Electrohydrodynamic Jet 3D Printed Nerve Guide Conduits (NGCs) for Peripheral Nerve Injury Repair
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of PCL Solution
2.3. Fabrication of NGCs
2.4. Calculation of Theoretical and Experimental Porosity
2.5. Material Characterization
2.5.1. Scanning Electron Microscope
2.5.2. Raman Spectroscopy
2.5.3. Contact Angle Measurement
2.6. Mechanical Testing
2.7. Degradation Studies
2.7.1. Gravimetric Analysis
2.7.2. Mechanical Testing
2.7.3. Molecular Weight Determination
2.8. PC12 Cell Culture
2.9. Cell Proliferation Using PrestoBlue Assay
2.10. Reverse Transcription PCR (RT-PCR)
2.11. Immunocytochemistry
2.12. Statistical Analysis
3. Results
3.1. Design of Scaffolds with Different Pore Sizes
3.2. Effect of Input Voltage, Stage Speed, and Solution Feed Rate on the Scaffold Morphology
3.3. Material Characterization
3.4. Mechanical Testing
3.5. Degradation Studies
3.6. Calculation of Production Time
3.7. Cell Culture Studies
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Lim, E.-M.F.; Nakanishi, S.T.; Hoghooghi, V.; Eaton, S.E.; Palmer, A.L.; Frederick, A.; Stratton, J.A.; Stykel, M.G.; Whelan, P.J.; Zochodne, D.W. AlphaB-crystallin regulates remyelination after peripheral nerve injury. Proc. Natl. Acad. Sci. USA 2017, 114, E1701–E1716. [Google Scholar] [CrossRef] [PubMed]
- Sanen, K.; Martens, W.; Georgiou, M.; Ameloot, M.; Lambrichts, I.; Phillips, J. Engineered neural tissue with Schwann cell differentiated human dental pulp stem cells: Potential for peripheral nerve repair? J. Tissue Eng. Regen. Med. 2017, 11, 3362–3372. [Google Scholar] [CrossRef] [PubMed]
- Scheib, J.; Höke, A. Advances in peripheral nerve regeneration. Nat. Rev. Neurol. 2013, 9, 668. [Google Scholar] [CrossRef] [PubMed]
- Carriel, V.; Garzón, I.; Campos, A.; Cornelissen, M.; Alaminos, M. Differential expression of GAP-43 and neurofilament during peripheral nerve regeneration through bio-artificial conduits. J. Tissue Eng. Regen. Med. 2017, 11, 553–563. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Wang, Y.-L.; Kong, D.; Qu, B.; Su, X.-J.; Li, H.; Pi, H.-Y. Nerve autografts and tissue-engineered materials for the repair of peripheral nerve injuries: A 5-year bibliometric analysis. Neural Regen. Res. 2015, 10, 1003. [Google Scholar] [PubMed]
- Rinker, B.; Vyas, K.S. Clinical applications of autografts, conduits, and allografts in repair of nerve defects in the hand: Current guidelines. Clin. Plast. Surg. 2014, 41, 533–550. [Google Scholar] [CrossRef] [PubMed]
- Radtke, C.; Kocsis, J.D. Olfactory-ensheathing cell transplantation for peripheral nerve repair: Update on recent developments. Cells Tissues Organs 2014, 200, 48–58. [Google Scholar] [CrossRef] [PubMed]
- Ray, W.Z.; Mackinnon, S.E. Management of nerve gaps: Autografts, allografts, nerve transfers, and end-to-side neurorrhaphy. Exp. Neurol. 2010, 223, 77. [Google Scholar] [CrossRef] [PubMed]
- Boeckstyns, M.E.; Sørensen, A.I.; Viñeta, J.F.; Rosén, B.; Navarro, X.; Archibald, S.J.; Valss-Solé, J.; Moldovan, M.; Krarup, C. Collagen conduit versus microsurgical neurorrhaphy: 2-year follow-up of a prospective, blinded clinical and electrophysiological multicenter randomized, controlled trial. J. Hand Surg. 2013, 38, 2405–2411. [Google Scholar] [CrossRef] [PubMed]
- Santos, D.; Wieringa, P.; Moroni, L.; Navarro, X.; Valle, J.D. PEOT/PBT guides enhance nerve regeneration in long gap defects. Adv. Healthc. Mater. 2017, 6, 1600298. [Google Scholar] [CrossRef] [PubMed]
- Vijayavenkataraman, S.; Lu, W.; Fuh, J. 3D bioprinting–an ethical, legal and social aspects (ELSA) framework. Bioprinting 2016, 1, 11–21. [Google Scholar] [CrossRef]
- Vijayavenkataraman, S. A perspective on bioprinting ethics. Artif. Organs 2016, 40, 1033–1038. [Google Scholar] [CrossRef] [PubMed]
- Lundborg, G.; Gelberman, R.H.; Longo, F.M.; Powell, H.C.; Varon, S. In vivo regeneration of cut nerves encased in silicone tubes: Growth across a six-millimeter gap. J. Neuropathol. Exp. Neurol. 1982, 41, 412–422. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Zhang, C.; Wen, X. Fabrication of semipermeable hollow fiber membranes with highly aligned texture for nerve guidance. J. Biomed. Mater. Res. Part A 2005, 75, 941–949. [Google Scholar] [CrossRef] [PubMed]
- Ni, H.-C.; Tseng, T.-C.; Chen, J.-R.; Hsu, S.-H.; Chiu, M. Fabrication of bioactive conduits containing the fibroblast growth factor 1 and neural stem cells for peripheral nerve regeneration across a 15 mm critical gap. Biofabrication 2013, 5, 035010. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Mi, R.; Hoke, A.; Chew, S.Y. Nanofibrous nerve conduit-enhanced peripheral nerve regeneration. J. Tissue Eng. Regen. Med. 2014, 8, 377–385. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; MacEwan, M.R.; Liu, W.; Jesuraj, N.; Li, X.; Hunter, D.; Xia, Y. Nerve guidance conduits based on double-layered scaffolds of electrospun nanofibers for repairing the peripheral nervous system. ACS Appl. Mater. Interfaces 2014, 6, 9472–9480. [Google Scholar] [CrossRef] [PubMed]
- Oh, S.H.; Kim, J.H.; Song, K.S.; Jeon, B.H.; Yoon, J.H.; Seo, T.B.; Namgung, U.; Lee, I.W.; Lee, J.H. Peripheral nerve regeneration within an asymmetrically porous PLGA/Pluronic F127 nerve guide conduit. Biomaterials 2008, 29, 1601–1609. [Google Scholar] [CrossRef] [PubMed]
- Jeffries, E.M.; Wang, Y. Incorporation of parallel electrospun fibers for improved topographical guidance in 3D nerve guides. Biofabrication 2013, 5, 035015. [Google Scholar] [CrossRef] [PubMed]
- Koh, H.; Yong, T.; Teo, W.; Chan, C.; Puhaindran, M.; Tan, T.; Lim, A.; Lim, B.; Ramakrishna, S. In vivo study of novel nanofibrous intra-luminal guidance channels to promote nerve regeneration. J. Neural Eng. 2010, 7, 046003. [Google Scholar] [CrossRef] [PubMed]
- Quigley, A.; Bulluss, K.; Kyratzis, I.; Gilmore, K.; Mysore, T.; Schirmer, K.; Kennedy, E.; O’Shea, M.; Truong, Y.; Edwards, S. Engineering a multimodal nerve conduit for repair of injured peripheral nerve. J. Neural Eng. 2013, 10, 016008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tonda-Turo, C.; Audisio, C.; Gnavi, S.; Chiono, V.; Gentile, P.; Raimondo, S.; Geuna, S.; Perroteau, I.; Ciardelli, G. Porous poly (ε-caprolactone) nerve guide filled with porous gelatin matrix for nerve tissue engineering. Adv. Eng. Mater. 2011, 13, B151–B164. [Google Scholar] [CrossRef]
- Fregnan, F.; Ciglieri, E.; Tos, P.; Crosio, A.; Ciardelli, G.; Ruini, F.; Tonda-Turo, C.; Geuna, S.; Raimondo, S. Chitosan crosslinked flat scaffolds for peripheral nerve regeneration. Biomed. Mater. 2016, 11, 045010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Y.; De Laporte, L.; Rives, C.B.; Jang, J.-H.; Lin, W.-C.; Shull, K.R.; Shea, L.D. Neurotrophin releasing single and multiple lumen nerve conduits. J. Controll. Release 2005, 104, 433–446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, F.; Murugan, R.; Ramakrishna, S.; Wang, X.; Ma, Y.-X.; Wang, S. Fabrication of nano-structured porous PLLA scaffold intended for nerve tissue engineering. Biomaterials 2004, 25, 1891–1900. [Google Scholar] [CrossRef] [PubMed]
- Bozkurt, A.; Brook, G.A.; Moellers, S.; Lassner, F.; Sellhaus, B.; Weis, J.; Woeltje, M.; Tank, J.; Beckmann, C.; Fuchs, P. In vitro assessment of axonal growth using dorsal root ganglia explants in a novel three-dimensional collagen matrix. Tissue Eng. 2007, 13, 2971–2979. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Lim, S.H.; Mao, H.-Q.; Chew, S.Y. Current applications and future perspectives of artificial nerve conduits. Exp. Neurol. 2010, 223, 86–101. [Google Scholar] [CrossRef] [PubMed]
- Tonda-Turo, C.; Cipriani, E.; Gnavi, S.; Chiono, V.; Mattu, C.; Gentile, P.; Perroteau, I.; Zanetti, M.; Ciardelli, G. Crosslinked gelatin nanofibres: Preparation, characterisation and in vitro studies using glial-like cells. Mater. Sci. Eng. C 2013, 33, 2723–2735. [Google Scholar] [CrossRef] [PubMed]
- Panahi-Joo, Y.; Karkhaneh, A.; Nourinia, A.; Abd-Emami, B.; Negahdari, B.; Renaud, P.; Bonakdar, S. Design and fabrication of a nanofibrous polycaprolactone tubular nerve guide for peripheral nerve tissue engineering using a two-pole electrospinning system. Biomed. Mater. 2016, 11, 025017. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.B.; Mullins, M.E.; Cregg, J.M.; Hurtado, A.; Oudega, M.; Trombley, M.T.; Gilbert, R.J. Creation of highly aligned electrospun poly-l-lactic acid fibers for nerve regeneration applications. J. Neural Eng. 2008, 6, 016001. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Vijayavenkataraman, S.; Wang, D.; Jing, L.; Sun, J.; He, K. Influence of electrohydrodynamic jetting parameters on the morphology of PCL scaffolds. Int. J. Bioprint. 2017, 3, 72–82. [Google Scholar] [CrossRef]
- Wang, H.; Vijayavenkataraman, S.; Wu, Y.; Shu, Z.; Sun, J.; Fuh, J.Y.H. Investigation of process parameters of electrohydro-dynamic jetting for 3D printed PCL fibrous scaffolds with complex geometries. Int. J. Bioprint. 2016, 2, 63–71. [Google Scholar] [CrossRef]
- Vijayavenkataraman, S.; Zhang, S.; Lu, W.F.; Fuh, J.Y.H. Electrohydrodynamic-jetting (EHD-jet) 3D-printed functionally graded scaffolds for tissue engineering applications. J. Mater. Res. 2018, 1–13. [Google Scholar] [CrossRef]
- Wesełucha-Birczyńska, A.; Świętek, M.; Sołtysiak, E.; Galiński, P.; Piekara, K.; Błażewicz, M. Raman spectroscopy and the material study of nanocomposite membranes from poly (ε-caprolactone) with biocompatibility testing in osteoblast-like cells. Analyst 2015, 140, 2311–2320. [Google Scholar] [CrossRef] [PubMed]
- Murphy, C.M.; O’Brien, F.J. Understanding the effect of mean pore size on cell activity in collagen-glycosaminoglycan scaffolds. Cell Adhes. Migr. 2010, 4, 377–381. [Google Scholar] [CrossRef] [Green Version]
- Lackington, W.A.; Ryan, A.J.; O’Brien, F.J. Advances in nerve guidance conduit-based therapeutics for peripheral nerve repair. ACS Biomater. Sci. Eng. 2017, 3, 1221–1235. [Google Scholar] [CrossRef]
- Woodruff, M.A.; Hutmacher, D.W. The return of a forgotten polymer—polycaprolactone in the 21st century. Prog. Polym. Sci. 2010, 35, 1217–1256. [Google Scholar] [CrossRef] [Green Version]
- Vijayavenkataraman, S.; Shuo, Z.; Fuh, J.Y.; Lu, W.F. Design of three-dimensional scaffolds with tunable matrix stiffness for directing stem cell lineage specification: An in silico study. Bioengineering 2017, 4, 66. [Google Scholar] [CrossRef] [PubMed]
- Kehoe, S.; Zhang, X.; Boyd, D. FDA approved guidance conduits and wraps for peripheral nerve injury: A review of materials and efficacy. Injury 2012, 43, 553–572. [Google Scholar] [CrossRef] [PubMed]
- Dash, T.K.; Konkimalla, V.B. Poly-є-caprolactone based formulations for drug delivery and tissue engineering: A review. J. Controll. Release 2012, 158, 15–33. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Choi, K.H.; Ghim, H.D.; Kim, S.S.; Chun, D.H.; Kim, H.Y.; Lyoo, W.S. Role of molecular weight of atactic poly (vinyl alcohol) (PVA) in the structure and properties of PVA nanofabric prepared by electrospinning. J. Appl. Polym. Sci. 2004, 93, 1638–1646. [Google Scholar] [CrossRef]
- Zargham, S.; Bazgir, S.; Tavakoli, A.; Rashidi, A.S.; Damerchely, R. The effect of flow rate on morphology and deposition area of electrospun nylon 6 nanofiber. J. Eng. Fabr. Fibers (JEFF) 2012, 7, 42–49. [Google Scholar]
- Chiono, V.; Tonda-Turo, C. Trends in the design of nerve guidance channels in peripheral nerve tissue engineering. Prog. Neurobiol. 2015, 131, 87–104. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Peter, S.J.; Lyman, M.D.; Lai, H.-L.; Leite, S.M.; Tamada, J.A.; Vacanti, J.P.; Langer, R.; Mikos, A.G. In vitro degradation of porous poly (l-lactic acid) foams. Biomaterials 2000, 21, 1595–1605. [Google Scholar] [CrossRef]
- Odelius, K.; Höglund, A.; Kumar, S.; Hakkarainen, M.; Ghosh, A.K.; Bhatnagar, N.; Albertsson, A.-C. Porosity and pore size regulate the degradation product profile of polylactide. Biomacromolecules 2011, 12, 1250–1258. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Ding, J. Effects of porosity and pore size on in vitro degradation of three-dimensional porous poly (d,l-lactide-co-glycolide) scaffolds for tissue engineering. J. Biomed. Mater. Res. Part A 2005, 75, 767–777. [Google Scholar] [CrossRef] [PubMed]
- Loh, Q.L.; Choong, C. Three-dimensional scaffolds for tissue engineering applications: Role of porosity and pore size. Tissue Eng. Part B Rev. 2013, 19, 485–502. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Matthew, H.W.; Wooley, P.H.; Yang, S.Y. Effect of porosity and pore size on microstructures and mechanical properties of poly-ε-caprolactone-hydroxyapatite composites. J. Biomed. Mater. Res. Part B Appl. Biomater. 2008, 86, 541–547. [Google Scholar] [CrossRef] [PubMed]
- Karageorgiou, V.; Kaplan, D. Porosity of 3D biomaterial scaffolds and osteogenesis. Biomaterials 2005, 26, 5474–5491. [Google Scholar] [CrossRef] [PubMed]
- Kokai, L.E.; Lin, Y.-C.; Oyster, N.M.; Marra, K.G. Diffusion of soluble factors through degradable polymer nerve guides: Controlling manufacturing parameters. Acta Biomater. 2009, 5, 2540–2550. [Google Scholar] [CrossRef] [PubMed]
- Nectow, A.R.; Marra, K.G.; Kaplan, D.L. Biomaterials for the development of peripheral nerve guidance conduits. Tissue Eng. Part B Rev. 2011, 18, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Dumont, C.E.; Born, W. Stimulation of neurite outgrowth in a human nerve scaffold designed for peripheral nerve reconstruction. J. Biomed. Mater. Res. Part B Appl. Biomater. 2005, 73, 194–202. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Zhang, Q.; Shi, M.; Zhang, Y.; Tao, W.; Li, M. Effect of pore size on the biodegradation rate of silk fibroin scaffolds. Adv. Mater. Sci. Eng. 2015, 2015. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.; Niehaus, A.; Nichols, S.; Lee, D.; Koepsel, J.; Anderson, D.; Lannutti, J. Electrospun PCL in vitro: A microstructural basis for mechanical property changes. J. Biomater. Sci. Polym. Ed. 2009, 20, 467–481. [Google Scholar] [CrossRef] [PubMed]
- Bölgen, N.; Menceloğlu, Y.Z.; Acatay, K.; Vargel, I.; Pişkin, E. In vitro and in vivo degradation of non-woven materials made of poly (ε-caprolactone) nanofibers prepared by electrospinning under different conditions. J. Biomater. Sci. Polym. Ed. 2005, 16, 1537–1555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grinsell, D.; Keating, C. Peripheral nerve reconstruction after injury: A review of clinical and experimental therapies. BioMed Res. Int. 2014, 2014. [Google Scholar] [CrossRef] [PubMed]
- Pfister, B.J.; Gordon, T.; Loverde, J.R.; Kochar, A.S.; Mackinnon, S.E.; Cullen, D.K. Biomedical engineering strategies for peripheral nerve repair: Surgical applications, state of the art, and future challenges. Crit. Rev.™ Biomed. Eng. 2011, 39, 81–124. [Google Scholar] [CrossRef]
Fabrication Technologies | Limitations |
---|---|
Solvent Casting | Highly toxic solvent, poor interconnectivity, irregularly shaped pores, low porosity (<50%) |
Gas Foaming | Poor interconnectivity, external surface is non-porous |
Phase Separation | Limited only to specific polymers |
Freeze Drying | Irregularly shaped pores |
Melt moulding | Presence of residual porogen particles, high processing temperatures |
Electrospinning | Fibres produced are random and highly disordered; lacks repeatability and customizability |
Gene | Primers | Length |
---|---|---|
GAPDH | Forward 5′ CGTGGAGTCTACTGGCGTCTTC 3′ Reverse 5′GGGAGTTGTCATATTTCTCGTGGTT 3′ | 22 25 |
β3 tubulin | Forward 5′CAGATGCTGGCCATTCAGAGTAAG 3′ Reverse 5′ TGTTGCCGATGAAGGTGGAC 3′ | 24 20 |
Neurofilament-Heavy chain | Forward 5′AAGGAAACCGTCATTGTAGAGGAA 3′ Reverse 5′ GGAGACGTAGTTGCTGCTTCTT 3′ | 24 22 |
GAP-43 | Forward 5′ CCGACAGGATGAGGGTAAAG 3′ Reverse 5′ GCAGGAGAGACAGGGTTC 3′ | 20 18 |
Raman Bands (cm−1) | Assignments |
---|---|
921 | ν(C–COO); crystalline |
1069 | ν(COC); crystalline |
1113 | ν(COC); crystalline |
1308 | ω(CH2); crystalline & amorphous |
1445 | δ(CH2); crystalline |
1725 | ν(C=O); crystalline |
2916 | Antisymmetric C–H stretching ν(CH2)asym |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vijayavenkataraman, S.; Zhang, S.; Thaharah, S.; Sriram, G.; Lu, W.F.; Fuh, J.Y.H. Electrohydrodynamic Jet 3D Printed Nerve Guide Conduits (NGCs) for Peripheral Nerve Injury Repair. Polymers 2018, 10, 753. https://doi.org/10.3390/polym10070753
Vijayavenkataraman S, Zhang S, Thaharah S, Sriram G, Lu WF, Fuh JYH. Electrohydrodynamic Jet 3D Printed Nerve Guide Conduits (NGCs) for Peripheral Nerve Injury Repair. Polymers. 2018; 10(7):753. https://doi.org/10.3390/polym10070753
Chicago/Turabian StyleVijayavenkataraman, Sanjairaj, Shuo Zhang, Siti Thaharah, Gopu Sriram, Wen Feng Lu, and Jerry Ying Hsi Fuh. 2018. "Electrohydrodynamic Jet 3D Printed Nerve Guide Conduits (NGCs) for Peripheral Nerve Injury Repair" Polymers 10, no. 7: 753. https://doi.org/10.3390/polym10070753
APA StyleVijayavenkataraman, S., Zhang, S., Thaharah, S., Sriram, G., Lu, W. F., & Fuh, J. Y. H. (2018). Electrohydrodynamic Jet 3D Printed Nerve Guide Conduits (NGCs) for Peripheral Nerve Injury Repair. Polymers, 10(7), 753. https://doi.org/10.3390/polym10070753