Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. General Procedure for Population Feneration
2.3. Determination of Sensitivity Level to Herbicides
3. Differential Gene Expression
3.1. Plant Material
3.2. RNA Extraction and Complementary DNA (cDNA) Synthesis
3.3. qRT-PCR Assay
4. Results
4.1. Sensitivity to Herbicides
4.2. Differential Gene Expression
4.3. Gene Expression Profile with Respect to Florpyrauxifen-Benzyl Treatment
4.4. Gene Expression Profile with Respect to Glyphosate Treatment
4.5. Gene Expression Profile with Respect to Quinclorac Treatment
5. Discussions
5.1. Drought Stress Effect on E. colona Tolerance to Herbicides
5.2. Memory of Gene Expression and Sensitivity Reduction in E. colona to Herbicide
6. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Loboguerrero, A.M.; Campbell, B.; Cooper, P.; Hansen, J.; Rosenstock, T.; Wollenberg, E. Food and Earth Systems: Priorities for Climate Change Adaptation and Mitigation for Agriculture and Food Systems. Sustainability 2019, 11, 1372. [Google Scholar] [CrossRef]
- Stephens, E.C.; Jones, A.D.; Parsons, D. Agricultural systems research and global food security in the 21st century: An overview and roadmap for future opportunities. Agric. Syst. 2018, 163, 1–6. [Google Scholar] [CrossRef]
- Wiebe, K.; Robinson, S.; Cattaneo, A. Climate change, agriculture and food security. In Sustainable Food and Agriculture; Elsevier: Amsterdam, The Netherlands, 2019; pp. 55–74. ISBN 9780128121344. [Google Scholar]
- Mahajan, G.; Ramesha, M.S.; Chauhan, B.S. Genotypic Differences for Water-Use Efficiency and Weed Competitiveness in Dry Direct-Seeded Rice. Agron. J. 2015, 107, 1573–1583. [Google Scholar] [CrossRef]
- Heap, I. The International Survey of Herbicide Resistant Weeds Database. Available online: www.weedscience.org (accessed on 1 July 2020).
- Mahajan, G.; Mutti, N.K.; Walsh, M.; Chauhan, B.S. Effect of varied soil moisture regimes on the growth and reproduction of two Australian biotypes of junglerice (Echinochloa colona). Weed Sci. 2019, 67, 552–559. [Google Scholar] [CrossRef]
- Refatti, J.P.; de Avila, L.A.; Camargo, E.R.; Ziska, L.H.; Oliveira, C.; Salas-Perez, R.; Rouse, C.E.; Roma-Burgos, N. High [CO2] and Temperature Increase Resistance to Cyhalofop-Butyl in Multiple-Resistant Echinochloa colona. Front. Plant. Sci. 2019, 10, 529. [Google Scholar] [CrossRef]
- Peerzada, A.M.; Bajwa, A.A.; Ali, H.H.; Chauhan, B.S. Biology, impact, and management of Echinochloa colona (L.) Link. Crop. Prot. 2016, 83, 56–66. [Google Scholar] [CrossRef]
- Owen, M.D.K. Diverse Approaches to Herbicide-Resistant Weed Management. Weed Sci. 2016, 64, 570–584. [Google Scholar] [CrossRef]
- Rangani, G.; Salas-Perez, R.A.; Aponte, R.A.; Knapp, M.; Craig, I.R.; Mietzner, T.; Langaro, A.C.; Noguera, M.M.; Porri, A.; Roma-Burgos, N. A Novel Single-Site Mutation in the Catalytic Domain of Protoporphyrinogen Oxidase IX (PPO) Confers Resistance to PPO-Inhibiting Herbicides. Front. Plant. Sci. 2019, 10, 568. [Google Scholar] [CrossRef]
- Burgos, N.R.; Heap, I.M.; Rouse, C.E.; Lawton-Rauh, A.L. Evolution of herbicide-resistant weeds. In WEED CONTROL Sustainability, Hazards and Risks in Cropping Systems Worldwide; CRC Press Taylor & Francis Group: Boca Raton, FL, USA, 2019; pp. 92–132. ISBN 9781498719087. [Google Scholar]
- Bagavathiannan, M.V.; Davis, A.S. An ecological perspective on managing weeds during the great selection for herbicide resistance. Pest. Manag. Sci. 2018, 74, 2277–2286. [Google Scholar] [CrossRef]
- Hawkins, N.J.; Bass, C.; Dixon, A.; Neve, P. The evolutionary origins of pesticide resistance. Biol. Rev. 2019, 94, 135–155. [Google Scholar] [CrossRef]
- Kohlhase, D.R.; Edwards, J.W.; Owen, M.D.K. Inheritance of 4-hydroxyphenylpyruvate dioxygenase inhibitor herbicide resistance in an Amaranthus tuberculatus population from Iowa, USA. Plant. Sci. 2018, 274, 360–368. [Google Scholar] [CrossRef]
- Neve, P.; Powles, S. High survival frequencies at low herbicide use rates in populations of Lolium rigidum result in rapid evolution of herbicide resistance. Heredity 2005, 95, 485–492. [Google Scholar] [CrossRef] [PubMed]
- Neve, P.; Powles, S. Recurrent selection with reduced herbicide rates results in the rapid evolution of herbicide resistance in Lolium rigidum. Theor. Appl. Genet. 2005, 110, 1154–1166. [Google Scholar] [CrossRef] [PubMed]
- Délye, C.; Jasieniuk, M.; Le Corre, V. Deciphering the evolution of herbicide resistance in weeds. Trends Genet. 2013, 29, 649–658. [Google Scholar] [CrossRef] [PubMed]
- Zhao, N.; Yan, Y.; Luo, Y.; Zou, N.; Liu, W.; Wang, J. Unravelling mesosulfuron-methyl phytotoxicity and metabolism-based herbicide resistance in Alopecurus aequalis: Insight into regulatory mechanisms using proteomics. Sci. Total Environ. 2019, 670, 486–497. [Google Scholar] [CrossRef]
- Dalazen, G.; Markus, C.; Merotto, A., Jr. Differential Expression of Genes Associated with Degradation Enhancement of Imazethapyr in Barnyardgrass (Echinochloa crus-galli). J. Agric. Sci. 2018, 10, 389–401. [Google Scholar] [CrossRef]
- Goh, S.S.; Yu, Q.; Han, H.; Vila-Aiub, M.M.; Busi, R.; Powles, S.B. Non-target-site glyphosate resistance in Echinochloa colona from Western Australia. Crop. Prot. 2018, 112, 257–263. [Google Scholar] [CrossRef]
- Iwakami, S.; Kamidate, Y.; Yamaguchi, T.; Ishizaka, M.; Endo, M.; Suda, H.; Nagai, K.; Sunohara, Y.; Toki, S.; Uchino, A.; et al. CYP81A P450s are involved in concomitant cross-resistance to acetolactate synthase and acetyl-CoA carboxylase herbicides in Echinochloa phyllopogon. New Phytol. 2019, 221, 2112–2122. [Google Scholar] [CrossRef]
- Piasecki, C.; Yang, Y.; Benemann, D.P.; Kremer, F.S.; Galli, V.; Millwood, R.J.; Cechin, J.; Agostinetto, D.; Maia, L.C.; Vargas, L.; et al. Transcriptomic Analysis Identifies New Non-Target Site Glyphosate-Resistance Genes in Conyza bonariensis. Plants 2019, 8, 157. [Google Scholar] [CrossRef]
- Salas-Perez, R.A.; Saski, C.A.; Noorai, R.E.; Srivastava, S.K.; Lawton-Rauh, A.L.; Nichols, R.L.; Roma-Burgos, N. RNA-Seq transcriptome analysis of Amaranthus palmeri with differential tolerance to glufosinate herbicide. PLoS ONE 2018, 13, e0195488. [Google Scholar] [CrossRef]
- Wright, A.A.; Rodriguez-Carres, M.; Sasidharan, R.; Koski, L.; Peterson, D.G.; Nandula, V.K.; Ray, J.D.; Bond, J.A.; Shaw, D.R. Multiple Herbicide–Resistant Junglerice (Echinochloa colona): Identification of Genes Potentially Involved in Resistance through Differential Gene Expression Analysis. Weed Sci. 2018, 66, 347–354. [Google Scholar] [CrossRef]
- Varanasi, V.K.; Brabham, C.; Norsworthy, J.K. Confirmation and Characterization of Non-target site Resistance to Fomesafen in Palmer amaranth (Amaranthus palmeri). Weed Sci. 2018, 66, 702–709. [Google Scholar] [CrossRef]
- Kudsk, P.; Moss, S. Herbicide dose? In ACS Symposium Series; ACS Symposium Series; American Chemical Society: Washington, WA, USA, 2017; Volume 1249, pp. 15–24. ISBN 9780841232099. [Google Scholar]
- Nandula, V.K.; Riechers, D.E.; Ferhatoglu, Y.; Barrett, M.; Duke, S.O.; Dayan, F.E.; Goldberg-Cavalleri, A.; Tétard-Jones, C.; Wortley, D.J.; Onkokesung, N.; et al. Herbicide Metabolism: Crop Selectivity, Bioactivation, Weed Resistance, and Regulation. Weed Sci. 2019, 67, 149–175. [Google Scholar] [CrossRef]
- Yu, Q.; Powles, S. Metabolism-Based Herbicide Resistance and Cross-Resistance in Crop Weeds: A Threat to Herbicide Sustainability and Global Crop Production. Plant Physiol. 2014, 166, 1106–1118. [Google Scholar] [CrossRef] [PubMed]
- Gaines, T.A.; Lorentz, L.; Figge, A.; Herrmann, J.; Maiwald, F.; Ott, M.; Han, H.; Busi, R.; Yu, Q.; Powles, S.B.; et al. RNA-Seq transcriptome analysis to identify genes involved in metabolism-based diclofop resistance in Lolium rigidum. Plant. J. 2014, 78, 865–876. [Google Scholar] [CrossRef]
- Vieira, B.C.; Luck, J.D.; Amundsen, K.L.; Gaines, T.A.; Werle, R.; Kruger, G.R. Response of Amaranthus spp. following exposure to sublethal herbicide rates via spray particle drift. PLoS ONE 2019, 14, e0220014. [Google Scholar] [CrossRef]
- Ashworth, M.B.; Walsh, M.J.; Flower, K.C.; Powles, S.B. Recurrent selection with reduced 2,4-D amine doses results in the rapid evolution of 2,4-D herbicide resistance in wild radish (Raphanus raphanistrum L.). Pest. Manag. Sci. 2016, 72, 2091–2098. [Google Scholar] [CrossRef]
- Busi, R.; Gaines, T.A.; Walsh, M.J.; Powles, S.B. Understanding the potential for resistance evolution to the new herbicide pyroxasulfone: Field selection at high doses versus recurrent selection at low doses. Weed Res. 2012, 52, 489–499. [Google Scholar] [CrossRef]
- Busi, R.; Neve, P.; Powles, S. Evolved polygenic herbicide resistance in Lolium rigidum by low-dose herbicide selection within standing genetic variation. Evol. Appl. 2013, 6, 231–242. [Google Scholar] [CrossRef]
- Busi, R.; Girotto, M.; Powles, S.B. Response to low-dose herbicide selection in self-pollinated Avena fatua. Pest. Manag. Sci. 2016, 72, 603–608. [Google Scholar] [CrossRef]
- Busi, R.; Powles, S.B. Evolution of glyphosate resistance in a Lolium rigidum population by glyphosate selection at sublethal doses. Heredity 2009, 103, 318–325. [Google Scholar] [CrossRef] [PubMed]
- Busi, R.; Powles, S.B. Cross-resistance to prosulfocarb + S-metolachlor and pyroxasulfone selected by either herbicide in Lolium rigidum. Pest. Manag. Sci. 2016, 72, 1664–1672. [Google Scholar] [CrossRef] [PubMed]
- Tehranchian, P.; Norsworthy, J.K.; Powles, S.; Bararpour, M.T.; Bagavathiannan, M.V.; Barber, T.; Scott, R.C. Recurrent Sublethal-Dose Selection for Reduced Susceptibility of Palmer Amaranth (Amaranthus palmeri) to Dicamba. Weed Sci. 2017, 65, 206–212. [Google Scholar] [CrossRef]
- Yu, Q.; Han, H.; Cawthray, G.R.; Wang, S.F.; Powles, S.B. Enhanced rates of herbicide metabolism in low herbicide-dose selected resistant Lolium rigidum. Plant. Cell Environ. 2013, 36, 818–827. [Google Scholar] [CrossRef]
- Délye, C.; Gardin, J.A.C.; Boucansaud, K.; Chauvel, B.; Petit, C. Non-target-site-based resistance should be the centre of attention for herbicide resistance research: Alopecurus myosuroides as an illustration. Weed Res. 2011, 51, 433–437. [Google Scholar] [CrossRef]
- Gressel, J. Evolving understanding of the evolution of herbicide resistance. Pest. Manag. Sci. 2009, 65, 1164–1173. [Google Scholar] [CrossRef]
- Kollist, H.; Zandalinas, S.I.; Sengupta, S.; Nuhkat, M.; Kangasjärvi, J.; Mittler, R. Rapid Responses to Abiotic Stress: Priming the Landscape for the Signal Transduction Network. Trends Plant. Sci. 2019, 24, 25–37. [Google Scholar] [CrossRef]
- Markus, C.; Pecinka, A.; Karan, R.; Barney, J.N.; Merotto, A. Epigenetic regulation—Contribution to herbicide resistance in weeds? Pest. Manag. Sci. 2018, 74, 275–281. [Google Scholar] [CrossRef]
- Radwan, D.E.M. Salicylic acid induced alleviation of oxidative stress caused by clethodim in maize (Zea mays L.) leaves. Pestic. Biochem. Physiol. 2012, 102, 182–188. [Google Scholar] [CrossRef]
- Weller, S.L.; Florentine, S.K.; Mutti, N.K.; Jha, P.; Chauhan, B.S. Response of Chloris truncata to moisture stress, elevated carbon dioxide and herbicide application. Sci. Rep. 2019, 9, 10721. [Google Scholar] [CrossRef]
- Miller, M.R.; Norsworthy, J.K. Influence of Soil Moisture on Absorption, Translocation, and Metabolism of Florpyrauxifen-benzyl. Weed Sci. 2018, 66, 418–423. [Google Scholar] [CrossRef]
- Skelton, J.J.; Ma, R.; Riechers, D.E. Waterhemp (Amaranthus tuberculatus) control under drought stress with 2,4-dichlorophenoxyacetic acid and glyphosate. Weed Biol. Manag. 2016, 16, 34–41. [Google Scholar] [CrossRef]
- Wu, L.-M.; Fang, Y.; Yang, H.-N.; Bai, L.-Y. Effects of drought-stress on seed germination and growth physiology of quinclorac-resistant Echinochloa crusgalli. PLoS ONE 2019, 14, e0214480. [Google Scholar] [CrossRef] [PubMed]
- Dos Santos, A.B.; Bottcher, A.; Kiyota, E.; Mayer, J.L.S.; Vicentini, R.; Dos Santos Brito, M.; Creste, S.; Landell, M.G.A.; Mazzafera, P. Water Stress Alters Lignin Content and Related Gene Expression in Two Sugarcane Genotypes. J. Agric. Food Chem. 2015, 63, 4708–4720. [Google Scholar] [CrossRef] [PubMed]
- Ritz, C.; Streibig, J. Analysis of dose-response curve data. Package ‘drc’. Available online: http://cran.r-project.org/web/packages/drc/drc.pdf (accessed on 24 June 2020).
- Seefeldt, S.S.; Jensen, J.E.; Fuerst, E.P. Log-Logistic Analysis of Herbicide Dose-Response Relationships. Weed Technol. 1995, 9, 218–227. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Caldana, C.; Scheible, W.R.; Mueller-Roeber, B.; Ruzicic, S. A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant. Methods 2007, 3, 7. [Google Scholar] [CrossRef] [PubMed]
- Jain, M.; Nijhawan, A.; Tyagi, A.K.; Khurana, J.P. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2006, 345, 646–651. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, Q.; Wu, J.; Zheng, X.; Zheng, S.; Sun, X.; Qiu, Q.; Lu, T. Gene Knockout Study Reveals That Cytosolic Ascorbate Peroxidase 2(OsAPX2) Plays a Critical Role in Growth and Reproduction in Rice under Drought, Salt and Cold Stresses. PLoS ONE 2013, 8, e57472. [Google Scholar] [CrossRef]
- Rouse, C.E. Characterization of Multiple-Herbicide-Resistant Echinochloa colona from Arkansas. Ph.D. Dissertation, University of Arkansas, Fayetteville, AR, USA, December 2017. [Google Scholar]
- Ye, S.; Yu, S.; Shu, L.; Wu, J.; Wu, A.; Luo, L. Expression profile analysis of 9 heat shock protein genes throughout the life cycle and under abiotic stress in rice. Chin. Sci. Bull. 2012, 57, 336–343. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Saeed, A.I.; Sharov, V.; White, J.; Li, J.; Liang, W.; Bhagabati, N.; Braisted, J.; Klapa, M.; Currier, T.; Thiagarajan, M.; et al. TM4: A free, open-source system for microarray data management and analysis. Biotechniques 2003, 34, 374–378. [Google Scholar] [CrossRef] [PubMed]
- Duke, S.O. Why have no new herbicide modes of action appeared in recent years? Pest. Manag. Sci. 2012, 68, 505–512. [Google Scholar] [CrossRef] [PubMed]
- Dayan, F.E. Is There a Natural Route to the Next Generation of Herbicides? Outlooks Pest. Manag. 2018, 29, 54–57. [Google Scholar] [CrossRef]
- Holsinger, K.E. Reproductive systems and evolution in vascular plants. Proc. Natl. Acad. Sci. USA 2000, 97, 7037–7042. [Google Scholar] [CrossRef]
- Oladosu, Y.; Rafii, M.Y.; Samuel, C.; Fatai, A.; Magaji, U.; Kareem, I.; Kamarudin, Z.S.; Muhammad, I.; Kolapo, K. Drought Resistance in Rice from Conventional to Molecular Breeding: A Review. Int. J. Mol. Sci. 2019, 20, 3519. [Google Scholar] [CrossRef]
- Gaines, T.A.; Cripps, A.; Powles, S.B. Evolved Resistance to Glyphosate in Junglerice (Echinochloa colona) from the Tropical Ord River Region in Australia. Weed Technol. 2012, 26, 480–484. [Google Scholar] [CrossRef]
- Matzrafi, M.; Seiwert, B.; Reemtsma, T.; Rubin, B.; Peleg, Z. Climate change increases the risk of herbicide-resistant weeds due to enhanced detoxification. Planta 2016, 244, 1217–1227. [Google Scholar] [CrossRef]
- Tétard-Jones, C.; Sabbadin, F.; Moss, S.; Hull, R.; Neve, P.; Edwards, R. Changes in the proteome of the problem weed blackgrass correlating with multiple-herbicide resistance. Plant. J. 2018, 94, 709–720. [Google Scholar] [CrossRef]
- Pereira, A. Plant abiotic stress challenges from the changing environment. Front. Plant. Sci. 2016, 7, 2013–2015. [Google Scholar] [CrossRef]
- Caverzan, A.; Passaia, G.; Rosa, S.B.; Ribeiro, C.W.; Lazzarotto, F.; Margis-Pinheiro, M. Plant responses to stresses: Role of ascorbate peroxidase in the antioxidant protection. Peroxidases Biochem. Charact. Funct. Potential Appl. 2013, 4, 142–158. [Google Scholar] [CrossRef] [PubMed]
- Maroli, A.S.; Nandula, V.K.; Dayan, F.E.; Duke, S.O.; Gerard, P.; Tharayil, N. Metabolic Profiling and Enzyme Analyses Indicate a Potential Role of Antioxidant Systems in Complementing Glyphosate Resistance in an Amaranthus palmeri Biotype. J. Agric. Food Chem. 2015, 63, 9199–9209. [Google Scholar] [CrossRef] [PubMed]
- Agostinetto, D.; Benemann, D.P.; Cechin, J.; Nohatto, M.A.; Langaro, A.C.; Piasecki, C.; Vargas, L. Gene Expression Related to Oxidative Stress Induced by Herbicides in Rice. Agron. J. 2019, 111, 1239–1246. [Google Scholar] [CrossRef]
- Li, Z.; Li, J.; Bing, J.; Zhang, G. The role analysis of APX gene family in the growth and developmental processes and in response to abiotic stresses in Arabidopsis thaliana. Yi Chuan = Hered. 2019, 41, 534–547. [Google Scholar] [CrossRef]
- Guo, F.; Iwakami, S.; Yamaguchi, T.; Uchino, A.; Sunohara, Y.; Matsumoto, H. Role of CYP81A cytochrome P450s in clomazone metabolism in Echinochloa phyllopogon. Plant. Sci. 2019, 283, 321–328. [Google Scholar] [CrossRef]
- Busi, R.; Goggin, D.E.; Heap, I.M.; Horak, M.J.; Jugulam, M.; Masters, R.A.; Napier, R.M.; Riar, D.S.; Satchivi, N.M.; Torra, J.; et al. Weed resistance to synthetic auxin herbicides. Pest Manag. Sci. 2018, 74, 2265–2276. [Google Scholar] [CrossRef]
- Ghanizadeh, H.; Harrington, K.C. Non-target Site Mechanisms of Resistance to Herbicides. CRC. Crit. Rev. Plant. Sci. 2017, 36, 24–34. [Google Scholar] [CrossRef]
- Fang, J.; Zhang, Y.; Liu, T.; Yan, B.; Li, J.; Dong, L. Target-Site and Metabolic Resistance Mechanisms to Penoxsulam in Barnyardgrass (Echinochloa crus-galli (L.) P. Beauv). J. Agric. Food Chem. 2019, 67, 8085–8095. [Google Scholar] [CrossRef]
- Yan, B.; Zhang, Y.; Li, J.; Fang, J.; Liu, T.; Dong, L. Transcriptome profiling to identify cytochrome P450 genes involved in penoxsulam resistance in Echinochloa glabrescens. Pestic. Biochem. Physiol. 2019, 158, 112–120. [Google Scholar] [CrossRef]
- Torra, J.; Rojano-Delgado, A.M.; Rey-Caballero, J.; Royo-Esnal, A.; Salas, M.L.; De Prado, R. Enhanced 2,4-D metabolism in two resistant papaver rhoeas populations from Spain. Front. Plant. Sci. 2017, 8, 1584. [Google Scholar] [CrossRef]
- Guo, L.; Qiu, J.; Ye, C.; Jin, G.; Mao, L.; Zhang, H.; Yang, X.; Peng, Q.; Wang, Y.; Jia, L.; et al. Echinochloa crus-galli genome analysis provides insight into its adaptation and invasiveness as a weed. Nat. Commun. 2017, 8, 1031. [Google Scholar] [CrossRef] [PubMed]
- Dimaano, N.G.; Yamaguchi, T.; Fukunishi, K.; Tominaga, T.; Iwakami, S. Functional characterization of cytochrome P450 CYP81A subfamily to disclose the pattern of cross-resistance in Echinochloa phyllopogon. Plant. Mol. Biol. 2020, 102, 403–416. [Google Scholar] [CrossRef]
- Divya, K.; Bhatnagar-Mathur, P.; Sharma, K.K.; Reddy, P.S. Heat Shock Proteins (HSPS) Mediated Signalling Pathways During Abiotic Stress Conditions; Elsevier Inc.: Amsterdam, The Netherlands, 2019; ISBN 9780128164518. [Google Scholar]
- Singh, R.K.; Gupta, V.; Prasad, M. Plant molecular chaperones: Structural organization and their roles in abiotic stress tolerance. In Molecular Plant Abiotic Stress; Roychoudhury, A., Tripathi, D., Eds.; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2019; pp. 221–239. [Google Scholar]
- Dyer, W.E. Stress-induced evolution of herbicide resistance and related pleiotropic effects. Pest. Manag. Sci. 2018, 74, 1759–1768. [Google Scholar] [CrossRef]
- Balfagón, D.; Zandalinas, S.I.; Baliño, P.; Muriach, M.; Gómez-Cadenas, A. Involvement of ascorbate peroxidase and heat shock proteins on citrus tolerance to combined conditions of drought and high temperatures. Plant. Physiol. Biochem. 2018, 127, 194–199. [Google Scholar] [CrossRef]
- Esmaeili, N.; Yang, X.; Cai, Y.; Sun, L.; Zhu, X.; Shen, G.; Payton, P.; Fang, W.; Zhang, H. Co-overexpression of AVP1 and OsSIZ1 in Arabidopsis substantially enhances plant tolerance to drought, salt, and heat stresses. Sci. Rep. 2019, 9, 7642. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.A.; Li, Z.-G.; Hoque, T.S.; Burritt, D.J.; Fujita, M.; Munné-Bosch, S. Heat or cold priming-induced cross-tolerance to abiotic stresses in plants: Key regulators and possible mechanisms. Protoplasma 2018, 255, 399–412. [Google Scholar] [CrossRef]
- Keith, B.K.; Burns, E.E.; Bothner, B.; Carey, C.C.; Mazurie, A.J.; Hilmer, J.K.; Biyiklioglu, S.; Budak, H.; Dyer, W.E. Intensive herbicide use has selected for constitutively elevated levels of stress-responsive mRNAs and proteins in multiple herbicide-resistant Avena fatua L. Pest. Manag. Sci. 2017, 73, 2267–2281. [Google Scholar] [CrossRef] [PubMed]
- Jacob, P.; Hirt, H.; Bendahmane, A. The heat-shock protein/chaperone network and multiple stress resistance. Plant. Biotechnol. J. 2017, 15, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Chen, X.; Hu, W.; Xiang, Y.; Yan, M.; Wang, J. Overexpressing heat-shock protein OsHSP50.2 improves drought tolerance in rice. Plant. Cell Rep. 2018, 37, 1585–1595. [Google Scholar] [CrossRef]
- Islam, M.O.; Kato, H.; Shima, S.; Tezuka, D.; Matsui, H.; Imai, R. Functional identification of a rice trehalase gene involved in salt stress tolerance. Gene 2019, 685, 42–49. [Google Scholar] [CrossRef]
- Kosar, F.; Akram, N.A.; Sadiq, M.; Al-Qurainy, F.; Ashraf, M. Trehalose: A Key Organic Osmolyte Effectively Involved in Plant Abiotic Stress Tolerance. J. Plant. Growth Regul. 2019, 38, 606–618. [Google Scholar] [CrossRef]
- Zang, B.; Li, H.; Li, W.; Deng, X.W.; Wang, X. Analysis of trehalose-6-phosphate synthase (TPS) gene family suggests the formation of TPS complexes in rice. Plant. Mol. Biol. 2011, 76, 507–522. [Google Scholar] [CrossRef] [PubMed]
- Agreda-Laguna, K.-A.; Cabrera-Ponce, J.-L.; Ruiz Medrano, R.; Antonio Garzon-Tiznado, J.; Xoconostle-Cazares, B. Trehalose Accumulation Provides Drought Tolerance to Genetically-Modified Maize in Open Field Trials. Pak. J. Agric. Sci. 2018, 55, 1009–1020. [Google Scholar] [CrossRef]
- Lin, Q.; Yang, J.; Wang, Q.; Zhu, H.; Chen, Z.; Dao, Y.; Wang, K. Overexpression of the trehalose-6-phosphate phosphatase family gene AtTPPF improves the drought tolerance of Arabidopsis thaliana. BMC Plant. Biol. 2019, 19, 381. [Google Scholar] [CrossRef]
- Liu, X.; Fu, L.; Qin, P.; Sun, Y.; Liu, J.; Wang, X. Overexpression of the wheat trehalose 6-phosphate synthase 11 gene enhances cold tolerance in Arabidopsis thaliana. Gene 2019, 710, 210–217. [Google Scholar] [CrossRef] [PubMed]
- Lyu, J.I.; Park, J.H.; Kim, J.-K.; Bae, C.-H.; Jeong, W.-J.; Min, S.R.; Liu, J.R. Enhanced tolerance to heat stress in transgenic tomato seeds and seedlings overexpressing a trehalose-6-phosphate synthase/phosphatase fusion gene. Plant. Biotechnol. Rep. 2018, 12, 399–408. [Google Scholar] [CrossRef]
- Meitzel, T.; Radchuk, R.; McAdam, E.L.; Thormählen, I.; Munz, E.; Hilo, A.; Geigenberger, P.; Ross, J.J.; Lunn, J.E.; Borisjuk, L. Trehalose 6-phosphate Controls Seed Filling by Inducing Auxin Biosynthesis. bioRxiv 2019, 752915. [Google Scholar] [CrossRef]
- Barbier, F.; Péron, T.; Lecerf, M.; Perez-Garcia, M.D.; Barrière, Q.; Rolčík, J.; Boutet-Mercey, S.; Citerne, S.; Lemoine, R.; Porcheron, B.; et al. Sucrose is an early modulator of the key hormonal mechanisms controlling bud outgrowth in Rosa hybrida. J. Exp. Bot. 2015, 66, 2569–2582. [Google Scholar] [CrossRef]
- Lilley, J.L.S.; Gee, C.W.; Sairanen, I.; Ljung, K.; Nemhauser, J.L. An endogenous carbon-sensing pathway Triggers increased auxin flux and hypocotyl elongation. Plant. Physiol. 2012, 160, 2261–2270. [Google Scholar] [CrossRef]
- Ljung, K.; Nemhauser, J.L.; Perata, P. New mechanistic links between sugar and hormone signalling networks. Curr. Opin. Plant. Biol. 2015, 25, 130–137. [Google Scholar] [CrossRef]
- Sairanen, I.; Novák, O.; Pěnčík, A.; Ikeda, Y.; Jones, B.; Sandberg, G.; Ljung, K. Soluble carbohydrates regulate auxin biosynthesis via PIF proteins in Arabidopsis. Plant. Cell 2013, 24, 4907–4916. [Google Scholar] [CrossRef]
- Baucom, R.S. Evolutionary and ecological insights from herbicide-resistant weeds: What have we learned about plant adaptation, and what is left to uncover? New Phytol. 2019, 223, 68–82. [Google Scholar] [CrossRef]
- Burns, E.E.; Keith, B.K.; Talbert, L.E.; Dyer, W.E. Non-target site resistance to flucarbazone, imazamethabenz and pinoxaden is controlled by three linked genes in Avena fatua. Weed Res. 2018, 58, 8–16. [Google Scholar] [CrossRef]
- Délye, C.; Duhoux, A.; Gardin, J.A.C.; Gouzy, J.; Carrère, S. High conservation of the transcriptional response to acetolactate-synthase-inhibiting herbicides across plant species. Weed Res. 2018, 58, 2–7. [Google Scholar] [CrossRef]
- Maroli, A.S.; Gaines, T.A.; Foley, M.E.; Duke, S.O.; Doğramacı, M.; Anderson, J.V.; Horvath, D.P.; Chao, W.S.; Tharayil, N. Omics in Weed Science: A Perspective from Genomics, Transcriptomics, and Metabolomics Approaches. Weed Sci. 2018, 66, 681–695. [Google Scholar] [CrossRef]
- Wilson, C.E.; Takano, H.K.; Van Horn, C.R.; Yerka, M.K.; Westra, P.; Stoltenberg, D.E. Physiological and molecular analysis of glyphosate resistance in non-rapid response Ambrosia trifida from Wisconsin. Pest. Manag. Sci. 2020, 76, 150–160. [Google Scholar] [CrossRef] [PubMed]
- Brazier-Hicks, M.; Gershater, M.; Dixon, D.; Edwards, R. Substrate specificity and safener inducibility of the plant UDP-glucose-dependent family 1 glycosyltransferase super-family. Plant. Biotechnol. J. 2018, 16, 337–348. [Google Scholar] [CrossRef]
- Pan, L.; Gao, H.; Xia, W.; Zhang, T.; Dong, L. Establishing a herbicide-metabolizing enzyme library in Beckmannia syzigachne to identify genes associated with metabolic resistance. J. Exp. Bot. 2016, 67, 1745–1757. [Google Scholar] [CrossRef]
- Liu, Q.; Chen, T.T.; Xiao, D.W.; Zhao, S.M.; Lin, J.S.; Wang, T.; Li, Y.J.; Hou, B.K. OsIAGT1 Is a Glucosyltransferase Gene Involved in the Glucose Conjugation of Auxins in Rice. Rice 2019, 12, 92. [Google Scholar] [CrossRef]
- Xu, W.; Di, C.; Zhou, S.; Liu, J.; Li, L.; Liu, F.; Yang, X.; Ling, Y.; Su, Z. Rice transcriptome analysis to identify possible herbicide quinclorac detoxification genes. Front. Genet. 2015, 6, 306. [Google Scholar] [CrossRef]
- Ljung, K. Auxin metabolism and homeostasis during plant development. Dev. 2013, 140, 943–950. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.H.; Ma, X.M.; Han, P.; Wang, B.; Sun, Y.G.; Zhang, G.Z.; Li, Y.J.; Hou, B.K. UGT74D1 Is a Novel Auxin Glycosyltransferase from Arabidopsis thaliana. PLoS ONE 2013, 8, e61705. [Google Scholar] [CrossRef]




| Active Ingredient | Trade Name | WSSA Group a | MOA | Chemical Family | Recommended Rate (g ae·ha–1) | Application Rate b (g ae·ha–1) |
|---|---|---|---|---|---|---|
| Florpyrauxifen-benzyl | Loyant® | 4 | Synthetic auxins | Arylpicolinate | 30 | 7.5 |
| Glyphosate | Roundup PowerMax® | 9 | Inhibition of EPSP synthase | Glycine | 1056 | 132 |
| Quinclorac | Facet L® | 4 | Synthetic auxins | Quinoline carboxylic acid | 432 | 54 |
| Gene | Family/Name | Oligonucleotide Sequences (5′→3′) | Reference |
|---|---|---|---|
| Act1 (Reference gene) | Actin 1 | F: ATCCTTGTATGCTAGCGGTCGA | [52] |
| R: ATCCAACCGGAGGATAGCATG | |||
| EF1-α (Reference gene) | Elongation factor 1 α | F: GTCATTGGCCACGTCGACTC | [52] |
| R: TGTTCATCTCAGCGGCTTCC | |||
| UBQ5 (Reference gene) | Ubiquitin 5 | F: ACCACTTCGACCGCCACTACT | [53] |
| R: ACGCCTAAGCCTGCTGGTT | |||
| APX2 | Ascorbate peroxidase | F: CATCCTCTCCTACGCCGAC | [54] |
| R: CCTTCAGGAGGAGGCTCAG | |||
| CYP709B1 | Cytochrome P450 709B1 | F: GTCGTCAAGCAGGTGCTCTT | [55] |
| R: CAGTGAGGACGAGACCCTTG | |||
| CYP709B2 | Cytochrome P450 709B2 | F: GCCTGAGAGGTTCGAGTACG | [55] |
| R: CGATCATCGCAAAGTTCTGA | |||
| CYP72A14 | Cytochrome P450 72A14 | F: TCGGTGGCATCAAATATCCT | [55] |
| R: GAACTTGCCTGCGTCTTTTC | |||
| CYP72A15 | Cytochrome P450 72A15 | F: CCAGTGAGCTGATACGCAGA | [55] |
| R: GACGTCGCCTGTGAGATTTT | |||
| UGT75D | Glycosyltransferase | F: GCTCACTTTCCCGTTCCAG | [56] |
| R: GTGGTGGAGAATGTGACGAG | |||
| HSP10 | Heat-shock protein 71.10 | F: CCGTGTGCTTCGACATTGAC | [56] |
| R: CGTTGGTGATGGTGHTCTTGTT | |||
| HSP15 | Heat-shock protein 24.15 | F: GATCAAGGCGGAGATGAAGAAC | [55] |
| R: ACTCGACGTTGACCTGGAAGA | |||
| TPP | Trehalose phosphate phosphatase | F: TTGAAGGTGCGAGTGTTGAG | [55] |
| R: AACCACTCCCCAGTCCTTCT | |||
| TPS | Trehalose phosphate synthase | F: ACAGAGGGGCTACATTGCAC | [52] |
| R: CTGCAACTGCTCCAAGTGAA |
| Log-Logistic Regression Estimates a | |||||
|---|---|---|---|---|---|
| Treatments b | b | d | ED50 | p-Value c | TI d |
| Florpyrauxifen-Benzyl | (g ae ha−1) | ||||
| G0∙WW | −1.99 (0.09) | 100.79 (0.67) | 3.34 (0.07) | <0.05 | - |
| G0∙DS | −1.36 (0.06) | 103.93 (0.96) | 3.91 (0.12) | <0.05 | 1.17 |
| G1∙WW | −2.25 (0.12) | 100.50 (0.78) | 3.46 (0.09) | <0.05 | 1.04 |
| G1∙DS | −1.39 (0.06) | 104.95 (1.31) | 5.57 (0.18) | <0.05 | 1.67 |
| G2∙WW | −2.23 (0.13) | 100.28 (0.83) | 3.46 (0.08) | <0.05 | 1.04 |
| G2∙DS | −1.56 (0.07) | 104.90 (1.32) | 6.94 (0.25) | <0.05 | 2.07 |
| Glyphosate | (g ae ha−1) | ||||
| G0∙WW | −1.75 (0.16) | 101.91 (1.82) | 196.82 (11.40) | <0.05 | - |
| G0∙DS | −1.78 (0.16) | 105.11 (2.19) | 364.74 (20.21) | <0.05 | 1.85 |
| G1∙WW | −1.71 (0.14) | 102.41 (1.73) | 207.77 (11.32) | <0.05 | 1.06 |
| G1∙DS | −1.86 (0.15) | 104.68 (2.09) | 406.97 (20.55) | <0.05 | 2.07 |
| G2∙WW | −1.60 (0.13) | 102.15 (1.85) | 217.88 (12.37) | <0.05 | 1.11 |
| G2∙DS | −2.15 (0.17) | 104.46 (1.97) | 501.75 (21.97) | <0.05 | 2.55 |
| Quinclorac | (g ae ha−1) | ||||
| G0∙WW | −1.61 (0.14) | 105.05 (2.29) | 97.95 (6.05) | <0.05 | - |
| G0∙DS | −1.84 (0.16) | 104.57 (2.17) | 113.73 (6.29) | <0.05 | 1.16 |
| G1∙WW | −1.67 (0.14) | 104.62 (2.19) | 98.66 (5.86) | <0.05 | 1.01 |
| G1∙DS | −1.95 (0.17) | 104.61 (2.15) | 126.81 (6.64) | <0.05 | 1.29 |
| G2∙WW | −1.60 (0.11) | 104.88 (1.89) | 100.94 (5.10) | <0.05 | 1.03 |
| G2∙DS | −2.25 (0.17) | 103.35 (1.72) | 147.64 (5.76) | <0.05 | 1.51 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Benedetti, L.; Rangani, G.; Ebeling Viana, V.; Carvalho-Moore, P.; Rabaioli Camargo, E.; Avila, L.A.d.; Roma-Burgos, N. Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice. Agronomy 2020, 10, 1619. https://doi.org/10.3390/agronomy10111619
Benedetti L, Rangani G, Ebeling Viana V, Carvalho-Moore P, Rabaioli Camargo E, Avila LAd, Roma-Burgos N. Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice. Agronomy. 2020; 10(11):1619. https://doi.org/10.3390/agronomy10111619
Chicago/Turabian StyleBenedetti, Lariza, Gulab Rangani, Vívian Ebeling Viana, Pâmela Carvalho-Moore, Edinalvo Rabaioli Camargo, Luis Antonio de Avila, and Nilda Roma-Burgos. 2020. "Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice" Agronomy 10, no. 11: 1619. https://doi.org/10.3390/agronomy10111619
APA StyleBenedetti, L., Rangani, G., Ebeling Viana, V., Carvalho-Moore, P., Rabaioli Camargo, E., Avila, L. A. d., & Roma-Burgos, N. (2020). Recurrent Selection by Herbicide Sublethal Dose and Drought Stress Results in Rapid Reduction of Herbicide Sensitivity in Junglerice. Agronomy, 10(11), 1619. https://doi.org/10.3390/agronomy10111619

