The Cell-Wall β-d-Glucan in Leaves of Oat (Avena sativa L.) Affected by Fungal Pathogen Blumeria graminis f. sp. avenae
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Pathogen Infection
2.2. Determination of β-d-Glucans in Leaves
2.3. Content of Chlorophylls
2.4. βGlucanase Analysis
2.5. Expression of CslF Genes
2.6. Statistical Analysis
3. Results
3.1. Determination of β-d-Glucans
3.2. Chlorophyll Content
3.3. Glucanhydrolases
3.4. CslF6 Gene Expression
3.5. CslF9 Gene Expression
3.6. CslF3 Gene Expression
3.7. Relationships among All Evaluated Parameters
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burton, R.A.; Collins, H.M.; Kibble, N.A.J.; Smith, J.A.; Shirley, N.J.; Jobling, S.A.; Henderson, M.; Singh, R.R.; Pettolino, F.; Wilson, S.M.; et al. Over-expression of specific HvCslF cellulose synthase-like genes in transgenic barley increases the levels of cell wall (1,3;1,4)-β-d-glucans and alters their fine structure. Plant Biotechnol. J. 2011, 9, 117–135. [Google Scholar] [CrossRef] [PubMed]
- Carpita, N.C.; Defernez, M.; Findlay, K.; Wells, B.; Shoue, D.A.; Catchpole, G.; Wilson, R.H.; McCann, M.C. Cell wall architecture of the elongating maize coleoptile. Plant Physiol. 2001, 127, 551–565. [Google Scholar] [CrossRef]
- Burton, R.A.; Gidley, M.J.; Fincher, G.B. Heterogeneity in the chemistry, structure and function of plant cell walls. Nat. Chem. Biol. 2010, 6, 724–732. [Google Scholar] [CrossRef] [PubMed]
- Fincher, G.B. Revolutionary times in our understanding of cell wall biosynthesis and remodeling in the grasses. Plant Physiol. 2009, 149, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Burton, R.A.; Fincher, G.B. (1,3;1,4)-β-d-Glucans in Cell Walls of the Poaceae, Lower Plants, and Fungi: A Tale of Two Linkages. Mol. Plant 2009, 2, 873–882. [Google Scholar] [CrossRef] [PubMed]
- Mathews, R.; Kamil, A.; Chu, Y. Global review of heart health claims for oat beta-glucan products. Nutr. Rev. 2020, 78, 78–97. [Google Scholar] [CrossRef]
- Ahmad, A.; Munir, B.; Abrar, M. Perspective of β-glucan as functional ingredient for food industry. J. Nutr. Food Sci. 2012, 52, 201–212. [Google Scholar] [CrossRef]
- Ames, N.; Storsley, J.; Thandapilly, S.J. CHAPTER 8: Functionality of beta-glucan from oat and barley and its relation with human health. In Cereal Grain-Based Functional Foods, 1st ed.; Beta, T., Camire, M.E., Eds.; RSC Publisher: Cambridge, UK, 2018; pp. 147–166. [Google Scholar] [CrossRef]
- Burton, R.A.; Fincher, G.B. Current challenges in cell wall biology in the cereals and grasses. Front. Plant Sci. 2012, 3, 130. [Google Scholar] [CrossRef]
- Havrlentová, M.; Gregusová, V.; Šliková, S.; Nemeček, P.; Hudcovicová, M.; Kuzmová, D. Relationship between the Content of β-d-Glucans and Infection with Fusarium Pathogens in Oat (Avena sativa L.) Plants. Plants 2020, 9, 1776. [Google Scholar] [CrossRef]
- Martin, C.; Schöneberg, T.; Vogelgsang, S.; Morisoli, R.; Bertossa, M.; Mauch-Mani, B.; Mascher, F. Resistance against Fusarium graminearum and the relationship to β-glucan content in barley grains. Eur. J. Plant Pathol. 2018, 152, 621–634. [Google Scholar] [CrossRef]
- Kofuji, K.; Aoki, A.; Tsubaki, K.; Konishi, M.; Isobe, T.; Murata, Y. Antioxidant Activity of β-Glucan. ISRN Pharm. 2012, 2012, 125864. [Google Scholar] [CrossRef]
- Lattanzio, V.; Lattanzio, V.M.T.; Cardinali, A. Role of phenolics in the resistance mechanisms of plants against fungal Pathogens and Insects. In Phytochemistry: Advances in Research; John Wiley and Sons: Hoboken, NJ, USA, 2006; Volume 661, pp. 23–67. [Google Scholar] [CrossRef]
- Bai, Y.-P.; Zhou, H.-M.; Zhu, K.-R.; Li, Q. Effect of thermal processing on the molecular, structural, and antioxidant characteristics of highland barley β-glucan. Carbohydr. Polym. 2021, 271, 118416. [Google Scholar] [CrossRef] [PubMed]
- Burton, R.A. Cellulose Synthase-Like CslF Genes Mediate the Synthesis of Cell Wall (1,3;1,4)-β-d-Glucans. Science 2006, 311, 1940–1942. [Google Scholar] [CrossRef] [PubMed]
- Doblin, M.S.; Pettolino, F.A.; Wilson, S.M.; Campbell, R.; Burton, R.A.; Fincher, G.B.; Newbigin, E.; Bacic, A. A barley cellulose synthase-like CSLH gene mediates (1,3;1,4)-β-d-glucan synthesis in transgenic Arabidopsis. Proc. Natl. Acad. Sci. USA 2009, 106, 5996–6001. [Google Scholar] [CrossRef] [PubMed]
- Farrokhi, N.; Burton, R.A.; Brownfield, L.; Hrmova, M.; Wilson, S.M.; Bacic, A.; Fincher, G.B. Plant cell wall biosynthesis: Genetic, biochemical and functional genomics approaches to the identification of key genes. Plant Biotechnol. J. 2006, 4, 145–167. [Google Scholar] [CrossRef]
- Little, A.; Schwerdt, J.G.; Shirley, N.J.; Khor, S.F.; Neumann, K.; O’Donovan, L.A.; Lahnstein, J.; Collins, H.M.; Henderson, M.; Fincher, G.B.; et al. Revised Phylogeny of the Cellulose Synthase Gene Superfamily: Insights into Cell Wall Evolution. Plant Physiol. 2018, 177, 1124–1141. [Google Scholar] [CrossRef] [PubMed]
- Nemeth, C.; Freeman, J.; Jones, H.D.; Sparks, C.; Pellny, T.K.; Wilkinson, M.D.; Dunwell, J.; Andersson, A.A.M.; Mitchell, R.A.C.; Shewry, P.R. Down-Regulation of the CSLF6 Gene Results in Decreased (1,3;1,4)-β-d-Glucan in Endosperm of Wheat. Plant Physiol. 2010, 152, 10. [Google Scholar] [CrossRef]
- Vega-Sánchez, M.E.; Verhertbruggen, Y.; Christensen, U.; Chen, X.; Sharma, V.; Varanasi, P.; Jobling, S.A.; Talbot, M.; White, R.G.; Joo, M.; et al. Loss of Cellulose Synthase-Like F6 Function Affects Mixed-Linkage Glucan Deposition, Cell Wall Mechanical Properties, and Defense Responses in Vegetative Tissues of Rice. Plant Physiol. 2012, 159, 56–69. [Google Scholar] [CrossRef]
- Burton, R.A.; Jobling, S.A.; Harvey, A.J.; Shirley, N.J.; Mather, D.E.; Bacic, A.; Fincher, G.B. The Genetics and Transcriptional Profiles of the Cellulose Synthase-Like HvCslF Gene Family in Barley. Plant Physiol. 2008, 146, 1821–1833. [Google Scholar] [CrossRef]
- Garcia-Gimenez, G.; Barakate, A.; Smith, P.; Stephens, J.; Khor, S.F.; Doblin, M.S.; Hao, P.; Bacic, A.; Fincher, G.B.; Burton, R.A.; et al. Targeted mutation of barley (1,3;1,4)-β-glucan synthases reveals complex relationships between the storage and cell wall polysaccharide content. Plant J. 2020, 104, 1009–1022. [Google Scholar] [CrossRef] [PubMed]
- Hrmova, M.; Farkas, V.; Lahnstein, J.; Fincher, G.B. A Barley Xyloglucan Xyloglucosyl Transferase Covalently Links Xyloglucan, Cellulosic Substrates, and (1,3;1,4)-β-d-Glucans. J. Biol. Chem. 2007, 282, 12951–12962. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Xue, X.; Cui, S.; Zhang, X.; Han, Q.; Zhu, L.; Liang, X.; Wang, X.; Huang, L.; Chen, X.; et al. Cloning and characterization of a wheat β-1,3-glucanase gene induced by the stripe rust pathogen Puccinia striiformis f. sp. tritici. Mol. Biol. Rep. 2010, 37, 1045–1052. [Google Scholar] [CrossRef] [PubMed]
- Balasubramanian, V.; Vashisht, D.; Cletus, J.; Sakthivel, N. Plant β-1,3-glucanases: Their biological functions and transgenic expression against phytopathogenic fungi. Biotechnol. Lett. 2012, 34, 1983–1990. [Google Scholar] [CrossRef] [PubMed]
- Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Münch-Garthoff, S.; Neuhaus, J.-M.; Boller, T.; Kemmerling, B.; Kogel, K.-H. Expression of β-1,3-glucanase and chitinase in healthy, stem-rust-affected and elicitor-treated near-isogenic wheat lines showing Sr5-OrSr24-specified race-specific rust resistance. Planta 1997, 201, 235–244. [Google Scholar] [CrossRef]
- Shetty, N.P.; Kristensen, B.K.; Newman, M.-A.; Møller, K.; Gregersen, P.L.; Jørgensen, H.J.L. Association of hydrogen peroxide with restriction of Septoria tritici in resistant wheat. Physiol. Mol. Plant Pathol. 2003, 62, 333–346. [Google Scholar] [CrossRef]
- Ray, S.; Anderson, J.M.; Urmeev, F.I.; Goodwin, S.B. Rapid induction of a protein disulfide isomerase and defense-related genes in wheat in response to the hemibiotrophic fungal pathogen Mycosphaerella graminicola. Plant Mol. Biol. 2003, 53, 741–754. [Google Scholar] [CrossRef]
- Adhikari, T.B.; Balaji, B.; Breeden, J.; Goodwin, S.B. Resistance of wheat to Mycosphaerella graminicola involves early and late peaks of gene expression. Physiol. Mol. Plant Pathol. 2007, 71, 55–68. [Google Scholar] [CrossRef]
- Hlinková, E.; Bobák, M.; Illéš, P. Chitinases and endoglucanases synthesized in the infected barley leaves in the powdery mildew period sporulation. Plant Prot. Sci. 2002, 38, 469–473. [Google Scholar] [CrossRef]
- Pham, T.A.T.; Schwerdt, J.G.; Shirley, N.J.; Xing, X.; Hsieh, Y.S.Y.; Srivastava, V.; Bulone, V.; Little, A. Analysis of cell wall synthesis and metabolism during early germination of Blumeria graminis f. sp. hordei conidial cells induced in vitro. Cell Surf. 2019, 5, 100030. [Google Scholar] [CrossRef]
- Okoń, S.; Kowalczyk, K. Deriving isolates of powdery mildew (Blumeria Graminis DC. f. sp. avenae Em. Marchal.) in common oat (Avena sativa L.) and using them to identify selected resistance genes. Acta Agrobot. 2012, 65, 155–160. [Google Scholar] [CrossRef]
- Roderick, H.W.; Jones, E.R.L.; Šebesta, J. Resistance to oat powdery mildew in Britain and Europe: A review. Ann. Appl. Biol. 2000, 136, 85–91. [Google Scholar] [CrossRef]
- Bhardwaj, N.R.; Banyal, D.K.; Roy, A.K. Prediction model for assessing powdery mildew disease in common oat (Avena sativa L.). J. Crop Prot. 2021, 146, 105677. [Google Scholar] [CrossRef]
- Okoń, S.; Cieplak, M.; Kuzdraliński, A.; Ociepa, T. New Pathotype Nomenclature for Better Characterization the Virulence and Diversity of Blumeria graminis f.sp. avenae Populations. Agronomy 2021, 11, 1852. [Google Scholar] [CrossRef]
- Jones, I.T.; Roderick, H.W.; Clifford, B.C. The integration of host resistance with fungicides in the control of oat powdery mildew. Ann. App. Biol. 1987, 110, 591–602. [Google Scholar] [CrossRef]
- Zhang, Z.; Henderson, C.; Perfect, E.; Carver, T.L.W.; Thomas, B.J.; Skamnioti, P.; Gurr, S.J. Of genes and genomes, needles, and haystacks: Blumeria graminis and functionality. Mol. Plant Pathol. 2005, 6, 561–575. [Google Scholar] [CrossRef]
- Xue, L.H.; Li, C.J.; Zhao, G.Q. First report of powdery mildew caused by Blumeria graminis on Avena sativa in China. Plant Dis. 2017, 101, 1954. [Google Scholar] [CrossRef]
- Malannavar, A.B.; Banyal, D.K. Components of slow mildewing in oat powdery mildew caused by Blumeria graminis f. sp. avenae. Himachal J. Agric. Res. 2020, 46, 62–68. [Google Scholar]
- Okoń, S.M.; Ociepa, T. Virulence structure of the Blumeria graminis DC.f. sp. avenae populations occurring in Poland across 2010–2013. Eur. J. Plant Pathol. 2017, 149, 711–718. [Google Scholar] [CrossRef]
- Schwarzbach, E.; Červená, V.; Bojnanská, K. Settling velocity and dispersion of barley powdery mildew conidia in still and turbulent air in settling tower. In Abstract Book. Proceedings of the 8th Conference of the European Foundation for Plant Pathology and British Society for Plant Pathology: Presidential Meeting 2006, Copenhagen, Denmark, 13–17th August 2006; KVL: Frederiksberg, Denmark, 2006. [Google Scholar]
- Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. In Methods in Enzymology; Whisstock, C., Phillip, I., Eds.; Bird, Academic Press: Oxford, UK, 1987; Volume 148, pp. 350–382. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Pan, S.Q.; Ye, X.S.; Kuc, J. A Technique for Detection of Chitinase, β-1, 3-glucanase, and Protein Patterns After a Single Separation Using Polyacrylamide Gel Electrophoresis or Isoelectrofocusing. Phytopahology 1991, 81, 970. [Google Scholar] [CrossRef]
- Żur, I.; Gołębiowska, G.; Dubas, E.; Golemiec, E.; Matušíková, I.; Libantová, J.; Moravčíková, J. β-1,3-glucanase and chitinase activities in winter triticales during cold hardening and subsequent infection by Microdochium nivale. Biologia 2013, 68, 241–248. [Google Scholar] [CrossRef]
- Michalko, J.; Socha, P.; Mészáros, P.; Blehová, A.; Libantová, J.; Moravčíková, J.; Matušíková, I. Glucan-rich diet is digested and taken up by the carnivorous sundew (Drosera rotundifolia L.): Implication for a novel role of plant β-1,3-glucanases. Planta 2013, 238, 715–725. [Google Scholar] [CrossRef]
- Maglovski, M.; Gregorová, Z.; Rybanský, Ľ.; Mészáros, P.; Moravčíková, J.; Hauptvogel, P.; Adamec, L.; Matušíková, I. Nutrition supply affects the activity of pathogenesis-related β-1,3-glucanases and chitinases in wheat. Plant Growth Regul. 2017, 81, 443–453. [Google Scholar] [CrossRef]
- Piršelová, B.; Kuna, R.; Libantová, J.; Moravčíková, J.; Matušíková, I. Biochemical and physiological comparison of heavy metal-triggered defense responses in the monocot maize and dicot soybean roots. Mol. Biol. Rep. 2011, 38, 3437–3446. [Google Scholar] [CrossRef] [PubMed]
- Fráterová, L.; Salaj, T.; Matušíková, I.; Salaj, J. The role of chitinases and glucanases in somatic embryogenesis of black pine and hybrid firs. Open Life Sci. 2013, 8, 1172–1182. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
- Hrmova, M.; MacGregor, E.A.; Biely, P.; Stewart, R.J.; Fincher, G.B. Substrate Binding and Catalytic Mechanism of a Barley β-d-Glucosidase/(1,4)-β-d-Glucan Exohydrolase. J. Biol. Chem. 1998, 273, 11134–11143. [Google Scholar] [CrossRef]
- De Bolle, M.F.C.; Goderis, I.J.; Terras, F.R.G.; Cammue, B.P.A.; Broekaert, W.F. A technique for detecting antifungal activity of proteins separated by polyacrylamide gel electrophoresis. Electrophoresis 1991, 12, 442–444. [Google Scholar] [CrossRef]
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef]
- Sambrook, J.; Russel, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Harlow, E., Lane, D., Eds.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001; Volume 1, pp. i–ix. [Google Scholar]
- Duan, Z.; Han, W.; Yan, L.; Wu, B. Reference gene selections for real time quantitative PCR analysis of gene expression in different oat tissues and under salt stress. Biol. Plant 2020, 64, 838–844. [Google Scholar] [CrossRef]
- Emamifar, S.; Abolmaali, S.; Mohsen Sohrabi, S.; Mohammadi, M.; Shahmohammadi, M. Molecular characterization and evaluation of the antibacterial activity of a plant defensin peptide derived from a gene of oat (Avena sativa L.). Phytochemistry 2021, 181, 112586. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Hammer, O.; Harper, D.A. Frontmatter. In Paleontological Data Analysis; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2005; pp. 1–10. [Google Scholar] [CrossRef]
- Aditya, J.; Lewis, J.; Shirley, N.J.; Tan, H.-T.; Henderson, M.; Fincher, G.B.; Burton, R.A.; Mather, D.E.; Tucker, M.R. The dynamics of cereal cyst nematode infection differ between susceptible and resistant barley cultivars and lead to changes in (1,3;1,4)-β-glucan levels and HvCslF gene transcript abundance. New Phytol. 2015, 207, 135–147. [Google Scholar] [CrossRef]
- Gibeaut, D.M.; Pauly, M.; Bacic, A.; Fincher, G.B. Changes in cell wall polysaccharides in developing barley (Hordeum vulgare) coleoptiles. Planta 2005, 221, 729–738. [Google Scholar] [CrossRef]
- Christensen, U.; Alonso-Simon, A.; Scheller, H.V.; Willats, W.G.T.; Harholt, J. Characterization of the primary cell walls of seedlings of Brachypodium distachyon–A potential model plant for temperate grasses. Phytochemistry 2010, 71, 62–69. [Google Scholar] [CrossRef]
- Trethewey, J.A.K.; Harris, P.J. Location of (1 → 3)- and (1 → 3),(1 → 4)-β-d-glucans in vegetative cell walls of barley (Hordeum vulgare) using immunogold labelling. New Phytol. 2002, 154, 347–358. [Google Scholar] [CrossRef]
- Hoson, T. Physiological functions of plant cell coverings. J. Plant Res. 2002, 115, 277–282. [Google Scholar] [CrossRef]
- Buckeridge, M.S.; Rayon, C.; Urbanowicz, B.; Tiné, M.A.S.; Carpita, N.C. Mixed Linkage (1→3),(1→4)-β-d-Glucans of Grasses. Cereal Chem. 2004, 81, 115–127. [Google Scholar] [CrossRef]
- Havrlentová, M.; Deáková, Ľ.; Kraic, J.; Žofajová, A. Can β-d-glucan protect oat seeds against a heat stress? Nova Biotechnol. Chim. 2016, 15, 107–113. [Google Scholar] [CrossRef]
- Walton, J.D. Deconstructing the cell wall. Plant Physiol. 1994, 104, 1113–1118. [Google Scholar] [CrossRef] [PubMed]
- Barghahn, S.; Arnal, G.; Jain, N.; Petutschnig, E.; Brumer, H.; Lipka, V. Mixed Linkage β-1,3/1,4-Glucan Oligosaccharides Induce Defense Responses in Hordeum vulgare and Arabidopsis thaliana. Front. Plant Sci. 2021, 12, 682439. [Google Scholar] [CrossRef] [PubMed]
- Bacete, L.; Melida, H.; Miedes, E.; Molina, A. Plant cell wall-mediated immunity: Cell wall changes trigger disease resistance responses. Plant J. 2018, 93, 614–636. [Google Scholar] [CrossRef] [PubMed]
- Saijo, Y.; Loo, E.P.; Yasuda, S. Pattern recognition receptors and signaling in plant–microbe interactions. Plant J. 2018, 93, 592–613. [Google Scholar] [CrossRef] [PubMed]
- Hou, S.; Liu, Z.; Shen, H.; Wu, D. Damage-associated molecular pattern-triggered immunity in plants. Front. Plant Sci. 2019, 10, 646. [Google Scholar] [CrossRef] [PubMed]
- Pontiggia, D.; Benedetti, M.; Costantini, S.; De Lorenzo, G.; Cervone, F. Dampening the DAMPs: How Plants Maintain the Homeostasis of Cell Wall Molecular Patterns and Avoid Hyper-Immunity. Front. Plant Sci. 2020, 11, 613259. [Google Scholar] [CrossRef]
- Ferrari, S.; Savatin, D.; Sicilia, F.; Gramegna, G.; Cervone, F.; De Lorenzo, G. Oligogalacturonides: Plant damage-associated molecular patterns and regulators of growth and development. Front. Plant Sci. 2013, 4, 49. [Google Scholar] [CrossRef]
- Benedetti, M.; Pontiggia, D.; Raggi, S.; Cheng, Z.; Scaloni, F.; Ferrari, S.; Ausubel, F.M.; Cervone, F.; De Lorenzo, G. Plant immunity triggered by engineered in vivo release of oligogalacturonides, damage-associated molecular patterns. Proc. Natl. Acad. Sci. USA 2015, 112, 5533–5538. [Google Scholar] [CrossRef]
- Yang, F.; Jacobsen, S.; Jørgensen, H.J.L.; Collinge, D.B.; Svensson, B.; Finnie, C. Fusarium graminearum and its interactions with cereal heads: Studies in the proteomics era. Front. Plant Sci. 2013, 4, 37. [Google Scholar] [CrossRef]
- Backes, A.; Charton, S.; Planchon, S.; Esmaeel, Q.; Sergeant, K.; Hausman, J.-F.; Renaut, J.; Barka, E.A.; Jacquard, C.; Guerriero, G. Gene expression and metabolite analysis in barley inoculated with net blotch fungus and plant growth-promoting rhizobacteria. Plant Physiol. Biochem. 2021, 168, 488–500. [Google Scholar] [CrossRef]
- Pilling, E.; Höfte, H. Feedback from the wall. Curr. Opin. Plant Biol. 2003, 6, 611–616. [Google Scholar] [CrossRef] [PubMed]
- Bart, R.S.; Chern, M.; Vega-Sánchez, M.E.; Canlas, P.; Ronald, P.C. Rice Snl6, a Cinnamoyl-CoA Reductase-Like Gene Family Member, is Required for NH1-Mediated Immunity to Xanthomonas oryzae pv. oryzae. PLoS Genet. 2010, 6, e1001123. [Google Scholar] [CrossRef]
- Seifert, G.J.; Blaukopf, C. Irritable Walls: The plant extracellular matrix and signaling. Plant Physiol. 2010, 153, 467–478. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, M.; Zhang, Y. Effects of powdery mildew infection on chloroplast and mitochondrial functions in rubber tree. Trop. Plant Pathol. 2014, 39, 242–250. [Google Scholar] [CrossRef]
- Carver, T.L.W.; Ingerson-Morris, S.M.; Thomas, B.J. Influences of host surface features on development of Erysiphe graminis and Erysiphe pisi. In Plant Cuticles—An Integrated Functional Approach; Kerstiens, G., Ed.; Bios Scientific Pub: Oxford, UK, 1996; pp. 255–266. [Google Scholar]
- Saja, D.; Janeczko, A.; Barna, B.; Skoczowski, A.; Dziurka, M.; Kornaś, A.; Gullner, G. Powdery mildew-induced hormonal and photosynthetic changes in barley near isogenic lines carrying various resistant genes. Int. J. Mol. Sci. 2020, 21, 4536. [Google Scholar] [CrossRef] [PubMed]
- Penuelas, J.; Filella, I.; Biel, C.; Serrano, L.; Savé, R. The reflectance at the 950–970 nm region as an indicator of plant water status. Int. J. Remote Sens. 1993, 14, 1887–1905. [Google Scholar] [CrossRef]
- Penuelas, J.; Filella, I.; Gamon, J.A. Assessment of photosynthetic radiation-use efficiency with spectral reflectance. New Phytol. 1995, 131, 291–296. [Google Scholar] [CrossRef]
- Carter, G.A.; Knapp, A.K. Leaf optical properties in higher plants: Linking spectral characteristics to stress and chlorophyll concentration. Am. J. Bot. 2001, 88, 677–684. [Google Scholar] [CrossRef]
- Walters, D.; Raynor, L.; Mitchell, A.; Walker, R.; Walker, K. Antifungal Activities of Four Fatty Acids against Plant Pathogenic Fungi. Mycopathologia 2004, 157, 87–90. [Google Scholar] [CrossRef]
- Kretschmer, M.; Damoo, D.; Djamei, A.; Kronstad, J. Chloroplasts and Plant Immunity: Where are the Fungal Effectors? Pathogens 2020, 9, 19. [Google Scholar] [CrossRef]
- Swarbrick, P.J.; Schultye-Lefert, P.; Scholes, J.D. Metabolic consequences of susceptibility and resistance (race-specific and broad-spectrum) in barley leaves challenged with powdery mildew. Plant Cell Environ. 2006, 29, 1061–1076. [Google Scholar] [CrossRef] [PubMed]
- Scharte, J.; Schon, H.; Wies, E. Photosynthesis and carbohydrate metabolism in tobacco leaves during an incompatible interaction with Phytophthora nicotianae. Plant Cell Environ. 2005, 28, 1421–1435. [Google Scholar] [CrossRef]
- Chen, Y.-E.; Cui, J.-M.; Su, Y.-Q.; Yuan, S.; Yuan, M.; Zhang, H.-Y. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage. Front. Plant Sci. 2015, 6, 779. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Zhong, S.; Zhang, M.; Liang, Y.; Gong, G.; Chang, X.; Tan, F.; Yang, H.; Qiu, X.; Luo, L.; et al. Potential Role of Photosynthesis in the Regulation of Reactive Oxygen Species and Defense Responses to Blumeria graminis f. sp. tritici in Wheat. Int. J. Mol. Sci. 2020, 21, 5767. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Luo, P. Changes in Photosynthesis Could Provide Important Insight into the Interaction between Wheat and Fungal Pathogens. Int. J. Mol. Sci. 2021, 22, 8865. [Google Scholar] [CrossRef] [PubMed]
- Fink, W.; Liefland, M.; Mendgen, K. Chitinases and β-1,3-glucanases in the apoplastic compartment of oat leaves (Avena sativa L.) 1. Plant Physiol. 1988, 88, 270–275. [Google Scholar] [CrossRef]
- Keen, N.T.; Yoshikawa, M. β-1,3-Endoglucanase from Soybean Releases Elicitor-Active Carbohydrates from Fungus Cell Walls. Plant Physiol. 1983, 71, 460–465. [Google Scholar] [CrossRef]
- Mauch, F.; Staehelin, L.A. Functional Implications of the Subcellular Localization of Ethylene-Induced Chitinase and [beta]-1,3-Glucanase in Bean Leaves. Plant Cell 1989, 1, 447–457. [Google Scholar] [CrossRef]
- Hrmova, M.; Fincher, G.B. Structure-function relationships of β- d-glucan endo- and exohydrolases from higher plants. Plant Mol. Biol. 2001, 47, 73–91. [Google Scholar] [CrossRef]
- Jutidamron-Gphan, W.; Andersen, J.; Mackinnon, G.; Manners, J.; Simpson, R.; Scott, K. Induction of B-1,3-Glucanase in Barley in Response to Infection by Fungal Pathogens. Mol. Plant Microbe Interact. 1991, 4, 234–238. [Google Scholar] [CrossRef]
- Gupta, P.; Ravi, I.; Sharma, V. Induction of β-1,3-glucanase and chitinase activity in the defense response of Eruca sativa plants against the fungal pathogen Alternaria brassicicola. J. Plant Inter. 2013, 8, 155–161. [Google Scholar] [CrossRef]
- Su, Y.; Wang, Z.; Liu, F.; Li, Z.; Peng, Q.; Guo, J.; Xu, L.; Que, Y. Isolation and Characterization of ScGluD2, a New Sugarcane beta-1,3-Glucanase D Family Gene Induced by Sporisorium scitamineum, ABA, H2O2, NaCl, and CdCl2 Stresses. Front. Plant Sci. 2016, 7, 1348. [Google Scholar] [CrossRef] [PubMed]
- Ellinger, D.; Naumann, M.; Falter, C.; Zwikowics, C.; Jamrow, T.; Manisseri, C.; Somerville, S.C.; Voigt, C.A. Elevated early callose deposition results in complete penetration resistance to powdery mildew in Arabidopsis. Plant Physiol. 2013, 161, 1433–1444. [Google Scholar] [CrossRef]
- Wang, Y.; Li, X.; Fan, B.; Zhu, C.; Chen, Z. Regulation and function of defense-related callose deposition in plants. Int. J. Mol. Sci. 2021, 22, 2393. [Google Scholar] [CrossRef]
- Zambryski, P.; Crawford, K. Plasmodesmata: Gatekeepers for Cell-to-Cell Transport of Developmental Signals in Plants. Annu. Rev. Cell Dev. Biol. 2000, 16, 393–421. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, J.; Henderson, M.; Schweizer, P.; Burton, R.A.; Fincher, G.B.; Little, A. Differential accumulation of callose, arabinoxylan and cellulose in nonpenetrated versus penetrated papillae on leaves of barley infected with Blumeria graminis f. sp. hordei. New Phytol. 2014, 204, 650–660. [Google Scholar] [CrossRef]
- Biely, P.; Markovič, O.; Mislovičová, D. Sensitive detection of endo-1, 4-β-glucanases and endo-1, 4-β-xylanases in gels. Anal. Biochem. 1985, 144, 147–151. [Google Scholar] [CrossRef]
- Côté, F.; Letarte, J.; Grenier, J.; Trudel, J.; Asselin, A. Detection of β- 1,3-glucanase activity after native polyacrylamide gel electrophoresis: Application to tobacco pathogenesis-related proteins. Electrophoresis 1989, 10, 527–529. [Google Scholar] [CrossRef]
- Pham, T.A.T.; Kyriacou, B.A.; Schwerdt, J.G.; Shirley, N.J.; Xing, X.; Bulone, V.; Little, A. Composition and biosynthetic machinery of the Blumeria graminis f. sp. hordei conidia cell wall. Cell Surf. 2019, 5, 100029. [Google Scholar] [CrossRef]
- Piršelová, B.; Matušíková, I. Callose: The plant cell wall polysaccharide with multiple biological functions. Acta Physiol. Plant. 2013, 35, 635–644. [Google Scholar] [CrossRef]










| Gene | Primer Sequence (5′→3′) | PCR Product Length (bp) | Tm (°C) |
|---|---|---|---|
| CslF6 | F: TTGCGCTCGGGATAATGG | 91 | 61 |
| R: TATACCGATGCTGTGGCAGC | |||
| CslF3 | F: CAATGTTGATCCGTCGGACC | 101 | 59 |
| R: TGCCAAGATAAGAGGGCCC | |||
| CslF9 | F: TTGCGCTCGGGATAATGG | 91 | 61 |
| R: TATACCGATGCTGTGGCAGC | |||
| EF-1A | F: CCAAGAGGCCCTCAGACAAG | 101 | 61 |
| R: CACTCCGGTCTCAACACGC |
| MW (kDa) | Aragon | Bay Yan 2 | Ivory | Vaclav | Racoon |
|---|---|---|---|---|---|
| 140 | present | n.d. | n.d. | n.d. | n.d. |
| 80 | present | present | present | present | present |
| 60 | present | present | present | present | present |
| 48 | 0.48 ± 0.08 * | 0.36 ± 0.05 * | 0.30 ± 0.15 * | 0.24 ± 0.05 * | 0.17 ± 0.03 * |
| 40 | 0.87 ± 0.14 | 3.08 ± 0.59 * | 0.87 ± 0.17 | 1.08 ± 0.22 | 0.63 ± 0.20 * |
| 35 | 1.65 ± 0.82 | 1.09 ± 0.20 | 4.45 ± 2.53 | 2.85 ± 1.25 | 1.68 ± 0.55 * |
| Isoform | Aragon | Bay Yan 2 | Ivory | Vaclav | Racoon |
|---|---|---|---|---|---|
| A1 | present | n.d. | n.d. | n.d. | present |
| A2 | n.d. | present | n.d. | n.d. | present |
| A3 | 6.16 ± 2.23 * | 13.71 ± 6.46 * | 3.97 ± 0.72 * | 9.16 ± 0.76 * | 17.94 ± 11.24 * |
| A4 | 2.58 ± 1.18 | 9.84 ± 4.45 * | 2.07 ± 0.67 | 8.86 ± 3.52 * | 7.00 ± 2.37 * |
| A5 | 1.44 ± 0.42 | 8.14 ± 2.89 * | present | present | present |
| A6 | 1.71 ± 0.34 * | 5.53 ± 2.35 * | 13.18 ± 6.22 * | 6.25 ± 3.72 * | 3.11 ± 1.23 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gregusová, V.; Kaňuková, Š.; Hudcovicová, M.; Bojnanská, K.; Ondreičková, K.; Piršelová, B.; Mészáros, P.; Lengyelová, L.; Galuščáková, Ľ.; Kubová, V.; et al. The Cell-Wall β-d-Glucan in Leaves of Oat (Avena sativa L.) Affected by Fungal Pathogen Blumeria graminis f. sp. avenae. Polymers 2022, 14, 3416. https://doi.org/10.3390/polym14163416
Gregusová V, Kaňuková Š, Hudcovicová M, Bojnanská K, Ondreičková K, Piršelová B, Mészáros P, Lengyelová L, Galuščáková Ľ, Kubová V, et al. The Cell-Wall β-d-Glucan in Leaves of Oat (Avena sativa L.) Affected by Fungal Pathogen Blumeria graminis f. sp. avenae. Polymers. 2022; 14(16):3416. https://doi.org/10.3390/polym14163416
Chicago/Turabian StyleGregusová, Veronika, Šarlota Kaňuková, Martina Hudcovicová, Katarína Bojnanská, Katarína Ondreičková, Beáta Piršelová, Patrik Mészáros, Libuša Lengyelová, Ľudmila Galuščáková, Veronika Kubová, and et al. 2022. "The Cell-Wall β-d-Glucan in Leaves of Oat (Avena sativa L.) Affected by Fungal Pathogen Blumeria graminis f. sp. avenae" Polymers 14, no. 16: 3416. https://doi.org/10.3390/polym14163416
APA StyleGregusová, V., Kaňuková, Š., Hudcovicová, M., Bojnanská, K., Ondreičková, K., Piršelová, B., Mészáros, P., Lengyelová, L., Galuščáková, Ľ., Kubová, V., Matušíková, I., Mihálik, D., Kraic, J., & Havrlentová, M. (2022). The Cell-Wall β-d-Glucan in Leaves of Oat (Avena sativa L.) Affected by Fungal Pathogen Blumeria graminis f. sp. avenae. Polymers, 14(16), 3416. https://doi.org/10.3390/polym14163416

