Next Article in Journal
Effects of the Double-Cutting Method for Ratooning Rice in the SALIBU System under Different Soil Moisture Conditions on Grain Yield and Regeneration Rate
Next Article in Special Issue
Modeling the Emergence of Echinochloa sp. in Flooded Rice Systems
Previous Article in Journal
Induction of Plant Resistance against Tobacco Mosaic Virus Using the Biocontrol Agent Streptomyces cellulosae Isolate Actino 48
Previous Article in Special Issue
Integrated Management of Weeds in Direct-Seeded Rice in Cambodia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice

by
Lariza Benedetti
1,
Gulab Rangani
2,
Vívian Ebeling Viana
1,
Pâmela Carvalho-Moore
2,
Edinalvo Rabaioli Camargo
1,
Luis Antonio de Avila
1,* and
Nilda Roma-Burgos
2,*
1
Crop Protection Graduate Program (Programa de Pós-Graduação em Fitossanidade), Federal University of Pelotas (Universidade Federal de Pelotas), Pelotas, RS CEP 96160-000, Brazil
2
University of Arkansas, Fayetteville, AR 72704, USA
*
Authors to whom correspondence should be addressed.
Agronomy 2020, 10(11), 1619; https://doi.org/10.3390/agronomy10111619
Submission received: 21 September 2020 / Revised: 13 October 2020 / Accepted: 15 October 2020 / Published: 22 October 2020
(This article belongs to the Special Issue Biology and Integrated Management of Rice Weeds)

Abstract

:
Echinochloa colona (junglerice) is a problematic global weed for many crops, primarily controlled with herbicides. Drought stress alters the overall plant physiology and reduces herbicide efficacy. This research aimed to study the joint effect of drought stress (DS) and recurrent selection with sublethal dose of herbicide on adaptive gene expression and herbicide efficacy on E. colona. Three factors were evaluated: (A) E. colona generation (G0, original population from susceptible standard; G1 and G2, progenies of recurrent selection); (B) herbicide treatment (florpyrauxifen-benzyl, 0.25×; glyphosate, 0.125×; quinclorac, 0.125× the recommended dose; and nontreated check); (C) DS (50% and 100% field capacity). Recurrent exposure to sublethal herbicide dose, combined with drought stress, favors the selection of plants less susceptible to the herbicide. Upregulation of defense (antioxidant) genes (APX: ascorbate peroxidase), herbicide detoxification genes (CYP450 family: cytochrome P450), stress acclimation genes (HSP: heat-shock protein, TPP: trehalose phosphate phosphatase, and TPS: trehalose phosphate synthase), and genes related to herbicide conjugation (UGT: UDP glucosyltransferase) in the G2 population was significant. Recurrent exposure to sublethal herbicide dose under drought stress reduces junglerice sensitivity to herbicide, seemingly due to “imprinted” upregulation of metabolic and protection genes in response to these stresses.

Graphical Abstract

1. Introduction

Attaining global food security entails increasing food production without increasing crop production area. This is a seemingly an insurmountable challenge considering our changing climate and steady population growth [1,2,3]. Beyond having improved crop varieties, weeds remain the primary biological constraint in irrigated and non-irrigated crop production areas [4].
Echinochloa colona (L.) Link, commonly known as junglerice, a self-pollinating species, is among the top five worst weeds in the world, being a persistent threat in 35 cropping systems in more than 60 countries [5,6,7,8]. To prevent yield losses, weed control has been almost exclusively done with herbicides [9,10,11]. However, the extensive use of herbicides, repeated application of the same herbicide or of herbicides with the same mechanism of action (MOA), and repeated exposure to inadvertent sublethal doses have selected for many herbicide-resistant weed populations in the Echinochloa genus and hundreds more across other genera [5,12,13,14,15,16].
The International Survey for Herbicide Resistance database (http://www.weedscience.org) depicts 502 reported cases (species × site of action) of herbicide-resistant weeds globally as of July 2020, including multiple resistance to two and three sites of action. Herbicide-resistant junglerice occurs in rice, corn, soybean, cotton, and perennial crops in many countries including Argentina, Australia, Colombia, the United States of America (USA), Latin America, and South America. In Brazil, there has been resistance to synthetic auxins since 1999 and multiple resistance since 2004 in the Echinochloa genus, but not junglerice [5].
Weed resistance mechanisms fall under two broad categories: (1) target-site resistance (TSR), which results from mutations or overexpression of the target enzyme, and (2) non-target-site resistance (NTSR), which involves mechanisms that minimize the amount of active herbicide reaching the targeted site in the plant or physiological adaptations that protect the plant from the lethal effects of the herbicide [17]. TSR is widely documented in resistant weed populations, as identifying resistance-conferring mutations in the herbicide target is straightforward. Recent studies on NTSR in many species are generally not fully evaluated (or not at all) because processes that confer NTSR are complex. Either type of mechanism can confer resistance to multiple herbicides; both types of mechanisms can occur in the same population or in the same plant, adding another layer of complexity [18]. Recent NTSR studies sought to elucidate the genetic mechanisms that confer and select resistance through detoxification of xenobiotics, with multi-omics approaches, in species such as Amaranthus palmeri, Conyza bonariensis, E. phyllopogon, E. crus-galli, and E. colona [19,20,21,22,23,24,25].
The ability to metabolize (degrade or detoxify) enough of the herbicide for the plant to survive can occur naturally in tolerant species, or can be enhanced under conditions of environmental stress [26,27,28]. In this context, the increased expression of genes encoding metabolic enzymes is selected at low doses of herbicide and is possibly enriched in the population through recurrent selection [29,30]. Examples of recurrent selection have been reported for Amaranthus palmeri, Avena fatua, Lolium rigidum, and Raphanus raphanistrum, resulting in increased frequency of survivors in a population after a number of cycles of exposure to sublethal herbicide doses [31,32,33,34,35,36,37,38]. In this sense, there are assumptions that the “genomic memory” effect and epigenetic regulation facilitate the evolution of NTSR, according to the common (or generalized) coping mechanisms in the plant in response to oxidative stress caused by herbicides and by abiotic stresses [39,40,41,42,43]. Thus, metabolic resistance can confer resistance to herbicides of different chemical groups and sites of action, and even to new herbicides [28].
Drought is a predominant abiotic stress, which significantly affects plant response to herbicides, primarily reducing efficacy [44]. Reduced herbicide efficacy has been documented when weeds are under drought stress [45,46,47]. Drought causes multiple changes in the molecular, biochemical, and physiological state of the plant, with various consequences including reduced absorption and translocation of herbicide, preventing the active ingredient from reaching the target site, thus contributing to survival [45,46,47].
We hypothesized that recurrent treatment of E. colona with sublethal herbicide dose under drought stress reduces weed sensitivity to the herbicide, thereby selecting for plants with greater adaptability to the stress conditions with a transgenerational effect. Consequently, the combined effect of drought and herbicide stress accelerates the evolution of resistance. Therefore, the objectives of this research were to (1) study the combined effect of drought stress and sublethal dose of herbicides on E. colona sensitivity after three cycles of selection, and (2) quantity changes in candidate gene expression across successive generations.

2. Materials and Methods

2.1. Plant Material

This study was conducted using seeds of susceptible E. colona (referred to hereafter as G0), collected in 2011 from a field in Prairie County, Arkansas, USA. G0 was then exposed to three successive cycles of recurrent selection with sublethal doses of herbicides under well-watered or drought stress conditions to produce G1 and G2. This procedure is described in the next section.

2.2. General Procedure for Population Feneration

Seeds (G0) were planted into 50-cell trays containing commercial potting soil (Sun Gro Horticulture Canada Ltd., Vancouver, Canada). At the one-leaf stage, seedlings were transplanted into square pots (7.6 cm wide, 10.2 cm tall) containing a 1:3 mixture by volume of commercial potting soil and field soil (Captina silt loam-fine-silty, siliceous, active, mesic typic Fragiudults). The experiment was performed in a randomized complete design with six replications in each cycle. The experimental unit was one pot containing one plant. The experiment with populations G1 and G2 followed the same methodology described for G0 (Figure 1).
The experiment was conducted in the greenhouse at the University of Arkansas, Fayetteville, USA with 14-h photoperiod under a day/night temperature regime of 30 °C/21 °C. The pots were placed in trays and sub-irrigated until the seedlings reached the 2–3-leaf stage for treatment. The plants were then submitted to two water regimes: well-watered, which corresponds to 100% of the total water holding capacity of the pot (Cw), and drought stress, which corresponds to 50% of Cw in the respective treatment for 7 d, when the plants were sprayed with the respective herbicide treatments (Table 1).
Cw was determined using the fresh mass of the soil after water saturation (Cfm) and the dry mass (Cdm) after soil drying for 24 h at 105 °C and used in the equation Cw = (Cfm − Cdm)/Cfm × 100 as described by Santos et al. [48]. At the beginning of water treatment, all pots were saturated with water, drained, and weighed. The pots were weighed every day to determine the volume of water lost by evapotranspiration, which was then replenished, to maintain Cw at 50% and 100% and assuming 1 mL = 1 g.
The water-stress treatment continued for seven more days (total of 14 days under drought), then all plants were flooded. Preliminary dose-response experiments with and without drought stress were conducted to determine the sublethal dose that would allow plants to survive and produce seeds. The herbicides were applied in a spray chamber, at a pressure of 221 kPa and a volume of 187 L·ha−1. Watering by sub-irrigation was resumed after 24 h. Three weeks after herbicide application, the herbicide effect was evaluated visually. Injury was evaluated visually on a scale of 0% (no symptoms) to 100% (dead).
Prior to flowering, the plants were separated spatially to prevent cross-pollination. At maturity, seeds were harvested and bulked for each treatment. During each selection cycle, a separate group of six plants, without herbicide treatment, was grown to produce generations of plants exposed only to well-watered or drought stress conditions. This procedure was repeated over three cycles.

2.3. Determination of Sensitivity Level to Herbicides

The original population (G0) and selected progenies (G1 and G2) were subjected to their respective water regime assignment (100% and 50% of Cw) for 7 days, as implemented in the previous experiments, and sprayed with a range of herbicide rates when the plants were at the 2–3-leaf stage. The herbicide rates were 0×, 0.0625×, 0.125×, 0.25×, 0.5×, 0.75×, 1.0×, 1.5×, 2.0×, and 4.0× the recommended rate. The herbicide treatments were applied as described previously. After herbicide application, the plants were returned to the greenhouse and the water regimes maintained for seven more days. At 3 weeks after herbicide application, the herbicide effect was evaluated visually. Dose–response data were analyzed using the drc package in R v. 3.1.2 [49,50]. The three-parameter log-logistic model in Equation (1) was used.
Y = d/1 + exp[b(log x − log e)],
where Y is the response (% control), expressed as a percentage of the nontreated check, d is the asymptotic value of Y at the upper limit, b is the slope of the curve around e (ED50: the herbicide rate giving response halfway between d and the lower asymptotic limit, which was set to 0), and x is the herbicide rate.

3. Differential Gene Expression

3.1. Plant Material

The control sample was composed of leaf tissues of G0 plants, well-watered and without herbicide treatment, cultivated for three cycles, at the same period as the other plants, to produce G2. In other words, the control samples were G0 plants that were cultured at 100% of Cw without herbicide treatment. For all treatments, leaf tissues were collected before herbicide application (t0) and 12 h after herbicide application (t1). The tissues were flash-frozen in liquid nitrogen and stored at −80 °C until processed.

3.2. RNA Extraction and Complementary DNA (cDNA) Synthesis

Total RNA was extracted from 2 g of shoot tissue using the reagent PureLinKTM (Plant RNA Reagent-InvitrogenTM, Carlsbad, CA, USA), following the manufacturer’s recommendations. The quantity and quality were assessed by agarose gel electrophoresis (1% w/v). The amount and purity of RNA were determined using a NanoDrop™ 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The RNA (2 µg) was treated with DNase, and cDNA was obtained using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA) using oligo(dT) according to the manufacturer’s instructions.

3.3. qRT-PCR Assay

The qRT-PCR was conducted to determine changes in expression of NTSR candidate genes relative to the reference gene. The qRT-PCR was performed following MIQE guidelines [51], using specific oligonucleotides for target genes and ACT1, UBQ5, and EF1-α housekeeping genes (Table 2). The qRT-PCR experiments were conducted in a total volume of 10 µL containing 5.0 µL of iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), 0.5 µL of forward primer (10 mM), 0.5 µL of reverse primer (10 mM), 1 µL of cDNA (1:5 dilution), and 3.0 µL of water. Two biological replicates and two technical replicates were used for each treatment and primer pair.
The amplification efficiency was determined for each primer pair and melt-curve analyses were performed. The cycle conditions were as follows: one cycle of 95 °C for 5 min, followed by 39 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 1 min, and extension at 72 °C for 30 s, and a final dissociation curve at 95 °C for 5 s, followed by cooling to 70 °C for 1 min and gradual heating at 0.11 °C steps to 95 °C and cooling to 40 °C for 30 s. For each gene analyzed, UBQ5 was used as an endogenous control to quantify cDNA abundance, after the stability analysis of the expression data using DataAssist ™ v3.0 software (Applied biosystems, Life Technologies, Carlsbad, CA, USA).
Cycle threshold (Ct) was obtained during the reaction cycles, and relative gene expression values were calculated using the 2−∆∆Ct method [57]. Gene expression data were analyzed using the Multi Experiment Viewer (TIGR MeV) v3.0 software [58] and presented as a heat map diagram using the harvest stage as a baseline. The messenger RNA (mRNA) abundance of each gene from nontreated G0 population served as the baseline for determining relative RNA levels in each treatment from the G2 population.

4. Results

4.1. Sensitivity to Herbicides

The sensitivity of E. colona to herbicides was generally reduced under drought stress compared to the well-watered condition, after three cycles of selection with sublethal herbicide dose under drought (Table 3). Under well-watered conditions, the ED50 increased minimally in general between G0 and G2 with all herbicides tested. Specifically, the ED50 increased 0.12 points with florpyrauxifen-benzyl (Figure 2A–C), 21.06 points with glyphosate (Figure 2D–F), and 2.99 points with quinclorac (Figure 2G–I).
Under drought stress (50% of Cw), the ED50 increased significantly between G0 and G2 with all herbicides (Table 3). These increases were orders of magnitude higher compared to the ED50 increases under well-watered conditions. The ED50 increased 3.0 points with florpyrauxifen-benzyl (Figure 2A–C), 137.0 points with glyphosate (Figure 2D–F), and 33.9 points with quinclorac (Figure 2G–I). The magnitude of increase in tolerance was 6–25 times higher under drought stress compared to well-watered conditions.
These data indicate that recurrent exposure to sublethal herbicide dose can accelerate sensitivity reduction of E. colona to some herbicides, even without added abiotic stress. In this case, E. colona became less susceptible to glyphosate and quinclorac after three cycles of recurrent selection. Rapid reductions in herbicide sensitivity across generations occurred under drought stress in all herbicides tested.

4.2. Differential Gene Expression

In order to understand the reduction in sensitivity to herbicides between generations submitted to a single stress factor (drought or herbicide) or a combination of these two stress factors, the differential gene expression response was studied for genes related to antioxidant defense system (APX: ascorbate peroxidase), herbicide detoxification (CYP450 family: cytochrome P450), stress acclimation (HSP family: heat-shock protein, TPP: trehalose phosphate phosphatase, and TPS: trehalose phosphate synthase), and a gene related to herbicide molecule conjugation (UGT: UDP glucosyltransferase). E. colona plants (G2) exposed to drought stress over three cycles showed increased expression of TPP (0.1-fold), CYP709B1 and CYP72A14 (0.2-fold), APX (1.2-fold), UGT (1.6-fold), HSP10 (1.7-fold), and TPS (1.9-fold), with the highest relative expression observed for HSP15 (2.4-fold) compared to G0 plants (Figure 3).

4.3. Gene Expression Profile with Respect to Florpyrauxifen-Benzyl Treatment

The gene expression analysis of G1 and G2 populations in water regimes associated with the florpyrauxifen-benzyl herbicide were compared to G0, showing induced transcriptional activation of the analyzed genes in most cases. In well-watered conditions, all genes studied, except for APX and CYP72A15, were upregulated 12 h after florpyrauxifen-benzyl application (Figure 3). In drought stress conditions, all analyzed genes were upregulated after florpyrauxifen-benzyl treatment.
For the APX gene, transcript accumulation was similar before herbicide application (t0) in well-watered (0.2-fold) and in drought stress conditions (0.3-fold). However, when subjected to drought stress, APX expression was induced 12 h after florpyrauxifen-benzyl treatment to 1.8-fold under drought stress t1, but repressed −0.2-fold in well-watered t1 (Figure 3).
CYP709B1 had a similar gene expression profile to APX. The application of florpyrauxifen-benzyl to well-watered plants induced CYP709B1 expression from 0.5-fold before herbicide treatment to 1.2-fold 12 h after treatment. Under drought stress, the expression of CYP709B1 was −0.2-fold before herbicide application and 2.4-fold after herbicide application (Figure 3). The expression of CYP709B2 increased from −3.9-fold at t0 to 1.2-fold at t1 in well-watered plants treated with herbicide and from 2.0- to 2.1-fold after herbicide treatment of drought-stressed plants. The expression of CYP72A14 gene, which belongs to Clan 72 of the cytochrome P450 family, was also induced after the application of florpyrauxifen-benzyl, mainly in drought-stressed plants, increasing from 0.6-fold at t0 to 4.2-fold at t1 in drought stress alone, and drought stress plus herbicide treatment. However, as previously mentioned, the CYP72A15 gene was repressed after herbicide treatment of well-watered plants (1.3-fold in t0 to 1.0-fold in t1). Likewise, as observed with the other cytochrome P450 members studied, the CYP72A15 gene was induced upon florpyrauxifen-benzyl treatment in drought stress conditions (−0.1-fold at t0 to 2.2-fold at t1).
The expression of HSP10, HSP15, TPP, and UGT genes increased 12 h after florpyrauxifen-benzyl treatment, mainly in drought stress conditions (Figure 3). The expression of TPS increased minimally after herbicide treatment; even so, it was induced from 0.6-fold at t0 to 0.9-fold at t1 in well-watered plants and downregulated in drought-stressed plants (−1.6-fold to −1.5-fold).

4.4. Gene Expression Profile with Respect to Glyphosate Treatment

The transcript accumulation of the studied genes increased 12 h after glyphosate treatment in drought-stressed plants (Figure 3). In well-watered plants, all genes were induced by glyphosate, except for APX, CYP72A15, and TPS, which were repressed. While the APX expression was downregulated in well-watered plants treated with glyphosate (3.3- to 1.2-fold), gene expression increased from 1.3-fold at t0 to 3.0-fold at t1 in drought-stressed plants (Figure 3). After glyphosate treatment, the expression of CYP709B1, CYP709B2, CYP72A14, HSP10, and HSP15 increased, mainly in drought-stressed plants, reaching values of 5.2-, 6.9-, 5.2-, 7.0-, and 10.0-fold, respectively, being 1.1 to 3.3 points higher than glyphosate-treated plants in well-watered conditions.
CYP72A15 and TPS genes were downregulated after glyphosate treatment in well-watered plants, showing transcript accumulation from 2.1- to 1.2- and from 2.1- to −2.8-fold, respectively (Figure 3). However, in drought-stressed plants, the expression of these genes ranged from 1.6- to 4.1- and from 2.2- to 3.3-fold, respectively, when treated with glyphosate.
TPP and UGT genes were upregulated after glyphosate treatment, and the transcript accumulation in drought-stressed plants was very close to that in well-watered plants sprayed with glyphosate (Figure 3). TPP and UGT reached the same expression levels in well-watered and drought-stressed plants, 12 h after the glyphosate application (3.3- and 5.2-fold, respectively).

4.5. Gene Expression Profile with Respect to Quinclorac Treatment

The expression of genes studied changed in drought-stressed plants 12 h after quinclorac treatment (Figure 3). APX, CYP709B2, CYP72A14, and CYP72A15 were repressed after quinclorac treatment of well-watered plants. On the other hand, APX, CYP72A14, and CYP72A15 were induced in drought-stressed plants treated with quinclorac, reaching values of 1.2-, 4.4-, and 0.8-fold, respectively. CYP709B2 remained repressed by quinclorac even in drought-stressed plants, showing a −1.9-fold change.
The expression profile of CYP709B1 and UGT genes was similar, whereby these genes were induced after quinclorac treatment; however, the induction was higher in well-watered plants (Figure 3). CYP709B1 increased from 0.7-fold at t0 to 1.6-fold after quinclorac application in well-watered plants and from −2.4- to -0.7-fold in drought-stressed plants. Likewise, UGT transcripts increased from 1.4-fold at t0 to 2.7-fold after quinclorac application in well-watered plants and from −0.4 to 1.6-fold in drought-stressed plants.
Genes coding for heat-shock proteins (HSP10 and HSP15) were induced after quinclorac application (Figure 3). The increased expression was detected in both water regimes, but with higher values in drought-stressed plants, reaching 5.0- and 7.3- fold, respectively, for HSP10 and HSP15. Quinclorac application also induced the TPP gene, which showed expression averages of 2.3- and 1.3-fold in well-watered and drought-stressed plants, respectively.
TPS was induced in well-watered and herbicide-treated plants and was repressed in plants subjected to quinclorac plus drought stress treatment (Figure 3). This indicates a possible deviation from the normal metabolic pathway of trehalose biosynthesis to provide substrates for UGT, displaying a role in conjugation reactions.

5. Discussions

5.1. Drought Stress Effect on E. colona Tolerance to Herbicides

Recurrent selection with low doses of herbicides was studied to understand the mechanisms of resistance evolution and to propose sustainable management strategies. The increased tolerance of G2 plants to florpyrauxifen-benzyl, glyphosate, and quinclorac compared to G0 plants supports our hypothesis. In this study, recurrent selection with sublethal herbicide dose under drought stress selected E. colona plants with greater adaptability to the submitted conditions, with a transgenerational effect, resulting in reduced sensitivity to chemical control. The change was significant after three cycles of selection, thus highlighting the importance of adhering to best management practices pertaining to herbicide application. In reality, several mitigating factors prevent producers from applying herbicides under optimum conditions all the time. The timing of herbicide application is not always ideal. Therefore, the next line of defense is preventing seed production of plants that survive herbicide application in the field to break the selection cycle. It is important to sustain the efficacy of herbicides currently available because the prospect of discovering new herbicidal chemistries with a different mechanism of action or not yet compromised by evolved weed resistance is low [31,35,37,59,60].
Although the increase in tolerance between G0 and G2 was significant in all cases, except with florpyrauxifen-benzyl under well-watered conditions, the tolerance level of G2 E. colona to florpyrauxifen-benzyl, glyphosate, and quinclorac was still below the recommended rates of each herbicide (Figure 2 and Table 3). For practical purposes, G2 E. colona would still be classified as susceptible. Nevertheless, the progression in population dynamics clearly pointed toward resistance evolution, regardless of abiotic stress, and accelerated resistance evolution under drought stress. E. colona is a self-pollinating species, and evolution may be slower due to the low crossing rate [15,16,38,61]. In the same way, the self-pollinated A. fatua responses to low-dose herbicide selection was marginal, and it was much lower than in cross-pollinated L. rigidum, where L. rigidum evolved 40-fold resistance to diclofop-methyl via progressive enrichment of quantitative resistance-endowing traits [34]. A high level of evolved resistance was observed in allogamous species as L. rigidum with low doses of the herbicide diclofop-methyl for two generations and R. raphanistrum following four generations of low doses of 2,4-D selection [31,33,35].
Abiotic stresses such as CO2 limitation, drought, and heat also impart selection pressure on plants in addition to herbicides and, therefore, can accelerate the evolution of herbicide-resistant plants. Previous related research and our current study support this premise [7,55,62]. Drought stress is a good example of an environmental stress that easily compromises herbicide performance. Lack of soil moisture reduces the absorption, translocation, and metabolism of florpyrauxifen-benzyl in E. crus-galli, Sesbania herbacea, and Cyperus esculentus [45]. The obvious consequence is reduced herbicide efficacy on these species, just as drought stress reduced the efficacy of florpyrauxifen-benzyl on E. colona in this current study. Furthermore, we showed that tolerance to florpyrauxifen-benzyl increased with time, under drought stress (as it did with the other herbicides tested). The ability to adapt was carried to the successive generations and strengthened as the progeny was subjected to the same stress conditions.
E. colona has already evolved resistance to glyphosate, quinclorac, and other herbicides. Resistance to glyphosate was reported starting in 2007 in Australia and then in succeeding years in California, Venezuela, and Argentina due to intensive selection pressure [5,63]. Resistance to quinclorac is widespread among weedy Echinochloa species (E. crus-galli, E. crus-pavonis, E. zelayensis, and E. colona) as quinclorac is one of the primary herbicides used to control these grasses in rice production. Although florpyrauxifen-benzyl and quinclorac have the same mode of action, they each belong to a different chemical family. These two auxinic herbicides have activity on annual grasses but differ in the level of activity across species. A better understanding of E. colona response to synthetic auxins under different water regimes in rice production would enable producers to better use this weed management tool. The same principle applies to the use of glyphosate for general weed control in upland crops.

5.2. Memory of Gene Expression and Sensitivity Reduction in E. colona to Herbicide

For the plant to function normally and cope with the ebb and flow of various environmental stresses, several biochemical and physiological processes have to work in seamless coordination. Under stress conditions, as in herbicide treatment, the obligatory processes are modified quickly to mitigate the stress or cope with the stress. These modifications can be inferred from altered gene expression profiles, for example, between quinclorac-susceptible and -resistant E. colona [55]. The complexity of auxin perception signaling and diversity of plant response networks present a myriad of possibilities of how the plant can respond to auxinic herbicides metabolically or to other pathways [11,64,65].
Gene reprogramming and epigenetic regulation occur during plant development, being constantly provoked by environmental stimuli, eventually being manifested in a mechanism of plant adaptation and evolution [66]. Here, we studied the expression of genes involved in herbicide signaling, detoxification, and conjugation. Enzymes involved in antioxidative defense system, such as APX (ascorbate peroxidase), play an important role in the elimination of reactive oxygen species (ROS) by having a higher affinity for H2O2 than catalase and peroxidases, protecting plant cells during oxidative stress [67]. Not surprisingly, the APX gene was upregulated in drought-stressed and herbicide-treated plants. Increased APX enzyme activity has been related to glyphosate damage protection in glyphosate-resistant A. palmeri [68]. In rice, the expression of antioxidant genes (SOD, CAT, and APX) increased after bentazon, penoxsulam, and cyhalofop-butyl application [69]. We also now know that the APX enzyme family is involved in a variety of plant processes, in addition to mitigating oxidative stress. Eight members of the APX family in Arabidopsis participate in growth and development processes, as well as responses to drought, heat, and salt stress [70]. Each enzyme certainly has a specific function, but multi-functionality of one enzyme is possible; one APX enzyme may protect the plant from multiple abiotic stresses. This indicates the potential role of antioxidant systems in the evolution of weed resistance to herbicides, in the process of adapting to recurring abiotic stresses.
The cytochrome P450 monooxygenase superfamily is frequently associated with metabolic resistance to herbicides; it is responsible for the phase I metabolism of xenobiotics, including herbicides [21,28,71,72,73,74,75,76]. The upregulation of CytP450 genes identified here suggests their involvement in the evolution of resistance to florpyrauxifen-benzyl, glyphosate, or quinclorac and adaptation to drought stress. The large number of cytochrome P450 genes testify to the complexity and biodiversity of the function of this enzyme family [24,77,78]. The differential induction of CytP450 genes tested here by the synthetic auxins (florpyrauxifen-benzyl and quinclorac) indicates that, although they are from the same MOA group, they are significantly structurally different, such that they are possibly metabolized by different CytP450 genes [72]. Structural similarity primarily dictates cross-reactivity of CytP450 with different herbicides. A comprehensive study by Iwakami et al. [21] demonstrated that CYP81A P450s are involved in concomitant cross-resistance to ALS and ACCase herbicides on E. phyllopogon, and Dimaano et al. [78] conducted a functional characterization of cytochrome P450 CYP81A subfamily to disclose the pattern of cross-resistance to the same species.
Heat-shock proteins (HSPs) are molecular chaperones that ensure the correct folding of other proteins, throughout the life cycle of plants, to maintain growth and acclimatization. In addition, HSPs are known as stress-responsive proteins, as their concentration increases rapidly in plant cells in response to environmental stresses [79,80]. Currently, many research groups are investigating the mechanisms of action or function of HSPs in plants under various abiotic stress-causing conditions such as drought, salt, cold, heat, and even herbicides [81,82,83,84,85,86]. As expected, we determined that HSP transcript levels are higher under combined drought and herbicide stresses. Published information about HSPs pertain only to drought and other environmental stresses, not herbicides. The combined effect of drought and herbicide stress was not previously investigated. With respect to drought, Xiang and coworkers [87] also obtained upregulation of HSP50.2 in drought-stressed rice. The same authors reported that the overexpression of this gene in rice confers drought tolerance, probably through the modulation of ROS homeostasis and osmotic adjustment of the accumulated content of proline, which contributes to the improved protection ability from drought stress damage.
Some sugar compounds also play an important role in abiotic stress tolerance. Trehalose is a nonreducing disaccharide and a unique chemical compound, which is a key organic osmolyte involved in plant abiotic stress tolerance [88,89]. The pathway for trehalose biosynthesis contains two enzymatic steps: (1) trehalose-6-phosphate synthase (TPS) catalyzes the transfer of glucose from UDP-glucose to glucose 6-phosphate, forming trehalose 6-phosphate (T6P) and UDP; (2) trehalose-6-phosphate phosphatase (TPP) dephosphorylates T6P to trehalose and inorganic phosphate [90]. Recent findings associate the expression of carbohydrate metabolism-related genes with stress tolerance, such as the observed increase in drought tolerance in maize due to trehalose accumulation [91]. The overexpression of TPP increases drought tolerance in rice and Arabidopsis [92], the overexpression of TPS induces cold tolerance in Arabidopsis [93], and the overexpression of TPP and TPS increases tolerance to heat stress in transgenic tomato [94]. Our research showed the induction of TPP by florpyrauxifen-benzyl, glyphosate, and quinclorac under well-watered conditions. In addition, positive regulation of TPP and TPS was observed when glyphosate was applied to drought-stressed plants, suggesting the role of these genes in the adaptation of E. colona to simultaneous drought and glyphosate stress. On the other hand, TPS gene expression was downregulated after application of florpyrauxifen-benzyl or quinclorac to drought-stressed plants. We propose that, in water deficit, the action of TPS is inhibited by the auxinic herbicides, because there is interaction between auxin and the signaling sugar T6P synthetized by TPS [95]. In high auxin concentrations, TPS is inhibited, thereby affecting the sucrose status and normal plant growth [96,97,98,99].
Scientific advances in NTSR research have helped in the identification and understanding of resistance mechanisms in herbicide metabolism and in the network of detoxification processes [22,23,65,75,100,101,102,103,104]. Plants contain large numbers of UDP-glucose-dependent glycosyltransferases (UGTs), responsible for conjugating metabolites with acceptor molecules in phase II of xenobiotic metabolism [105,106]. Increases in UGT expression after florpyrauxifen-benzyl, glyphosate, and quinclorac treatments indicate the involvement of this gene in the adaptation response to these herbicides. In rice, the glucosyltransferase gene was reported to be involved in the glucose conjugation of phenolics and possible quinclorac detoxification [107,108]. A glucosyltransferase was identified and enabled as a potential transcriptional marker for quick diagnosis of metabolic resistance to mesosulfuron in Alopecurus aequalis [18].
Rouse and collaborators [55] presented a model of the biological pathway for quinclorac conjugation via UGT. The quinclorac molecule contains an exposed OH side group with which UGT can interact, suggesting the phase I step would not be necessary. Ljung et al. [109] and Jin et al. [110] described that the major route for deactivating endogenous auxin is through conjugation with sugars via glucosyltransferases, corroborating our findings. Furthermore, the upregulation of glycosyltranferase genes in glyphosate-resistant Conyza bonariensis after glyphosate treatment might indicate the increase in activity of these enzymes to cope with glyphosate [22]. Here, we detected a similar profile of UGT expression following glyphosate treatment.
Overall, our data support the involvement of several classes of candidate genes in E. colona adaptation to florpyrauxifen-benzyl, glyphosate, and quinclorac under drought stress (Figure 4). The NTSR mechanism is complex and its occurrence is increasing, which means that weed control may become even more difficult in times of climate change, by accelerating resistance evolution. While this research provides information on the increase in E. colona tolerance to sublethal doses of florpyrauxifen-benzyl, glyphosate, and quinclorac under drought stress, we cannot extrapolate this response, with certainty, to other herbicide mechanisms of action. Further research is required to clarify our understanding of the underlying mechanisms which allow E. colona to adapt to various herbicide MOAs under different climate change conditions.

6. Conclusions

Drought stress and recurrent sublethal dose application reduce the susceptibility of E. colona to florpyrauxifen-benzyl, glyphosate, and quinclorac herbicides, thus facilitating the adaptation of E. colona to climate change. The upregulation of all genes studied in selected progeny plants (G2) of E. colona with drought stress may be involved in the reduction of sensitivity to glyphosate. Drought stress combined with a low dose of florpyrauxifen-benzyl induced the expression of all genes studied, except TPS. A low dose of quinclorac plus drought stress increased the expression of most candidate genes, except for CYP709B1, CYP709B2, and TPS. This differential gene regulation possibly facilitates the reduction in susceptibility of E. colona to these stresses. Overall, recurrent selection with sublethal herbicide dose under drought stress reduced E. colona sensitivity to herbicide, seemingly due to “imprinted” upregulation of metabolic and protection genes in response to these stresses.

Author Contributions

Conceptualization, L.B., N.R.-B., L.A.d.A., and G.R.; data curation, L.B., G.R., and V.E.V.; formal analysis, L.B. and V.E.V.; funding acquisition, L.A.d.A. and N.R.-B.; investigation, L.B., G.R., P.C.-M., and N.R.-B.; methodology, L.B., G.R., N.R.-B., V.E.V., P.C.-M., E.R.C., and L.A.d.A.; project administration, N.R.-B. and L.A.d.A.; resources, N.R.-B., and L.A.d.A.; Supervision, E.R.C., L.A.d.A., and N.R.-B.; validation, L.B. and G.R.; visualization, L.B. and V.E.V.; writing—original draft, L.B.; writing—review and editing, N.R.-B., L.B., G.R., V.E.V., P.C.-M., E.R.C., and L.A.d.A. All authors read and agreed to the published version of the manuscript.

Funding

This research received funding from: Coordenação de Aperfeiçoamento de Pessoal de Nível Superior-Brasil (CAPES)-Finance Code 001; BASF Corporation grant to N.R.-B.; The University of Arkansas (Hatch Project ARK02416), Fayetteville, NC, USA; the research fellowship of L.A.d.A. by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq—Proc.N. 310538/2015–7) and the student sandwich doctoral fellowship of L.B. was financed by the CNPq—Proc.N. 208443/2017–7 CNPq. This research made possible by the direct financing from the “Ciência Sem Fronteiras” public call MEC/MCTI/CAPES/CNPQ/FAPS-Visiting Researcher fellowship-PVE 2014 (Public Call number 401381/2014–5).

Acknowledgments

The authors thanks the agencies that support this research and all the support personal from Universidade Federal de Pelotas and the University of Arkansas.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Loboguerrero, A.M.; Campbell, B.; Cooper, P.; Hansen, J.; Rosenstock, T.; Wollenberg, E. Food and Earth Systems: Priorities for Climate Change Adaptation and Mitigation for Agriculture and Food Systems. Sustainability 2019, 11, 1372. [Google Scholar] [CrossRef] [Green Version]
  2. Stephens, E.C.; Jones, A.D.; Parsons, D. Agricultural systems research and global food security in the 21st century: An overview and roadmap for future opportunities. Agric. Syst. 2018, 163, 1–6. [Google Scholar] [CrossRef]
  3. Wiebe, K.; Robinson, S.; Cattaneo, A. Climate change, agriculture and food security. In Sustainable Food and Agriculture; Elsevier: Amsterdam, The Netherlands, 2019; pp. 55–74. ISBN 9780128121344. [Google Scholar]
  4. Mahajan, G.; Ramesha, M.S.; Chauhan, B.S. Genotypic Differences for Water-Use Efficiency and Weed Competitiveness in Dry Direct-Seeded Rice. Agron. J. 2015, 107, 1573–1583. [Google Scholar] [CrossRef]
  5. Heap, I. The International Survey of Herbicide Resistant Weeds Database. Available online: www.weedscience.org (accessed on 1 July 2020).
  6. Mahajan, G.; Mutti, N.K.; Walsh, M.; Chauhan, B.S. Effect of varied soil moisture regimes on the growth and reproduction of two Australian biotypes of junglerice (Echinochloa colona). Weed Sci. 2019, 67, 552–559. [Google Scholar] [CrossRef]
  7. Refatti, J.P.; de Avila, L.A.; Camargo, E.R.; Ziska, L.H.; Oliveira, C.; Salas-Perez, R.; Rouse, C.E.; Roma-Burgos, N. High [CO2] and Temperature Increase Resistance to Cyhalofop-Butyl in Multiple-Resistant Echinochloa colona. Front. Plant. Sci. 2019, 10, 529. [Google Scholar] [CrossRef] [Green Version]
  8. Peerzada, A.M.; Bajwa, A.A.; Ali, H.H.; Chauhan, B.S. Biology, impact, and management of Echinochloa colona (L.) Link. Crop. Prot. 2016, 83, 56–66. [Google Scholar] [CrossRef]
  9. Owen, M.D.K. Diverse Approaches to Herbicide-Resistant Weed Management. Weed Sci. 2016, 64, 570–584. [Google Scholar] [CrossRef] [Green Version]
  10. Rangani, G.; Salas-Perez, R.A.; Aponte, R.A.; Knapp, M.; Craig, I.R.; Mietzner, T.; Langaro, A.C.; Noguera, M.M.; Porri, A.; Roma-Burgos, N. A Novel Single-Site Mutation in the Catalytic Domain of Protoporphyrinogen Oxidase IX (PPO) Confers Resistance to PPO-Inhibiting Herbicides. Front. Plant. Sci. 2019, 10, 568. [Google Scholar] [CrossRef]
  11. Burgos, N.R.; Heap, I.M.; Rouse, C.E.; Lawton-Rauh, A.L. Evolution of herbicide-resistant weeds. In WEED CONTROL Sustainability, Hazards and Risks in Cropping Systems Worldwide; CRC Press Taylor & Francis Group: Boca Raton, FL, USA, 2019; pp. 92–132. ISBN 9781498719087. [Google Scholar]
  12. Bagavathiannan, M.V.; Davis, A.S. An ecological perspective on managing weeds during the great selection for herbicide resistance. Pest. Manag. Sci. 2018, 74, 2277–2286. [Google Scholar] [CrossRef]
  13. Hawkins, N.J.; Bass, C.; Dixon, A.; Neve, P. The evolutionary origins of pesticide resistance. Biol. Rev. 2019, 94, 135–155. [Google Scholar] [CrossRef]
  14. Kohlhase, D.R.; Edwards, J.W.; Owen, M.D.K. Inheritance of 4-hydroxyphenylpyruvate dioxygenase inhibitor herbicide resistance in an Amaranthus tuberculatus population from Iowa, USA. Plant. Sci. 2018, 274, 360–368. [Google Scholar] [CrossRef]
  15. Neve, P.; Powles, S. High survival frequencies at low herbicide use rates in populations of Lolium rigidum result in rapid evolution of herbicide resistance. Heredity 2005, 95, 485–492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Neve, P.; Powles, S. Recurrent selection with reduced herbicide rates results in the rapid evolution of herbicide resistance in Lolium rigidum. Theor. Appl. Genet. 2005, 110, 1154–1166. [Google Scholar] [CrossRef] [PubMed]
  17. Délye, C.; Jasieniuk, M.; Le Corre, V. Deciphering the evolution of herbicide resistance in weeds. Trends Genet. 2013, 29, 649–658. [Google Scholar] [CrossRef] [PubMed]
  18. Zhao, N.; Yan, Y.; Luo, Y.; Zou, N.; Liu, W.; Wang, J. Unravelling mesosulfuron-methyl phytotoxicity and metabolism-based herbicide resistance in Alopecurus aequalis: Insight into regulatory mechanisms using proteomics. Sci. Total Environ. 2019, 670, 486–497. [Google Scholar] [CrossRef]
  19. Dalazen, G.; Markus, C.; Merotto, A., Jr. Differential Expression of Genes Associated with Degradation Enhancement of Imazethapyr in Barnyardgrass (Echinochloa crus-galli). J. Agric. Sci. 2018, 10, 389–401. [Google Scholar] [CrossRef]
  20. Goh, S.S.; Yu, Q.; Han, H.; Vila-Aiub, M.M.; Busi, R.; Powles, S.B. Non-target-site glyphosate resistance in Echinochloa colona from Western Australia. Crop. Prot. 2018, 112, 257–263. [Google Scholar] [CrossRef]
  21. Iwakami, S.; Kamidate, Y.; Yamaguchi, T.; Ishizaka, M.; Endo, M.; Suda, H.; Nagai, K.; Sunohara, Y.; Toki, S.; Uchino, A.; et al. CYP81A P450s are involved in concomitant cross-resistance to acetolactate synthase and acetyl-CoA carboxylase herbicides in Echinochloa phyllopogon. New Phytol. 2019, 221, 2112–2122. [Google Scholar] [CrossRef]
  22. Piasecki, C.; Yang, Y.; Benemann, D.P.; Kremer, F.S.; Galli, V.; Millwood, R.J.; Cechin, J.; Agostinetto, D.; Maia, L.C.; Vargas, L.; et al. Transcriptomic Analysis Identifies New Non-Target Site Glyphosate-Resistance Genes in Conyza bonariensis. Plants 2019, 8, 157. [Google Scholar] [CrossRef] [Green Version]
  23. Salas-Perez, R.A.; Saski, C.A.; Noorai, R.E.; Srivastava, S.K.; Lawton-Rauh, A.L.; Nichols, R.L.; Roma-Burgos, N. RNA-Seq transcriptome analysis of Amaranthus palmeri with differential tolerance to glufosinate herbicide. PLoS ONE 2018, 13, e0195488. [Google Scholar] [CrossRef]
  24. Wright, A.A.; Rodriguez-Carres, M.; Sasidharan, R.; Koski, L.; Peterson, D.G.; Nandula, V.K.; Ray, J.D.; Bond, J.A.; Shaw, D.R. Multiple Herbicide–Resistant Junglerice (Echinochloa colona): Identification of Genes Potentially Involved in Resistance through Differential Gene Expression Analysis. Weed Sci. 2018, 66, 347–354. [Google Scholar] [CrossRef]
  25. Varanasi, V.K.; Brabham, C.; Norsworthy, J.K. Confirmation and Characterization of Non-target site Resistance to Fomesafen in Palmer amaranth (Amaranthus palmeri). Weed Sci. 2018, 66, 702–709. [Google Scholar] [CrossRef]
  26. Kudsk, P.; Moss, S. Herbicide dose? In ACS Symposium Series; ACS Symposium Series; American Chemical Society: Washington, WA, USA, 2017; Volume 1249, pp. 15–24. ISBN 9780841232099. [Google Scholar]
  27. Nandula, V.K.; Riechers, D.E.; Ferhatoglu, Y.; Barrett, M.; Duke, S.O.; Dayan, F.E.; Goldberg-Cavalleri, A.; Tétard-Jones, C.; Wortley, D.J.; Onkokesung, N.; et al. Herbicide Metabolism: Crop Selectivity, Bioactivation, Weed Resistance, and Regulation. Weed Sci. 2019, 67, 149–175. [Google Scholar] [CrossRef] [Green Version]
  28. Yu, Q.; Powles, S. Metabolism-Based Herbicide Resistance and Cross-Resistance in Crop Weeds: A Threat to Herbicide Sustainability and Global Crop Production. Plant Physiol. 2014, 166, 1106–1118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Gaines, T.A.; Lorentz, L.; Figge, A.; Herrmann, J.; Maiwald, F.; Ott, M.; Han, H.; Busi, R.; Yu, Q.; Powles, S.B.; et al. RNA-Seq transcriptome analysis to identify genes involved in metabolism-based diclofop resistance in Lolium rigidum. Plant. J. 2014, 78, 865–876. [Google Scholar] [CrossRef]
  30. Vieira, B.C.; Luck, J.D.; Amundsen, K.L.; Gaines, T.A.; Werle, R.; Kruger, G.R. Response of Amaranthus spp. following exposure to sublethal herbicide rates via spray particle drift. PLoS ONE 2019, 14, e0220014. [Google Scholar] [CrossRef] [Green Version]
  31. Ashworth, M.B.; Walsh, M.J.; Flower, K.C.; Powles, S.B. Recurrent selection with reduced 2,4-D amine doses results in the rapid evolution of 2,4-D herbicide resistance in wild radish (Raphanus raphanistrum L.). Pest. Manag. Sci. 2016, 72, 2091–2098. [Google Scholar] [CrossRef]
  32. Busi, R.; Gaines, T.A.; Walsh, M.J.; Powles, S.B. Understanding the potential for resistance evolution to the new herbicide pyroxasulfone: Field selection at high doses versus recurrent selection at low doses. Weed Res. 2012, 52, 489–499. [Google Scholar] [CrossRef]
  33. Busi, R.; Neve, P.; Powles, S. Evolved polygenic herbicide resistance in Lolium rigidum by low-dose herbicide selection within standing genetic variation. Evol. Appl. 2013, 6, 231–242. [Google Scholar] [CrossRef]
  34. Busi, R.; Girotto, M.; Powles, S.B. Response to low-dose herbicide selection in self-pollinated Avena fatua. Pest. Manag. Sci. 2016, 72, 603–608. [Google Scholar] [CrossRef]
  35. Busi, R.; Powles, S.B. Evolution of glyphosate resistance in a Lolium rigidum population by glyphosate selection at sublethal doses. Heredity 2009, 103, 318–325. [Google Scholar] [CrossRef] [PubMed]
  36. Busi, R.; Powles, S.B. Cross-resistance to prosulfocarb + S-metolachlor and pyroxasulfone selected by either herbicide in Lolium rigidum. Pest. Manag. Sci. 2016, 72, 1664–1672. [Google Scholar] [CrossRef] [PubMed]
  37. Tehranchian, P.; Norsworthy, J.K.; Powles, S.; Bararpour, M.T.; Bagavathiannan, M.V.; Barber, T.; Scott, R.C. Recurrent Sublethal-Dose Selection for Reduced Susceptibility of Palmer Amaranth (Amaranthus palmeri) to Dicamba. Weed Sci. 2017, 65, 206–212. [Google Scholar] [CrossRef]
  38. Yu, Q.; Han, H.; Cawthray, G.R.; Wang, S.F.; Powles, S.B. Enhanced rates of herbicide metabolism in low herbicide-dose selected resistant Lolium rigidum. Plant. Cell Environ. 2013, 36, 818–827. [Google Scholar] [CrossRef]
  39. Délye, C.; Gardin, J.A.C.; Boucansaud, K.; Chauvel, B.; Petit, C. Non-target-site-based resistance should be the centre of attention for herbicide resistance research: Alopecurus myosuroides as an illustration. Weed Res. 2011, 51, 433–437. [Google Scholar] [CrossRef]
  40. Gressel, J. Evolving understanding of the evolution of herbicide resistance. Pest. Manag. Sci. 2009, 65, 1164–1173. [Google Scholar] [CrossRef]
  41. Kollist, H.; Zandalinas, S.I.; Sengupta, S.; Nuhkat, M.; Kangasjärvi, J.; Mittler, R. Rapid Responses to Abiotic Stress: Priming the Landscape for the Signal Transduction Network. Trends Plant. Sci. 2019, 24, 25–37. [Google Scholar] [CrossRef] [Green Version]
  42. Markus, C.; Pecinka, A.; Karan, R.; Barney, J.N.; Merotto, A. Epigenetic regulation—Contribution to herbicide resistance in weeds? Pest. Manag. Sci. 2018, 74, 275–281. [Google Scholar] [CrossRef]
  43. Radwan, D.E.M. Salicylic acid induced alleviation of oxidative stress caused by clethodim in maize (Zea mays L.) leaves. Pestic. Biochem. Physiol. 2012, 102, 182–188. [Google Scholar] [CrossRef]
  44. Weller, S.L.; Florentine, S.K.; Mutti, N.K.; Jha, P.; Chauhan, B.S. Response of Chloris truncata to moisture stress, elevated carbon dioxide and herbicide application. Sci. Rep. 2019, 9, 10721. [Google Scholar] [CrossRef] [Green Version]
  45. Miller, M.R.; Norsworthy, J.K. Influence of Soil Moisture on Absorption, Translocation, and Metabolism of Florpyrauxifen-benzyl. Weed Sci. 2018, 66, 418–423. [Google Scholar] [CrossRef]
  46. Skelton, J.J.; Ma, R.; Riechers, D.E. Waterhemp (Amaranthus tuberculatus) control under drought stress with 2,4-dichlorophenoxyacetic acid and glyphosate. Weed Biol. Manag. 2016, 16, 34–41. [Google Scholar] [CrossRef]
  47. Wu, L.-M.; Fang, Y.; Yang, H.-N.; Bai, L.-Y. Effects of drought-stress on seed germination and growth physiology of quinclorac-resistant Echinochloa crusgalli. PLoS ONE 2019, 14, e0214480. [Google Scholar] [CrossRef] [PubMed]
  48. Dos Santos, A.B.; Bottcher, A.; Kiyota, E.; Mayer, J.L.S.; Vicentini, R.; Dos Santos Brito, M.; Creste, S.; Landell, M.G.A.; Mazzafera, P. Water Stress Alters Lignin Content and Related Gene Expression in Two Sugarcane Genotypes. J. Agric. Food Chem. 2015, 63, 4708–4720. [Google Scholar] [CrossRef] [PubMed]
  49. Ritz, C.; Streibig, J. Analysis of dose-response curve data. Package ‘drc’. Available online: http://cran.r-project.org/web/packages/drc/drc.pdf (accessed on 24 June 2020).
  50. Seefeldt, S.S.; Jensen, J.E.; Fuerst, E.P. Log-Logistic Analysis of Herbicide Dose-Response Relationships. Weed Technol. 1995, 9, 218–227. [Google Scholar] [CrossRef]
  51. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
  52. Caldana, C.; Scheible, W.R.; Mueller-Roeber, B.; Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant. Methods 2007, 3, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Jain, M.; Nijhawan, A.; Tyagi, A.K.; Khurana, J.P. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2006, 345, 646–651. [Google Scholar] [CrossRef]
  54. Zhang, Z.; Zhang, Q.; Wu, J.; Zheng, X.; Zheng, S.; Sun, X.; Qiu, Q.; Lu, T. Gene Knockout Study Reveals That Cytosolic Ascorbate Peroxidase 2(OsAPX2) Plays a Critical Role in Growth and Reproduction in Rice under Drought, Salt and Cold Stresses. PLoS ONE 2013, 8, e57472. [Google Scholar] [CrossRef]
  55. Rouse, C.E. Characterization of Multiple-Herbicide-Resistant Echinochloa colona from Arkansas. Ph.D. Dissertation, University of Arkansas, Fayetteville, AR, USA, December 2017. [Google Scholar]
  56. Ye, S.; Yu, S.; Shu, L.; Wu, J.; Wu, A.; Luo, L. Expression profile analysis of 9 heat shock protein genes throughout the life cycle and under abiotic stress in rice. Chin. Sci. Bull. 2012, 57, 336–343. [Google Scholar] [CrossRef] [Green Version]
  57. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  58. Saeed, A.I.; Sharov, V.; White, J.; Li, J.; Liang, W.; Bhagabati, N.; Braisted, J.; Klapa, M.; Currier, T.; Thiagarajan, M.; et al. TM4: A free, open-source system for microarray data management and analysis. Biotechniques 2003, 34, 374–378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Duke, S.O. Why have no new herbicide modes of action appeared in recent years? Pest. Manag. Sci. 2012, 68, 505–512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  60. Dayan, F.E. Is There a Natural Route to the Next Generation of Herbicides? Outlooks Pest. Manag. 2018, 29, 54–57. [Google Scholar] [CrossRef]
  61. Holsinger, K.E. Reproductive systems and evolution in vascular plants. Proc. Natl. Acad. Sci. USA 2000, 97, 7037–7042. [Google Scholar] [CrossRef] [Green Version]
  62. Oladosu, Y.; Rafii, M.Y.; Samuel, C.; Fatai, A.; Magaji, U.; Kareem, I.; Kamarudin, Z.S.; Muhammad, I.; Kolapo, K. Drought Resistance in Rice from Conventional to Molecular Breeding: A Review. Int. J. Mol. Sci. 2019, 20, 3519. [Google Scholar] [CrossRef] [Green Version]
  63. Gaines, T.A.; Cripps, A.; Powles, S.B. Evolved Resistance to Glyphosate in Junglerice (Echinochloa colona) from the Tropical Ord River Region in Australia. Weed Technol. 2012, 26, 480–484. [Google Scholar] [CrossRef]
  64. Matzrafi, M.; Seiwert, B.; Reemtsma, T.; Rubin, B.; Peleg, Z. Climate change increases the risk of herbicide-resistant weeds due to enhanced detoxification. Planta 2016, 244, 1217–1227. [Google Scholar] [CrossRef]
  65. Tétard-Jones, C.; Sabbadin, F.; Moss, S.; Hull, R.; Neve, P.; Edwards, R. Changes in the proteome of the problem weed blackgrass correlating with multiple-herbicide resistance. Plant. J. 2018, 94, 709–720. [Google Scholar] [CrossRef] [Green Version]
  66. Pereira, A. Plant abiotic stress challenges from the changing environment. Front. Plant. Sci. 2016, 7, 2013–2015. [Google Scholar] [CrossRef] [Green Version]
  67. Caverzan, A.; Passaia, G.; Rosa, S.B.; Ribeiro, C.W.; Lazzarotto, F.; Margis-Pinheiro, M. Plant responses to stresses: Role of ascorbate peroxidase in the antioxidant protection. Peroxidases Biochem. Charact. Funct. Potential Appl. 2013, 4, 142–158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Maroli, A.S.; Nandula, V.K.; Dayan, F.E.; Duke, S.O.; Gerard, P.; Tharayil, N. Metabolic Profiling and Enzyme Analyses Indicate a Potential Role of Antioxidant Systems in Complementing Glyphosate Resistance in an Amaranthus palmeri Biotype. J. Agric. Food Chem. 2015, 63, 9199–9209. [Google Scholar] [CrossRef] [PubMed]
  69. Agostinetto, D.; Benemann, D.P.; Cechin, J.; Nohatto, M.A.; Langaro, A.C.; Piasecki, C.; Vargas, L. Gene Expression Related to Oxidative Stress Induced by Herbicides in Rice. Agron. J. 2019, 111, 1239–1246. [Google Scholar] [CrossRef]
  70. Li, Z.; Li, J.; Bing, J.; Zhang, G. The role analysis of APX gene family in the growth and developmental processes and in response to abiotic stresses in Arabidopsis thaliana. Yi Chuan = Hered. 2019, 41, 534–547. [Google Scholar] [CrossRef]
  71. Guo, F.; Iwakami, S.; Yamaguchi, T.; Uchino, A.; Sunohara, Y.; Matsumoto, H. Role of CYP81A cytochrome P450s in clomazone metabolism in Echinochloa phyllopogon. Plant. Sci. 2019, 283, 321–328. [Google Scholar] [CrossRef]
  72. Busi, R.; Goggin, D.E.; Heap, I.M.; Horak, M.J.; Jugulam, M.; Masters, R.A.; Napier, R.M.; Riar, D.S.; Satchivi, N.M.; Torra, J.; et al. Weed resistance to synthetic auxin herbicides. Pest Manag. Sci. 2018, 74, 2265–2276. [Google Scholar] [CrossRef]
  73. Ghanizadeh, H.; Harrington, K.C. Non-target Site Mechanisms of Resistance to Herbicides. CRC. Crit. Rev. Plant. Sci. 2017, 36, 24–34. [Google Scholar] [CrossRef]
  74. Fang, J.; Zhang, Y.; Liu, T.; Yan, B.; Li, J.; Dong, L. Target-Site and Metabolic Resistance Mechanisms to Penoxsulam in Barnyardgrass (Echinochloa crus-galli (L.) P. Beauv). J. Agric. Food Chem. 2019, 67, 8085–8095. [Google Scholar] [CrossRef]
  75. Yan, B.; Zhang, Y.; Li, J.; Fang, J.; Liu, T.; Dong, L. Transcriptome profiling to identify cytochrome P450 genes involved in penoxsulam resistance in Echinochloa glabrescens. Pestic. Biochem. Physiol. 2019, 158, 112–120. [Google Scholar] [CrossRef]
  76. Torra, J.; Rojano-Delgado, A.M.; Rey-Caballero, J.; Royo-Esnal, A.; Salas, M.L.; De Prado, R. Enhanced 2,4-D metabolism in two resistant papaver rhoeas populations from Spain. Front. Plant. Sci. 2017, 8, 1584. [Google Scholar] [CrossRef] [Green Version]
  77. Guo, L.; Qiu, J.; Ye, C.; Jin, G.; Mao, L.; Zhang, H.; Yang, X.; Peng, Q.; Wang, Y.; Jia, L.; et al. Echinochloa crus-galli genome analysis provides insight into its adaptation and invasiveness as a weed. Nat. Commun. 2017, 8, 1031. [Google Scholar] [CrossRef] [PubMed]
  78. Dimaano, N.G.; Yamaguchi, T.; Fukunishi, K.; Tominaga, T.; Iwakami, S. Functional characterization of cytochrome P450 CYP81A subfamily to disclose the pattern of cross-resistance in Echinochloa phyllopogon. Plant. Mol. Biol. 2020, 102, 403–416. [Google Scholar] [CrossRef]
  79. Divya, K.; Bhatnagar-Mathur, P.; Sharma, K.K.; Reddy, P.S. Heat Shock Proteins (HSPS) Mediated Signalling Pathways During Abiotic Stress Conditions; Elsevier Inc.: Amsterdam, The Netherlands, 2019; ISBN 9780128164518. [Google Scholar]
  80. Singh, R.K.; Gupta, V.; Prasad, M. Plant molecular chaperones: Structural organization and their roles in abiotic stress tolerance. In Molecular Plant Abiotic Stress; Roychoudhury, A., Tripathi, D., Eds.; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2019; pp. 221–239. [Google Scholar]
  81. Dyer, W.E. Stress-induced evolution of herbicide resistance and related pleiotropic effects. Pest. Manag. Sci. 2018, 74, 1759–1768. [Google Scholar] [CrossRef]
  82. Balfagón, D.; Zandalinas, S.I.; Baliño, P.; Muriach, M.; Gómez-Cadenas, A. Involvement of ascorbate peroxidase and heat shock proteins on citrus tolerance to combined conditions of drought and high temperatures. Plant. Physiol. Biochem. 2018, 127, 194–199. [Google Scholar] [CrossRef]
  83. Esmaeili, N.; Yang, X.; Cai, Y.; Sun, L.; Zhu, X.; Shen, G.; Payton, P.; Fang, W.; Zhang, H. Co-overexpression of AVP1 and OsSIZ1 in Arabidopsis substantially enhances plant tolerance to drought, salt, and heat stresses. Sci. Rep. 2019, 9, 7642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  84. Hossain, M.A.; Li, Z.-G.; Hoque, T.S.; Burritt, D.J.; Fujita, M.; Munné-Bosch, S. Heat or cold priming-induced cross-tolerance to abiotic stresses in plants: Key regulators and possible mechanisms. Protoplasma 2018, 255, 399–412. [Google Scholar] [CrossRef]
  85. Keith, B.K.; Burns, E.E.; Bothner, B.; Carey, C.C.; Mazurie, A.J.; Hilmer, J.K.; Biyiklioglu, S.; Budak, H.; Dyer, W.E. Intensive herbicide use has selected for constitutively elevated levels of stress-responsive mRNAs and proteins in multiple herbicide-resistant Avena fatua L. Pest. Manag. Sci. 2017, 73, 2267–2281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  86. Jacob, P.; Hirt, H.; Bendahmane, A. The heat-shock protein/chaperone network and multiple stress resistance. Plant. Biotechnol. J. 2017, 15, 405–414. [Google Scholar] [CrossRef] [PubMed]
  87. Xiang, J.; Chen, X.; Hu, W.; Xiang, Y.; Yan, M.; Wang, J. Overexpressing heat-shock protein OsHSP50.2 improves drought tolerance in rice. Plant. Cell Rep. 2018, 37, 1585–1595. [Google Scholar] [CrossRef]
  88. Islam, M.O.; Kato, H.; Shima, S.; Tezuka, D.; Matsui, H.; Imai, R. Functional identification of a rice trehalase gene involved in salt stress tolerance. Gene 2019, 685, 42–49. [Google Scholar] [CrossRef]
  89. Kosar, F.; Akram, N.A.; Sadiq, M.; Al-Qurainy, F.; Ashraf, M. Trehalose: A Key Organic Osmolyte Effectively Involved in Plant Abiotic Stress Tolerance. J. Plant. Growth Regul. 2019, 38, 606–618. [Google Scholar] [CrossRef]
  90. Zang, B.; Li, H.; Li, W.; Deng, X.W.; Wang, X. Analysis of trehalose-6-phosphate synthase (TPS) gene family suggests the formation of TPS complexes in rice. Plant. Mol. Biol. 2011, 76, 507–522. [Google Scholar] [CrossRef] [PubMed]
  91. Agreda-Laguna, K.-A.; Cabrera-Ponce, J.-L.; Ruiz Medrano, R.; Antonio Garzon-Tiznado, J.; Xoconostle-Cazares, B. Trehalose Accumulation Provides Drought Tolerance to Genetically-Modified Maize in Open Field Trials. Pak. J. Agric. Sci. 2018, 55, 1009–1020. [Google Scholar] [CrossRef]
  92. Lin, Q.; Yang, J.; Wang, Q.; Zhu, H.; Chen, Z.; Dao, Y.; Wang, K. Overexpression of the trehalose-6-phosphate phosphatase family gene AtTPPF improves the drought tolerance of Arabidopsis thaliana. BMC Plant. Biol. 2019, 19, 381. [Google Scholar] [CrossRef] [Green Version]
  93. Liu, X.; Fu, L.; Qin, P.; Sun, Y.; Liu, J.; Wang, X. Overexpression of the wheat trehalose 6-phosphate synthase 11 gene enhances cold tolerance in Arabidopsis thaliana. Gene 2019, 710, 210–217. [Google Scholar] [CrossRef] [PubMed]
  94. Lyu, J.I.; Park, J.H.; Kim, J.-K.; Bae, C.-H.; Jeong, W.-J.; Min, S.R.; Liu, J.R. Enhanced tolerance to heat stress in transgenic tomato seeds and seedlings overexpressing a trehalose-6-phosphate synthase/phosphatase fusion gene. Plant. Biotechnol. Rep. 2018, 12, 399–408. [Google Scholar] [CrossRef]
  95. Meitzel, T.; Radchuk, R.; McAdam, E.L.; Thormählen, I.; Munz, E.; Hilo, A.; Geigenberger, P.; Ross, J.J.; Lunn, J.E.; Borisjuk, L. Trehalose 6-phosphate Controls Seed Filling by Inducing Auxin Biosynthesis. bioRxiv 2019, 752915. [Google Scholar] [CrossRef]
  96. Barbier, F.; Péron, T.; Lecerf, M.; Perez-Garcia, M.D.; Barrière, Q.; Rolčík, J.; Boutet-Mercey, S.; Citerne, S.; Lemoine, R.; Porcheron, B.; et al. Sucrose is an early modulator of the key hormonal mechanisms controlling bud outgrowth in Rosa hybrida. J. Exp. Bot. 2015, 66, 2569–2582. [Google Scholar] [CrossRef] [Green Version]
  97. Lilley, J.L.S.; Gee, C.W.; Sairanen, I.; Ljung, K.; Nemhauser, J.L. An endogenous carbon-sensing pathway Triggers increased auxin flux and hypocotyl elongation. Plant. Physiol. 2012, 160, 2261–2270. [Google Scholar] [CrossRef] [Green Version]
  98. Ljung, K.; Nemhauser, J.L.; Perata, P. New mechanistic links between sugar and hormone signalling networks. Curr. Opin. Plant. Biol. 2015, 25, 130–137. [Google Scholar] [CrossRef]
  99. Sairanen, I.; Novák, O.; Pěnčík, A.; Ikeda, Y.; Jones, B.; Sandberg, G.; Ljung, K. Soluble carbohydrates regulate auxin biosynthesis via PIF proteins in Arabidopsis. Plant. Cell 2013, 24, 4907–4916. [Google Scholar] [CrossRef] [Green Version]
  100. Baucom, R.S. Evolutionary and ecological insights from herbicide-resistant weeds: What have we learned about plant adaptation, and what is left to uncover? New Phytol. 2019, 223, 68–82. [Google Scholar] [CrossRef] [Green Version]
  101. Burns, E.E.; Keith, B.K.; Talbert, L.E.; Dyer, W.E. Non-target site resistance to flucarbazone, imazamethabenz and pinoxaden is controlled by three linked genes in Avena fatua. Weed Res. 2018, 58, 8–16. [Google Scholar] [CrossRef] [Green Version]
  102. Délye, C.; Duhoux, A.; Gardin, J.A.C.; Gouzy, J.; Carrère, S. High conservation of the transcriptional response to acetolactate-synthase-inhibiting herbicides across plant species. Weed Res. 2018, 58, 2–7. [Google Scholar] [CrossRef]
  103. Maroli, A.S.; Gaines, T.A.; Foley, M.E.; Duke, S.O.; Doğramacı, M.; Anderson, J.V.; Horvath, D.P.; Chao, W.S.; Tharayil, N. Omics in Weed Science: A Perspective from Genomics, Transcriptomics, and Metabolomics Approaches. Weed Sci. 2018, 66, 681–695. [Google Scholar] [CrossRef] [Green Version]
  104. Wilson, C.E.; Takano, H.K.; Van Horn, C.R.; Yerka, M.K.; Westra, P.; Stoltenberg, D.E. Physiological and molecular analysis of glyphosate resistance in non-rapid response Ambrosia trifida from Wisconsin. Pest. Manag. Sci. 2020, 76, 150–160. [Google Scholar] [CrossRef] [PubMed]
  105. Brazier-Hicks, M.; Gershater, M.; Dixon, D.; Edwards, R. Substrate specificity and safener inducibility of the plant UDP-glucose-dependent family 1 glycosyltransferase super-family. Plant. Biotechnol. J. 2018, 16, 337–348. [Google Scholar] [CrossRef]
  106. Pan, L.; Gao, H.; Xia, W.; Zhang, T.; Dong, L. Establishing a herbicide-metabolizing enzyme library in Beckmannia syzigachne to identify genes associated with metabolic resistance. J. Exp. Bot. 2016, 67, 1745–1757. [Google Scholar] [CrossRef]
  107. Liu, Q.; Chen, T.T.; Xiao, D.W.; Zhao, S.M.; Lin, J.S.; Wang, T.; Li, Y.J.; Hou, B.K. OsIAGT1 Is a Glucosyltransferase Gene Involved in the Glucose Conjugation of Auxins in Rice. Rice 2019, 12, 92. [Google Scholar] [CrossRef] [Green Version]
  108. Xu, W.; Di, C.; Zhou, S.; Liu, J.; Li, L.; Liu, F.; Yang, X.; Ling, Y.; Su, Z. Rice transcriptome analysis to identify possible herbicide quinclorac detoxification genes. Front. Genet. 2015, 6, 306. [Google Scholar] [CrossRef] [Green Version]
  109. Ljung, K. Auxin metabolism and homeostasis during plant development. Dev. 2013, 140, 943–950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  110. Jin, S.H.; Ma, X.M.; Han, P.; Wang, B.; Sun, Y.G.; Zhang, G.Z.; Li, Y.J.; Hou, B.K. UGT74D1 Is a Novel Auxin Glycosyltransferase from Arabidopsis thaliana. PLoS ONE 2013, 8, e61705. [Google Scholar] [CrossRef]
Figure 1. Schematic diagram of the progression of experiments on Echinochloa colona submitted to selection by low herbicide rates and water regimes starting with the parental population (G0) and selected (G1 and G2) progenies. The letters WW and DS indicate well-watered and drought stress treatments, respectively. Herbicide treatments were: nontreated (no herbicide), florpyrauxifen-benzyl at 0.25×, glyphosate at 0.125×, and quinclorac at 0.125× the recommended dose. Time t0 (prior to herbicide application) and t1 (12 h after herbicide application) were the timings of leaf tissue collection for RNA extraction and subsequent gene expression.
Figure 1. Schematic diagram of the progression of experiments on Echinochloa colona submitted to selection by low herbicide rates and water regimes starting with the parental population (G0) and selected (G1 and G2) progenies. The letters WW and DS indicate well-watered and drought stress treatments, respectively. Herbicide treatments were: nontreated (no herbicide), florpyrauxifen-benzyl at 0.25×, glyphosate at 0.125×, and quinclorac at 0.125× the recommended dose. Time t0 (prior to herbicide application) and t1 (12 h after herbicide application) were the timings of leaf tissue collection for RNA extraction and subsequent gene expression.
Agronomy 10 01619 g001
Figure 2. Nonlinear regression analysis of herbicide efficacy on Echinochloa colona across cycles of recurrent exposure to drought stress and sublethal herbicide dose. The herbicide treatments were (AC) florpyrauxifen-benzyl, (DF) glyphosate, and (GI) quinclorac. G0 = original population; G1 and G2 are progenies after progressive cycles of selection. Weed control was evaluated 3 weeks after herbicide application. Each data point is an average of two replicates. The data were fitted with a three-parameter log-logistic model in Equation (1). Vertical dotted gray lines indicate the recommended dose of each herbicide.
Figure 2. Nonlinear regression analysis of herbicide efficacy on Echinochloa colona across cycles of recurrent exposure to drought stress and sublethal herbicide dose. The herbicide treatments were (AC) florpyrauxifen-benzyl, (DF) glyphosate, and (GI) quinclorac. G0 = original population; G1 and G2 are progenies after progressive cycles of selection. Weed control was evaluated 3 weeks after herbicide application. Each data point is an average of two replicates. The data were fitted with a three-parameter log-logistic model in Equation (1). Vertical dotted gray lines indicate the recommended dose of each herbicide.
Agronomy 10 01619 g002
Figure 3. Relative messenger RNA (mRNA) abundance in Echinochloa colona leaves. The mRNA abundance is represented as log2 fold-change, using the Multi Experiment Viewer (TIGR MeV) software [58], and values in parentheses represent 95% confidence intervals. The mRNA abundance of each gene from G0 population (original susceptible standard) served as the baseline for determining relative RNA levels. The letters WW and DS indicate the water regimes of well-watered and drought stress, respectively; nontreated = G2 without herbicide; t0 = before and t1 = 12 h after herbicide application to G2 plants. The color scale above the heatmap shows the expression level, where red indicates high transcript abundance while green indicates low abundance.
Figure 3. Relative messenger RNA (mRNA) abundance in Echinochloa colona leaves. The mRNA abundance is represented as log2 fold-change, using the Multi Experiment Viewer (TIGR MeV) software [58], and values in parentheses represent 95% confidence intervals. The mRNA abundance of each gene from G0 population (original susceptible standard) served as the baseline for determining relative RNA levels. The letters WW and DS indicate the water regimes of well-watered and drought stress, respectively; nontreated = G2 without herbicide; t0 = before and t1 = 12 h after herbicide application to G2 plants. The color scale above the heatmap shows the expression level, where red indicates high transcript abundance while green indicates low abundance.
Agronomy 10 01619 g003
Figure 4. Summary of the response of Echinochloa colona to recurrent selection by sublethal doses of herbicides and drought stress.
Figure 4. Summary of the response of Echinochloa colona to recurrent selection by sublethal doses of herbicides and drought stress.
Agronomy 10 01619 g004
Table 1. Herbicide treatments used in the recurrent selection experiment with Echinochloa colona under concurrent drought stress.
Table 1. Herbicide treatments used in the recurrent selection experiment with Echinochloa colona under concurrent drought stress.
Active
Ingredient
Trade
Name
WSSA
Group a
MOA Chemical
Family
Recommended Rate
(g ae·ha–1)
Application Rate b
(g ae·ha–1)
Florpyrauxifen-benzylLoyant®4Synthetic auxins Arylpicolinate307.5
GlyphosateRoundup PowerMax® 9Inhibition of EPSP synthase Glycine1056132
QuincloracFacet L®4Synthetic auxinsQuinoline carboxylic acid43254
a Weed Science Society of America Mechanism of Action (MOA) classification system; b Application rates were a fraction of the recommended dose: florpyrauxifen-benzyl at 0.25×; glyphosate and quinclorac at 0.125×. Doses were based on preliminary experiments to allow survival and seed production (data not shown).
Table 2. Oligonucleotides used for gene expression assay by qRT-PCR of Echinochloa colona that underwent three cycles of recurrent selection with sublethal doses of herbicides under drought stress. F, forward; R, reverse.
Table 2. Oligonucleotides used for gene expression assay by qRT-PCR of Echinochloa colona that underwent three cycles of recurrent selection with sublethal doses of herbicides under drought stress. F, forward; R, reverse.
GeneFamily/NameOligonucleotide Sequences (5′→3′)Reference
Act1
(Reference gene)
Actin 1F: ATCCTTGTATGCTAGCGGTCGA[52]
R: ATCCAACCGGAGGATAGCATG
EF1-α
(Reference gene)
Elongation
factor 1 α
F: GTCATTGGCCACGTCGACTC[52]
R: TGTTCATCTCAGCGGCTTCC
UBQ5
(Reference gene)
Ubiquitin 5F: ACCACTTCGACCGCCACTACT[53]
R: ACGCCTAAGCCTGCTGGTT
APX2Ascorbate peroxidaseF: CATCCTCTCCTACGCCGAC[54]
R: CCTTCAGGAGGAGGCTCAG
CYP709B1Cytochrome
P450 709B1
F: GTCGTCAAGCAGGTGCTCTT[55]
R: CAGTGAGGACGAGACCCTTG
CYP709B2Cytochrome
P450 709B2
F: GCCTGAGAGGTTCGAGTACG[55]
R: CGATCATCGCAAAGTTCTGA
CYP72A14Cytochrome
P450 72A14
F: TCGGTGGCATCAAATATCCT[55]
R: GAACTTGCCTGCGTCTTTTC
CYP72A15Cytochrome
P450 72A15
F: CCAGTGAGCTGATACGCAGA[55]
R: GACGTCGCCTGTGAGATTTT
UGT75DGlycosyltransferaseF: GCTCACTTTCCCGTTCCAG [56]
R: GTGGTGGAGAATGTGACGAG
HSP10Heat-shock protein 71.10F: CCGTGTGCTTCGACATTGAC[56]
R: CGTTGGTGATGGTGHTCTTGTT
HSP15Heat-shock protein 24.15F: GATCAAGGCGGAGATGAAGAAC[55]
R: ACTCGACGTTGACCTGGAAGA
TPPTrehalose phosphate phosphataseF: TTGAAGGTGCGAGTGTTGAG[55]
R: AACCACTCCCCAGTCCTTCT
TPSTrehalose phosphate synthaseF: ACAGAGGGGCTACATTGCAC[52]
R: CTGCAACTGCTCCAAGTGAA
Table 3. Parameter estimates (b, d, median effective dose (ED50), and tolerance index (TI)) for the control of Echinochloa colona with various herbicides across cycles of exposure to drought stress and sublethal herbicide dose, 3 weeks after herbicide treatment. The data were fitted with a three-parameter log-logistic regression model in Equation (1).
Table 3. Parameter estimates (b, d, median effective dose (ED50), and tolerance index (TI)) for the control of Echinochloa colona with various herbicides across cycles of exposure to drought stress and sublethal herbicide dose, 3 weeks after herbicide treatment. The data were fitted with a three-parameter log-logistic regression model in Equation (1).
Log-Logistic Regression Estimates a
Treatments bbdED50 p-Value cTI d
Florpyrauxifen-Benzyl (g ae ha−1)
G0∙WW−1.99 (0.09)100.79 (0.67)3.34 (0.07)<0.05-
G0∙DS−1.36 (0.06)103.93 (0.96)3.91 (0.12)<0.051.17
G1∙WW−2.25 (0.12)100.50 (0.78)3.46 (0.09)<0.051.04
G1∙DS−1.39 (0.06)104.95 (1.31)5.57 (0.18)<0.051.67
G2∙WW−2.23 (0.13)100.28 (0.83)3.46 (0.08)<0.051.04
G2∙DS−1.56 (0.07)104.90 (1.32)6.94 (0.25)<0.052.07
Glyphosate (g ae ha−1)
G0∙WW−1.75 (0.16)101.91 (1.82)196.82 (11.40)<0.05-
G0∙DS−1.78 (0.16)105.11 (2.19)364.74 (20.21)<0.051.85
G1∙WW−1.71 (0.14)102.41 (1.73)207.77 (11.32)<0.051.06
G1∙DS−1.86 (0.15)104.68 (2.09)406.97 (20.55)<0.052.07
G2∙WW−1.60 (0.13)102.15 (1.85)217.88 (12.37)<0.051.11
G2∙DS−2.15 (0.17)104.46 (1.97)501.75 (21.97)<0.052.55
Quinclorac (g ae ha−1)
G0∙WW−1.61 (0.14)105.05 (2.29)97.95 (6.05)<0.05-
G0∙DS−1.84 (0.16)104.57 (2.17)113.73 (6.29)<0.051.16
G1∙WW−1.67 (0.14)104.62 (2.19)98.66 (5.86)<0.051.01
G1∙DS−1.95 (0.17)104.61 (2.15)126.81 (6.64)<0.051.29
G2∙WW−1.60 (0.11)104.88 (1.89)100.94 (5.10)<0.051.03
G2∙DS−2.25 (0.17)103.35 (1.72)147.64 (5.76)<0.051.51
a Values in parentheses are standard errors of the mean. b The letters WW and DS indicate well-watered and drought stress treatments, respectively; G0 indicates the first cycle of treatments, G1 and G2 are the subsequent generations. c p-values compare the difference well-watered conditions and drought stress at the same cycle using the SI function in the drc package v2.5.12 in R. v3.3.0. d Tolerance index was calculated as the ratio of the ED50 of the progeny divided by the ED50 of the parental population (G0).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Benedetti, L.; Rangani, G.; Ebeling Viana, V.; Carvalho-Moore, P.; Rabaioli Camargo, E.; Avila, L.A.d.; Roma-Burgos, N. Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice. Agronomy 2020, 10, 1619. https://doi.org/10.3390/agronomy10111619

AMA Style

Benedetti L, Rangani G, Ebeling Viana V, Carvalho-Moore P, Rabaioli Camargo E, Avila LAd, Roma-Burgos N. Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice. Agronomy. 2020; 10(11):1619. https://doi.org/10.3390/agronomy10111619

Chicago/Turabian Style

Benedetti, Lariza, Gulab Rangani, Vívian Ebeling Viana, Pâmela Carvalho-Moore, Edinalvo Rabaioli Camargo, Luis Antonio de Avila, and Nilda Roma-Burgos. 2020. "Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice" Agronomy 10, no. 11: 1619. https://doi.org/10.3390/agronomy10111619

APA Style

Benedetti, L., Rangani, G., Ebeling Viana, V., Carvalho-Moore, P., Rabaioli Camargo, E., Avila, L. A. d., & Roma-Burgos, N. (2020). Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice. Agronomy, 10(11), 1619. https://doi.org/10.3390/agronomy10111619

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop