.; Giromini, C.; Dell’Orto, V.; Cheli, F. Mycotoxin contamination in the EU feed supply chain: A focus on cereal byproducts. Toxins 2016, 8, 45. [Google Scholar] [CrossRef] [PubMed]
  2. Pascari, X.; Ramos, A.J.; Marín, S.; Sanchís, V. Mycotoxins and beer. Impact of beer production process on mycotoxin contamination. A review. Food Res. Int. 2018, 103, 121–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Rančelis, V.; Žilinskaitė, S.; Vaitkūnienė, V.; Kačergius, A.; Kasparavičius, J. Immunodeficiency of barley allelic mutants ‘tweaky spike’.1. Susceptibility to Ustilago nuda (Jens.) Rostr. and Claviceps purpurea Tul. Biologija 1994, 4, 14–22. [Google Scholar]
  4. Mačkinaitė, R.; Kačergius, A.; Kasparavičius, J.; Balčiūnienė, L.; Vaitkūnienė, V.; Žilinskaitė, S.; Rančelis, V. Immunodeficiency of barley allelic mutants ‘tweaky spike’. II. Mildewed germinating grains and micromycetes. Biologija 1996, 4, 11–18. [Google Scholar]
  5. Assunção, R.; Silva, M.J.; Alvito, P. Challenges in risk assessment of multiple mycotoxins in food. World Mycotoxin J. 2016, 9, 791–811. [Google Scholar] [CrossRef] [Green Version]
  6. Bengyella, L.; Iftikhar, S.; Nawaz, K.; Fonmboh, D.J.; Yekwa, E.L.; Jones, R.C.; Njanu, Y.M.T.; Roy, P. Biotechnological application of endophytic filamentous Bipolaris and Curvularia: A review on bioeconomy impact. World J. Microbiol. Biotechnol. 2019, 35, 69. [Google Scholar] [CrossRef] [PubMed]
  7. Janssen, E.M.; Liu, C.; Van der Fels-Klerx, H.J. Fusarium infection and trichothecenes in barley and its comparison with wheat. World Mycotoxin J. 2018, 11, 33–46. [Google Scholar] [CrossRef]
  8. Šiukšta, R.; Vaitkūnienė, V.; Kaselytė, G.; Okockytė, V.; Žukauskaitė, J.; Žvingila, D.; Rančelis, V. Inherited phenotype instability of inflorescence and floral organ development in homeotic barley double mutants and its specific modification by auxin inhibitors and 2,4-D. Ann. Bot. 2015, 115, 651–663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Šiukšta, R.; Vaitkūnienė, V.; Rančelis, V. Is auxin involved in the induction of genetic instability in barley homeotic double mutants? Planta 2018, 247, 483–498. [Google Scholar] [CrossRef] [PubMed]
  10. Ludwig-Müller, J. Bacteria and fungi controlling plant growth by manipulating auxin: Balance between development and defense. J. Plant Physiol. 2015, 172, 4–12. [Google Scholar] [CrossRef] [PubMed]
  11. Murphy, B.R.; Doohan, F.M.; Hodkinson, T.R. Persistent fungal root endophytes isolated from a wild barley species suppress seed-borne infections in a barley cultivar. Biocontrol 2015, 60, 281–292. [Google Scholar] [CrossRef]
  12. Qiang, X.; Ding, J.; Lin, W.; Li, Q.; Xu, C.; Zheng, Q.; Li, Y. Alleviation of the detrimental effect of water deficit on wheat (Triticum aestivum L.) growth by an indole acetic acid-producing endophytic fungus. Plant Soil 2019, 439, 373–391. [Google Scholar] [CrossRef]
  13. Kazan, K.; Lyons, R. Intervention of phytohormone pathways by pathogen effectors. Plant Cell 2014, 26, 2285–2309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Chanclud, E.; Morel, J.B. Plant hormones: A fungal point of view. Mol. Plant Pathol. 2016, 17, 1289–1297. [Google Scholar] [CrossRef]
  15. Robert-Seilaniantz, A.; Navarro, L.; Bari, R.; Jones, J.D. Pathological hormone imbalances. Curr. Opin. Plant Biol. 2007, 10, 372–379. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, J.; Peng, Y.; Guo, Z. Constitutive expression of pathogen-inducible OsWRKY31 enhances disease resistance and affects root growth and auxin response in transgenic rice plants. Cell Res. 2008, 18, 508–521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Kidd, B.N.; Kadoo, N.Y.; Dombrecht, B.; Tekeoglu, M.; Gardiner, D.M.; Thatcher, L.F.; Aitken, E.A.; Schenk, P.M.; Manners, J.M.; Kazan, K. Auxin signaling and transport promote susceptibility to the root-infecting fungal pathogen Fusarium oxysporum in Arabidopsis. Mol. Plant Microbe Interact. 2011, 24, 733–748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Scheitz, K.; Lüthen, H.; Schenck, D. Rapid auxin-induced root growth inhibition requires the TIR and AFB auxin receptors. Planta 2013, 238, 1171–1176. [Google Scholar] [CrossRef] [PubMed]
  19. Vaitkūnienė, V.; Čėsnienė, T.; Balčiūnienė, L.; Barysas, D.; Vaišnienė, V.; Rančelis, V. Immunodeficiency of barley allelic mutants tweaky spike. 4. Action of thiolic compounds and ascorbic acid on the frequency of mouldy grains. Biologija 1997, 2, 6–11. [Google Scholar]
  20. Vaitkūnienė, V.; Balčiūnienė, L.; Varnaitė, A.; Rančelis, V. Response of barley immunodeficient mutants tweaky spike to salicylic acid in field conditions. Biologija 2005, 2, 13–20. [Google Scholar]
  21. Vaitkūnienė, V.; Balčiūnienė, L.; Varnaitė, A.; Rančelis, V. Quality of seed material of barley tw type mutants according to susceptibility to micromycetes after treatment of previous generation with salicylic acid. Biologija 2005, 3, 41–45. [Google Scholar]
  22. Vaitkūnienė, V.; Varnaitė, A.; Balčiūnienė, L.; Rančelis, V.; Mačkinaitė, R.; Leistrumaitė, A. Two types of revertants from the same homeotic barley mutants tweaky spike. Biologija 2006, 2, 18–23. [Google Scholar]
  23. Vaitkūnienė, V.; Varnaitė, A.; Rančelis, V. Interaction of barley tweaky spike and laxatum mutations in F1 hybrids. Biologija 2004, 4, 10–15. [Google Scholar]
  24. Mathur, S.B.; Kongsdal, O. Common Laboratory Seed Health Testing Methods for Detecting Fungi; Danish Government Institute of Seed Pathology for Developing Countries: Copenhagen, Denmark, 2003.
  25. Mačkinaitė, R. Internal mycobiota of wild and cultivated common caraway (Carum carvi L.) seeds. Zemdirbyste 2011, 98, 183–194. [Google Scholar]
  26. Aggarwal, R.; Gupta, S.; Banerjee, S.; Singh, V.B. Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat. Can J. Microbiol. 2011, 57, 934–942. [Google Scholar] [CrossRef] [PubMed]
  27. Te Beest, D.E.; Paveley, N.D.; Shaw, M.W.; van den Bosch, F. Disease-weather relationships for powdery mildew and yellow rust on winter wheat. Phytopathology 2008, 98, 609–617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Junk, J.; Kouadio, L.; Delfosse, P.; El Jarroudi, M. Effects of regional climate change on brown rust disease in winter wheat. Clim. Chang. 2016, 135, 439–451. [Google Scholar] [CrossRef] [Green Version]
  29. Różewicz, M.; Wyzińska, M.; Grabiński, J. The most important fungal diseases of cereals—Problems and possible solutions. Agronomy 2021, 11, 714. [Google Scholar] [CrossRef]
  30. Balčiūnienė, L.; Bieliūnienė, A.; Kazlauskaitė, D.; Vaitkūnienė, V.; Rančelis, V. Barley mutants with phenotypical gradient of spike development. Proc. Latv. Acad. Sci. B Nat. Exact Appl. Sci. 2001, 55, 207–211. [Google Scholar]
  31. Sauer, D.B.; Burroughs, R. Disinfection of seed surfaces with sodium hypochlorite. Phytopathology 1986, 76, 745–749. [Google Scholar] [CrossRef]
  32. Miché, L.; Balandreau, J. Effects of rice seed surface sterilization with hypochlorite on inoculated Burkholderia vietnamiensis. Appl. Environ. Microbiol. 2001, 67, 3046–3052. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Davoudpour, Y.; Schmidt, M.; Calabrese, F.; Richnow, H.H.; Musat, N. High resolution microscopy to evaluate the efficiency of surface sterilization of Zea mays seeds. PLoS ONE 2020, 15, e0242247. [Google Scholar] [CrossRef]
  34. Stotz, H.U.; Jikumaru, Y.; Shimada, Y.; Sasaki, E.; Stingl, N.; Mueller, M.J.; Kamiya, Y. Jasmonate-dependent and COI1-independent defense responses against Sclerotinia sclerotiorum in Arabidopsis thaliana: Auxin is part of COI1-independent defense signaling. Plant Cell Physiol. 2011, 52, 1941–1956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Llorente, F.; Muskett, P.; Sánchez-Vallet, A.; López, G.; Ramos, B.; Sánchez-Rodríguez, C.; Jordá, L.; Parker, J.; Molina, A. Repression of the auxin response pathway increases Arabidopsis susceptibility to necrotrophic fungi. Mol. Plant 2008, 1, 496–509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Meents, A.K.; Furch, A.; Almeida-Trapp, M.; Özyürek, S.; Scholz, S.S.; Kirbis, A.; Lenser, T.; Theißen, G.; Grabe, V.; Hansson, B.; et al. Beneficial and pathogenic Arabidopsis root-interacting fungi differently affect auxin levels and responsive genes during early infection. Front. Microbiol. 2019, 10, 380. [Google Scholar] [CrossRef] [PubMed]
  37. Huang, S.; Zhang, X.; Fernando, W. Directing Trophic Divergence in Plant-Pathogen Interactions: Antagonistic Phytohormones with NO Doubt? Front. Plant Sci. 2020, 11, 600063. [Google Scholar] [CrossRef] [PubMed]
  38. Petti, C.; Reiber, K.; Ali, S.S.; Berney, M.; Doohan, F.M. Auxin as a player in the biocontrol of Fusarium head blight disease of barley and its potential as a disease control agent. BMC Plant Biol. 2012, 12, 224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Luo, K.; Rocheleau, H.; Qi, P.F.; Zheng, Y.L.; Zhao, H.Y.; Ouellet, T. Indole-3-acetic acid in Fusarium graminearum: Identification of biosynthetic pathways and characterization of physiological effects. Fungal Biol. 2016, 120, 1135–1145. [Google Scholar] [CrossRef] [PubMed]
  40. Kumar, J.; Schäfer, P.; Hückelhoven, R.; Langen, G.; Baltruschat, H.; Stein, E.; Nagarajan, S.; Kogel, K.H. Bipolaris sorokiniana, a cereal pathogen of global concern: Cytological and molecular approaches towards better control. Mol. Plant Pathol. 2002, 3, 185–195. [Google Scholar] [CrossRef]
  41. Trail, F. For blighted waves of grain: Fusarium graminearum in the postgenomics era. Plant.Physiol. 2009, 149, 103–110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Wang, D.; Pajerowska-Mukhtar, K.; Culler, A.H.; Dong, X. Salicylic acid inhibits pathogen growth in plants through repression of the auxin signaling pathway. Curr. Biol. 2007, 17, 1784–1790. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Navarro, L. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 2006, 312, 436–439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Thomma, B.P.; Eggermont, K.; Penninckx, I.A.; Mauch-Mani, B.; Vogelsang, R.; Cammue, B.P. Separate jasmonate-dependent and salicylate-dependent defense response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc. Natl. Acad. Sci. USA 1998, 95, 15107–15111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Bari, R.; Jones, J.D.G. Role of plant hormones in plant defence responses. Plant Mol. Biol. 2009, 69, 473–488. [Google Scholar] [CrossRef] [PubMed]
  46. Guzman, J.D. Natural cinnamic acids, synthetic derivatives and hybrids with antimicrobial activity. Molecules 2014, 19, 19292–19349. [Google Scholar] [CrossRef]
  47. Zhou, K.; Chen, D.; Li, B.; Zhang, B.; Miao, F.; Zhou, L. Bioactivity and structure-activity relationship of cinnamic acid esters and their derivatives as potential antifungal agents for plant protection. PLoS ONE 2017, 12, e0176189. [Google Scholar] [CrossRef]
  48. Steenackers, W.J.; Klíma, P.; Quareshy, M.; Cesarino, I.; Kumpf, R.P.; Corneillie, S.; Araújo, P.; Viaene, T.; Goeminne, G.; Nowack, M.K.; et al. Cis-cinnamic acid is a novel, natural auxin efflux inhibitor that promotes lateral root formation. Plant Physiol. 2016, 173, 552–565. [Google Scholar] [CrossRef] [Green Version]
  49. Sooväli, P.; Koppel, M.; Kangor, T. Effectiveness of seed treatment against Fusarium spp. and Cochliobolus sativus of spring barley in different conditions. Agron. Res. 2018, 15, 280–287. [Google Scholar]
  50. Liatukas, Ž.; Supronienė, S.; Ruzgas, V.; Leistrumaitė, A. Effects of organic seed treatment methods on spring barley seed quality, crop, productivity and disease incidence. Zemdirbyste 2019, 106, 241–248. [Google Scholar] [CrossRef] [Green Version]
  51. Gupta, P.K.; Chand, R.; Vasistha, N.K.; Pandey, S.P.; Kumar, U.; Mishra, V.K.; Joshi, A.K. Spot blotch disease of wheat: The current status of research on genetics and breeding. Plant. Pathol. 2018, 67, 508–531. [Google Scholar] [CrossRef]
  52. Lindsey, B.E.; Rivero, L.; Calhoun, C.S.; Grotewold, E.; Brkljacic, J. Standardized method for high-throughput sterilization of Arabidopsis seeds. J. Vis. Exp. 2017, 128, 56587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Nalewaja, J.D.; Woznica, Z.; Matysiak, R. 2,4-D amine antagonism by salts. Weed Technol. 1991, 5, 873–880. [Google Scholar] [CrossRef]
  54. Nalewaja, J.D.; Matysiak, R. 2,4-D and salt combinations affect glyphosate phytotoxicity. Weed Technol. 1992, 6, 322–327. [Google Scholar] [CrossRef]
Agronomy 11 02180 g001 550
Figure 1. Effects of 2,4-D over a 10–50 mg L−1 range on barley tweaky-type mutants. (a) The frequency of mouldy grains (%) and (b) the root lengths (cm) of unsterilized and sterilized germinating grains measured after 5 days. For mouldy grains, n = 10 Petri dishes (100 grains); for root length n = 30; for tw2, n = 15 Petri dishes (150 grains) and n = 60. WT2016 and tw22016, grain reproduction in 2016; other material, grain reproduction in 2013; the MGG assay was performed in 2017. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the control and the 2,4-D treatment. The numbers denote significant differences (1 p < 0.05; 2 p < 0.01) between the controls of the tw-type mutant and the WT.
Figure 1. Effects of 2,4-D over a 10–50 mg L−1 range on barley tweaky-type mutants. (a) The frequency of mouldy grains (%) and (b) the root lengths (cm) of unsterilized and sterilized germinating grains measured after 5 days. For mouldy grains, n = 10 Petri dishes (100 grains); for root length n = 30; for tw2, n = 15 Petri dishes (150 grains) and n = 60. WT2016 and tw22016, grain reproduction in 2016; other material, grain reproduction in 2013; the MGG assay was performed in 2017. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the control and the 2,4-D treatment. The numbers denote significant differences (1 p < 0.05; 2 p < 0.01) between the controls of the tw-type mutant and the WT.
Agronomy 11 02180 g001
Agronomy 11 02180 g002 550
Figure 2. Effects of 2,4-D over a range of 50–800 mg L−1 and the auxin inhibitors HFCA and PCIB on (a) the frequency of mouldy grains (%) and (b,c) the root length (cm) of unsterilized germinating grains of tw mutants and the WT, as measured after 5 days. For mouldy grains, n = 10 Petri dishes (100 grains); for root length, n = 30. Grain was produced in 2013, and the MGG assay was performed in 2017. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the control and the 2,4-D treatment. The numbers denote significant differences (1 p < 0.05; 2 p < 0.01) between the controls of the tw-type mutant and the WT.
Figure 2. Effects of 2,4-D over a range of 50–800 mg L−1 and the auxin inhibitors HFCA and PCIB on (a) the frequency of mouldy grains (%) and (b,c) the root length (cm) of unsterilized germinating grains of tw mutants and the WT, as measured after 5 days. For mouldy grains, n = 10 Petri dishes (100 grains); for root length, n = 30. Grain was produced in 2013, and the MGG assay was performed in 2017. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the control and the 2,4-D treatment. The numbers denote significant differences (1 p < 0.05; 2 p < 0.01) between the controls of the tw-type mutant and the WT.
Agronomy 11 02180 g002
Agronomy 11 02180 g003 550
Figure 3. Effects of salicylic (SA) and trans-cinnamic (TCA) acids on (a) the frequency of mouldy grains (%) and (b) the root lengths (cm) of unsterilized and sterilized germinating grains of barley tw mutants and the WT, as measured after 5 days. For mouldy grains, n = 10 (100 grains); for root length, n = 30. Grain was produced in 2016, and the MGG test was performed in 2020. The asterisks represent significant differences (* p < 0.05; ** p < 0.01) between the control and the SA or TCA treatment. The numbers denote significant differences (2 p < 0.01; 3 p < 0.001) between the controls of the tw-type mutant and the WT.
Figure 3. Effects of salicylic (SA) and trans-cinnamic (TCA) acids on (a) the frequency of mouldy grains (%) and (b) the root lengths (cm) of unsterilized and sterilized germinating grains of barley tw mutants and the WT, as measured after 5 days. For mouldy grains, n = 10 (100 grains); for root length, n = 30. Grain was produced in 2016, and the MGG test was performed in 2020. The asterisks represent significant differences (* p < 0.05; ** p < 0.01) between the control and the SA or TCA treatment. The numbers denote significant differences (2 p < 0.01; 3 p < 0.001) between the controls of the tw-type mutant and the WT.
Agronomy 11 02180 g003
Agronomy 11 02180 g004 550
Figure 4. Spectra of fungi (%) in the internal grain tissues of barley tw mutants and the WT. The middle row—revertants from tw1; the lower row—revertants from tw2. N—revertants with normal spike and floral structure, C—revertants with normal floral structure but compactoid spikes. Grain was produced in 2013, and the analysis was performed in 2014. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the tw-type mutant and the WT (in the upper row) or between the revertant and the respective initial tw mutant (N1, N13 and C1 derived from tw1, N46, C6 and C7—from tw2).
Figure 4. Spectra of fungi (%) in the internal grain tissues of barley tw mutants and the WT. The middle row—revertants from tw1; the lower row—revertants from tw2. N—revertants with normal spike and floral structure, C—revertants with normal floral structure but compactoid spikes. Grain was produced in 2013, and the analysis was performed in 2014. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the tw-type mutant and the WT (in the upper row) or between the revertant and the respective initial tw mutant (N1, N13 and C1 derived from tw1, N46, C6 and C7—from tw2).
Agronomy 11 02180 g004
Agronomy 11 02180 g005 550
Figure 5. Effects of salicylic acid (SA) and trans-cinnamic acid (TCA) on the growth of Bipolaris sorokiniana after 7 days of growth on medium containing meal from tw. (a) The morphology of B. sorokiniana colonies grown on MEA media with different supplements. (b) Size of the colonies 7 days after inoculation. MEA, malt extract medium. Grain was produced in 2013, and the experiment was performed in 2014. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the control and the SA or TCA treatment. The numbers denote significant differences (2 p < 0.01) between the controls of the tw-type mutant and the WT.
Figure 5. Effects of salicylic acid (SA) and trans-cinnamic acid (TCA) on the growth of Bipolaris sorokiniana after 7 days of growth on medium containing meal from tw. (a) The morphology of B. sorokiniana colonies grown on MEA media with different supplements. (b) Size of the colonies 7 days after inoculation. MEA, malt extract medium. Grain was produced in 2013, and the experiment was performed in 2014. The asterisks represent significant differences (* p < 0.05; ** p < 0.01; *** p < 0.001) between the control and the SA or TCA treatment. The numbers denote significant differences (2 p < 0.01) between the controls of the tw-type mutant and the WT.
Agronomy 11 02180 g005
Table
Table 1. Variation in MGG frequencies (%) in barley tweaky spike (tw) allelic mutants in different years of seed material growth.
Table 1. Variation in MGG frequencies (%) in barley tweaky spike (tw) allelic mutants in different years of seed material growth.
YearPosition in SpikeWTtwtw1tw2References
1992Total u.s.25 ± 442 ± 2 340 ± 5 138 ± 5 1[4]
1993Total u.s.19 ± 433 ± 2 2c21 ± 4 c45 ± 5 3c
1996Total u.s.11.0 ± 2.2-34.5 ± 3.4 328.5 ± 3.2 3[19]
2002Total u.s.11.6 ± 2.318.0 ± 2.718.4 ± 2.819.2 ± 2.8 1[21]
1999Total u.s.7.8 ± 1.018.7 ± 1.6 320.2 ± 2.9 217.0 ± 1.5 3[30]
2012Total u.s.34.5 ± 2.9-32.0 ± 2.6 c48.0 ± 2.5 3cUnpublished data
2013Total u.s.11 ± 214 ± 29 ± 210 ± 1Present study
2013Total st.7 ± 25 ± 22 ± 16 ± 2[30]
2013Total u.s.15 ± 216 ± 28 ± 2 1a20 ± 2 bUnpublished data
2013Total st.4 ± 25 ± 21 ± 13 ± 2Present study
2016Total u.s.24 ± 4--35 ± 2 2
2016Total st.6 ± 2--20 ± 3 2
2017Total u.s.6 ± 213 ± 2 1a-19 ± 2 3a
2018Total u.s.8 ± 2-17 ± 2 222 ± 2 3
1,2,3 Comparison with the Wild Type: 1 p < 0.05; 2 p < 0.01; 3 p < 0.001. a,b,c Comparison of allelic tw mutants: a p < 0.05; b p < 0.01; c p < 0.001. u.s., unsterilized grains; st., sterilized grains.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Šiukšta, R.; Vaitkūnienė, V.; Mačkinaitė, R.; Rančelis, V. Application of Barley Tweaky Spike Mutants for the Study of Effects of Plant Immunity-Related Substances. Agronomy 2021, 11, 2180. https://doi.org/10.3390/agronomy11112180

AMA Style

Šiukšta R, Vaitkūnienė V, Mačkinaitė R, Rančelis V. Application of Barley Tweaky Spike Mutants for the Study of Effects of Plant Immunity-Related Substances. Agronomy. 2021; 11(11):2180. https://doi.org/10.3390/agronomy11112180

Chicago/Turabian Style

Šiukšta, Raimondas, Virginija Vaitkūnienė, Rimutė Mačkinaitė, and Vytautas Rančelis. 2021. "Application of Barley Tweaky Spike Mutants for the Study of Effects of Plant Immunity-Related Substances" Agronomy 11, no. 11: 2180. https://doi.org/10.3390/agronomy11112180

APA Style

Šiukšta, R., Vaitkūnienė, V., Mačkinaitė, R., & Rančelis, V. (2021). Application of Barley Tweaky Spike Mutants for the Study of Effects of Plant Immunity-Related Substances. Agronomy, 11(11), 2180. https://doi.org/10.3390/agronomy11112180

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop