Next Article in Journal
Effect of Laser Power on the Microstructure and Corrosion Resistance of NiCrBSi(Nb) Laser Clad Coatings
Previous Article in Journal
Lithium Niobate Thin Film on Silicon Fabricated by Pulsed Laser Deposition
Previous Article in Special Issue
Update of Natural Compounds in Transthyretin Amyloidosis, Years 2020–2025
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Crystals
Volume 15
Issue 9
10.3390/cryst15090758
crystals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

13b-K and Nirmatrelvir Resistance Mutations of SARS-CoV-2 Main Protease: Structural, Biochemical, and Biophysical Characterization of Free Enzymes and Inhibitor Complexes

by
Haifa El Kilani
1,2,*,†,
Xinyuanyuan Sun
1,†,
Mohamed Fouad Ibrahim
1,
Ute Curth
3 and
Rolf Hilgenfeld
1,2
1
Institute of Molecular Medicine, University of Lübeck, 23562 Lübeck, Germany
2
German Center for Infection Research (DZIF), Hamburg-Lübeck-Borstel-Riems Site, University of Lübeck, 23562 Lübeck, Germany
3
Institute for Biophysical Chemistry, Hannover Medical School, 30625 Hannover, Germany
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Crystals 2025, 15(9), 758; https://doi.org/10.3390/cryst15090758
Submission received: 22 July 2025 / Revised: 14 August 2025 / Accepted: 21 August 2025 / Published: 27 August 2025
(This article belongs to the Collection Feature Papers in Biomolecular Crystals)
Browse Figures
Versions Notes

Abstract

The SARS-CoV-2 main protease (Mpro) is a well-established target for antiviral drug development One such inhibitor, nirmatrelvir, in combination with ritonavir as a booster, has already been introduced into the market, under the name Paxlovid. However, being an RNA virus, SARS-CoV-2 is prone to the emergence of resistance mutations. A number of such mutations have been characterized, although they have not yet been shown to play a significant role in clinical settings; these include S144A, E166V, H172Y, and Q189K. We recombinantly produced these mutants and studied the corresponding proteins using X-ray crystallography, enzymology, and biophysical approaches. We discuss the potential of each mutant to lead to a widespread nirmatrelvir resistance scenario. We also demonstrate that one of our own inhibitors (13b-K), while showing some degree of cross-resistance with nirmatrelvir, exhibits much higher inhibitory activity against the Mpro carrying the E166V mutation.

1. Introduction

The outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in Wuhan in early 2020 [1] triggered intensive global research efforts, seeking to develop effective vaccines or drug candidates for the prevention or treatment of COVID-19.
The RNA-dependent RNA polymerase (RdRp), nonstructural protein 5 (Nsp5), and the main protease (Mpro, also called 3C-like protease, 3CLpro) are the most important targets for drug design against SARS-CoV-2 [2]. All three enzymes are relatively conserved among coronaviruses and play a crucial role in the viral life cycle [3,4].
Mpro is a homodimeric cysteine protease; each monomer comprises three domains, domains I, II, and III (residues 8–101, 102–184, and 201–306, respectively) [5,6,7]. Domains I and II contain the catalytic site (His41/Cys145) of the enzyme and the most conserved and essential residues for substrate binding, His41, Phe140, Ser144, Cys145, His163, Glu166, and His172. These residues contribute to the strong binding of the substrate to the S1-S4 specificity sites and to the dimerization of the protein, via essential hydrogen bonds and salt bridges from one monomer to the N-terminal residues of the adjacent monomer (“N-finger”; most importantly, Ser1 of the adjacent monomer (Ser1*)). As the substrate enters the substrate-binding pocket, the scissile peptide bond of P1′/P1 is nucleophilically attacked by the thiolate of Cys145, resulting in the formation of a tetrahedral transition state. This hemithioketal intermediate is stabilized by the oxyanion hole, which is formed by the backbone amide NH groups of Gly143, Ser144, and Cys145. The stabilization of this transition state lowers the activation energy of the reaction.
In 2021, the Food and Drug Administration of the United States (FDA) [8] provisionally authorized three antiviral drugs for the treatment of mild-to-moderate COVID-19 [2]: remdesivir [9,10] and molnupiravir [11,12,13], which target the RdRp, and Paxlovid [14], which targets the Mpro. Paxlovid is a combination of the Mpro inhibitor nirmatrelvir and the FDA-approved HIV protease inhibitor ritonavir. In this combination, ritonavir is used as a booster to slow down the metabolization of nirmatrelvir by the human liver cytochrome P450 3A4 (CYP3A4) [14].
Treatment with Paxlovid has been reported to show very good clinical efficacy compared to treatment with placebos, lowering the rates of hospitalization and death by 89% [15].
The genome sequences of naturally occurring nirmatrelvir-resistant SARS-CoV-2 variants, such as those encoding Mpro mutants H172Y, E166V, Q189K, and S144A, have been deposited in the Global Initiative on Sharing Avian Influenza Data (GISAID) database [16]. Although these mutants have only been detected at very low frequencies (35–200 viruses; data as of 7 July 2025), several biochemical studies [17,18,19] have reported a reduction in the inhibitory activity of nirmatrelvir due to these drug resistance mutations.
To investigate the effects of these mutations on Mpro conformation and inhibitor binding, we determined the crystal structures of the H172Y, E166V, Q189K, and S144A Mpro free enzymes and their complexes with our α-ketoamide Mpro inhibitor 13b-K [20,21], as well as with nirmatrelvir.

2. Materials and Methods

2.1. Compound Synthesis

PF-07321332 (nirmatrelvir) was custom-synthesized by Tocris (Bio-Techne, Wiesbaden, Germany), following the protocol in [20].

2.2. Cloning and Recombinant Protein Production

A gene encoding the SARS-CoV-2 main protease (Mpro wild type, GenBank reference: MN908947.3 (ORF1ab polyprotein residues 3264–3569)) with E. coli codon usage was produced by MWG Eurofins. The amplified DNA fragment was digested with the restriction enzymes BamHI and XhoI and then ligated into the plasmid pGEX-6P-1. The E166V-SARS-CoV-2 Mpro point mutation was generated by Phusion site-directed mutagenesis PCR (SDM). The PCR reaction solutions were mixed with the Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific, Waltham, MA, USA), using 5′ pre-phosphorylated primers (E166V-forward ATGCACCACATGGTGTTGCCGACTG and E166V-reverse ATAGCAGAAGCTAACGCAATCGTAG).
The H172Y, Q189K, and S144A mutations were inserted by overlap extension–PCR reaction. A pair of unique primers—H172Y_forward (ACTGGTGTATATGCCGGGACGGACT), H172Y_reverse (AGTCCGTCCCGGCATATACACCAGT); Q189K_forward (TTGTCGATCGCAAAACAGCCCAA), Q189K_reverse (TTGGGCTGTTTTGCGATCGACAA); and S144A_forward (TTCCTTAATGGCGCGTGTGGTTCGGT). S144A_reverse (ACCGAACCACACGCGCCATTAAGGAA)—was designed. The first PCR reaction was performed to generate two splice fragments containing a 5′ overhang. The WT Mpro coding gene with BamHI and XhoI sites was amplified from the Mpro construct described previously [1] and was used as a template. The second PCR joined these two spliced fragments in order to generate the PCR product encoding the H172Y, Q189K, and S144A mutated Mpros, including the cleavage sites of the restriction enzymes for cloning into the vector pGEX-6p-1 (GE Healthcare, Chicago, IL, USA). The amplified PCR product was digested with BamHI and XhoI and ligated into the vector pGEX-6p-1 digested with the same restriction enzymes. The gene sequence of the Mpro was verified by sequencing (MWG Eurofins, Ebersberg, Germany).
For recombinant protein production, the SARS-CoV-2 Mpro PGEx6p-1 plasmid was transformed into BL21 (DE3) competent cells and the protein was produced as described before [20].

2.3. Determination of Protein Stability of SARS-CoV-2 Mpro WT, H172Y, E166V, Q189K, and S144A Using Nano-Differential Scanning Fluorimetry (nanoDSF)

Thermal shift assays of the SARS-CoV-2 Mpro WT and the mutants were carried out using the nanoDSF method as implemented in Prometheus NT.48 (NanoTemper Technologies, Munich, Germany). The nanoDSF method is based on the autofluorescence of tryptophan (and tyrosine) residues to monitor protein unfolding. When the temperature increases, the protein will unfold and the hydrophobic residues of the protein are exposed; the ratio of autofluorescence at wavelengths 330 nm and 350 nm will change. The first derivative of 350/330 nm can be used to determine the melting temperature (Tm). Here, 30 µM of the WT or mutant protein was diluted in a final volume of 15 µL reaction buffer containing 20 mM HEPES pH7.0, 120 mM NaCl, 0.4 mM EDTA, 4 mM DTT, and 20% glycerol. Proteins were then loaded onto Prometheus NT.48 nanoDSF-grade standard capillaries (PR-C002, NanoTemper Technologies), and the fluorescence signal was recorded under a temperature gradient ranging from 25 to 90 °C (incremental steps of 0.5 °C min−1). The melting temperature (Tm) was calculated as the mid-point temperature of the melting curve using the PR ThermControl software 2.3.1 (NanoTemper Technologies, Munich, Germany). The melting curve was drawn using the GraphPad Prism 7.0 software; the values of the first derivative of 350/330 nm were displayed on the Y axis.

2.4. Enzyme Activity Assays

The experiment was performed as mentioned before in [22].
A fluorescent substrate harboring the cleavage site (indicated by ↓) of the SARS-CoV-2 Mpro (Dabcyl-KTSAVLQ↓SGFRKM-E(Edans)-NH2; Biosyntan, Berlin, Germany) and a buffer composed of 20 mM HEPES, 120 mM NaCl, 0.4 mM EDTA, 4 mM DTT, 20% glycerol, and 1% DMSO, pH 7.0, was used for the inhibition assay. In the fluorescence resonance energy transfer (FRET)-based cleavage assay, the fluorescence signal of the Edans generated due to the cleavage of the substrate by the Mpro was monitored, using an Flx800 fluorescence spectrophotometer (BioTek, Santa Clara, CA, USA), at an emission wavelength of 460 nm with excitation at 360 nm. Initially, 10 µL of the SARS-CoV-2 Mpro WT at a final concentration of 50 nM, H172Y at 400 nM, E166V at 500 nM, Q189K at 300 nM, and S144A at 100 nM were pipetted into a 96-well plate containing 60 µL of pre-pipetted reaction buffer. Then, 30 µL of the substrate at varying concentrations (10, 20, 40, 80, 120, 160, 240, 320 µM), dissolved in the reaction buffer, was added to reach a final volume of 100 µL. The measurements were taken over 45 min.
A calibration curve was generated by the measurement of varied concentrations (from 0.04 to 6250 nM) of free Edans, with a gain of 80 in a final volume of 100 µL reaction buffer. Initial velocities were determined from the linear section of the curve, and the corresponding relative fluorescence units per unit of time (∆RFU/s) was converted to the amount of cleaved substrate per unit of time (µM/s) by fitting to the calibration curve of free Edans.
Inner-filter effect corrections were applied for the kinetic measurements according to Liu et al. [23].
As saturation could be achieved, kinetic constants (Vmax and Km) were derived by fitting the corrected initial velocity to the Michaelis–Menten equation, V = V max × [S]/(Km + [S]), using the GraphPad Prism 7.0 software. kcat/Km was calculated according to the equation, kcat/Km = Vmax/([E] × Km). Triplicate experiments were performed for each data point, and the value was presented as the mean ± standard deviation (SD).

2.5. Inhibitory Activity Determination of WT-Mpro and Mpro Mutants in Complex with 13b-K and Nirmatrelvir

Inhibition assays of the SARS-CoV-2 Mpro against 13b-K or nirmatrelvir were performed using different inhibitor concentrations from 0 to 100 µM (0, 0.000063, 0.00019, 0.00056, 0.0017, 0.005, 0.015, 0.045, 0.1, 0.4, 1.2, 3.7, 11, 33, 100). The measurement time was 15 min.
First, 10 µL of enzyme (50 nM final enzyme concentration for WT, 400 nM for H172Y, 500 nM for E166V, 300 nM for Q189K, and 100 nM for S144A) was initially pipetted into a 96-well plate containing 59 μL of the reaction buffer (20 mM HEPES pH 7.0, 120 mM NaCl, 0.4 mM EDTA, 20% glycerol, 4 mM DTT). Subsequently, the corresponding concentration of the compound was added in drops with the Mpro and reaction buffer, and the inhibitor–Mpro mixture was incubated at 37 °C for 10 min.
Finally, the reaction was initiated by adding 30 μL of the FRET substrate (Dabcyl-KTSAVLQ↓SGFRKM-E(Edans)-NH2; Biosyntan, Berlin, Germany) dissolved in the reaction buffer. The reaction was monitored at 37 °C for 45 min using a spectrofluorometer, namely the Tecan Spark (Tecan Group Ltd., Männedorf, Switzerland), at an emission/excitation wavelength of 460/360 nm.
Measurements of enzymatic activity were performed in triplicate and the value was presented as the mean ± standard deviation (SD). The initial velocity of the enzymatic reaction with the compounds was adjusted using inner-filter effect corrections and calculated by linear regression for the first minute of the progression curve. Inhibition rates were obtained as (1 − (Vmax/V0)) × 100%. Inhibition constants Ki were calculated using the Morrison equation.

2.6. Analytical Ultracentrifugation

Sedimentation velocity runs were carried out in analytical ultracentrifuges, i.e., Optima AUC or ProteomeLab XL-I (Beckman Coulter, Brea, CA, USA), using An-50 Ti rotors at 50,000 rpm and 20 °C. Concentration profiles were measured with the absorption scanning optics at 230 nm using 3 or 12 mm standard double-sector centerpieces filled with 100 μL or 400 μL sample, respectively. Experiments were performed in a buffer containing 0.12 M NaCl, 20 mM HEPES pH 7.0, 10% (v/v) glycerol, 0.2 mM EDTA, and 1 mM TCEP in a concentration range of 0.25 to 10 µM SARS-CoV-2 Mpro. After dilution, samples were allowed to equilibrate for at least 4 h at 20 °C prior to sedimentation analysis. To investigate the influence of nirmatrelvir or 13b-K on the monomer–dimer equilibrium of SARS-CoV-2 Mpro mutants, proteins were diluted in the presence of 12 µM of the respective inhibitor.
For data analysis, a model for diffusion-deconvoluted differential sedimentation coefficient distributions (continuous c(s) distributions) implemented in the program SEDFIT [24] was used. The buffer density and viscosity and partial specific volumes were calculated from the buffer and amino acid compositions, respectively, with the program SEDNTERP [25] and were used to correct the experimental s-values to s20,w. Signal-weighted average s-values, sw, were obtained by integration of the c(s) distributions in the s-value range where monomers and dimers were observed using the program GUSSI [26]. Monomer–dimer equilibrium dissociation constants, Kd, were determined by fitting a monomer–dimer self-association model to the sw isotherms using the program SEDPHAT [27]. As the dissociation of the H172Y mutant was incomplete, the sedimentation coefficient of the monomer was set to the value obtained for the E166V mutant (2.7 S), as determined by the fitting of the sw isotherm. Figures showing the c(s) distributions were obtained with the program GUSSI.
Protein concentrations were determined spectrophotometrically using the absorption coefficients at 280 nm as calculated from the amino acid composition [28] and are given in monomers throughout the text.

2.7. Crystallization and Diffraction Data Collection of WT Mpro Free Enzymes and in Complex with Nirmatrelvir and 13b-K

The purified SARS-CoV-2 Mpro proteins were concentrated to 14 mg/mL. For the complexes with nirmatrelvir and 13b-K, the proteins were then incubated overnight with a 5-fold molar excess of inhibitor, and the mixture was incubated overnight at 4 °C.
After being centrifuged at 13,000 rpm to remove precipitates, the supernatants of the free enzyme and the protein-compound mixture were then subjected to co-crystallization screening with commercially available kits (PACT premierTM HT-96, Morpheus and LFS Screen from Molecular Dimensions, Rotherham, UK), using an Art Robbins Instruments robot and the vapor diffusion sitting drop method at 20 °C.
Diffraction data from the free enzymes H172Y, E166V, Q189K, and S144A-Mpro were collected from crystals grown under the conditions of LSF No.-F7 (0.1 M bis-tris propane pH 6.5, 0.2 M sodium acetate trihydrate, 20% w/v PEG 3350, 10% v/v ethylene glycol) for H172Y, LFS No.-F4 (0.1 M bis-tris propane pH 6.5, 0.2 M potassium thiocyanate, 20% w/v PEG 3350, 10% v/v ethylene glycol) for E166V, PACT No.-F6 (0.2 M sodium formate, 0.1 M bis-tris propane pH 6.5, 20% w/v PEG 3350) for Q189K, and LFS No.-F10 (0.1M bis-tris propane pH 6.50, 0.2 M sodium potassium phosphate pH 7.5, 20% w/v PEG 3350, 10% v/v ethylene glycol) for S144A.
Diffraction data from the H172Y, E166V, Q189K, and S144A Mpros in complex with 13b-K were collected from crystals grown under the conditions of LSF No.-H11 (0.1M bis-tris propane pH 8.5, 0.2 M potassium citrate tribasic monohydrate, 20% w/v PEG 3350, 10% v/v ethylene glycol) for H172Y, PACT No.-D8 (0.2M ammonium chloride, 0.1M tris pH 8.0, 20% w/v PEG 6000) for E166V, PACT No.-C5 (0.1M PCTP, pH 8.0, 25% w/v PEG 1500) for Q189K, and Morpheus No.-E5 (0.1M sodium HEPES, MOPS pH 7.5, 0.12 M ethylene glycol, 40% v/v PEG 500 MME, 20% w/v PEG 20000) for S144A.
Diffraction data from the H172Y, E166V, Q189K, and S144A Mpros in complex with nirmatrelvir were collected from crystals grown under the conditions of PACT No.-D5 (0.1M MMT 8.025% w/v PEG 1500) for H172Y and PACT No.-E11 (0.2 M sodium citrate tribasic dihydrate, 20% w/v PEG 3350) for Q189K. Crystals were then cryo-protected using 20% glycerol.
Fished crystals were flash-cooled using liquid nitrogen. Diffraction data were collected at 100 K at DESY PETRA III beamline P11 (Hamburg, Germany) using a Pilatus 6M detector (Dectris) and with synchrotron radiation at a wavelength of 1.0332 Å.

2.8. Diffraction Data Processing, Structure Solution, and Refinement

The programs XDSapp [29], Pointless [30,31], and Scala [30,31] were used for dataset processing, with Molrep [31,32] to solve the phase problem via the molecular replacement method using the SARS-CoV-2 Mpro free enzyme (PDB code: 6Y2E), SARS-CoV-2 Mpro in complex with nirmatrelvir (PDB code: 7vh8), and SARS-CoV-2 Mpro in complex with 13b-K (PDB code: 6Y2G) as search models. All compounds were built into Fo-Fc difference densities using the Coot software 0.9.8.91 [33] and structures were refined using the Refmac5 program [34]. All graphical illustrations and RMSD values were calculated using PyMOL 4.6 [35].
Diffraction data and model refinement statistics are displayed in Tables S1 and S2.

3. Results

The crystal structures of the H172Y-, E166V-, S144A-, and Q189K-SARS-CoV-2 Mpro free enzyme mutants and in complex with 13b-K were determined at resolutions ranging from 1.69 to 2.20 Å. In addition, the crystal structures of the H172Y- and Q189K-SARS-CoV-2 Mpro in complex with nirmatrelvir (PF-07321332) were also determined at 2.7 and 1.68 Å resolutions, respectively (Tables S2 and S3) [36,37,38].
In total, we determined 10 crystal structures of Mpro mutants as free enzymes or in complex with 13b-K or nirmatrelvir. The crystal structures displayed one of four space groups (see Tables S2 and S3), with either two Mpro protomers (one dimer) in the asymmetric unit of the crystal (space groups P212121 or P21) or one Mpro protomer (half a dimer) in the asymmetric unit (space groups C2 or P21212).
The crystal structures of the wild-type (WT, Wuhan-Hu-1 strain (NC_045512.2)) Mpro free enzyme [20] (PDB: 6Y2E), the WT Mpro in complex with 13b-K (PDB: 6Y2G), and the WT Mpro in complex with nirmatrelvir [14] (PDB: 7VH8) were used for structural comparisons.
We also used sedimentation velocity analysis by analytical ultracentrifugation (AUC) in order to investigate the influence of the four naturally occurring point mutations on the dimer stability of the SARS-CoV-2 Mpro and the influence of 13b-K and nirmatrelvir on dimerization.
In the presence of a 1 mM concentration of the reductant tris (2-carboxyethyl) phosphine (TCEP), the WT Mpro forms stable dimers, which only start to slightly dissociate at a concentration of 0.25 µM (Figure S1a). Unfortunately, lower Mpro concentrations are not accessible with the absorbance optics of the AUC. Therefore, the dissociation constant (Kd) has to be significantly lower than 0.25 µM. In an earlier study, we found that, in the absence of a reductant, the Mpro dimer was much less stable, with a Kd of about 2.5 µM [1]. This significant difference in dimer stability is due to the redox regulation of the Mpro involving a disulfide bond between the catalytic cysteine and a proximal cysteine, as well as an allosteric SONOS bridge [39]. Since we were interested in the oligomerization state of the active enzyme, all experiments in this study were performed under reducing conditions.

3.1. Activity of Mutants, Stability of Proteins, and Influence of Inhibitors on Their Activity

The H172Y mutant was first characterized. Its thermal stability was evaluated using nano-differential scanning fluorimetry (nanoDSF) to determine the melting temperature (Tm) of the protein. A marked decrease in Tm was observed (see Table 1 and Figure S2), indicating the compromised stability of the Mpro due to this mutation. More than a 4 °C decrease in the Tm value for the mutant free enzyme was observed, in comparison to the WT Mpro free enzyme (57.5 °C for WT_free vs. 53.4 °C for H172Y_free). Even more pronounced reductions in thermal stability were observed in inhibitor-bound forms, with drastic decreases (10–15 °C) in the Tm values for the H172Y–nirmatrelvir and H172Y–13b-K complexes compared to their WT counterparts (74.0 °C and 67.5 °C for WT vs. 58.5 °C and 57.7 °C for H172Y, respectively). In addition to reduced stability, the catalytic efficiency and inhibitor sensitivity of the H172Y mutant were also found to be reduced. Only ~16% of the enzymatic activity of the WT Mpro remained (kcat/Km = 5355.26 ± 1447.83 M−1·s−1 for WT vs. kcat/Km = 863.34 ± 380.32 M−1·s−1 for H172Y; see Table 1 and Figure 1. Based on the IC50 values, the H172Y mutant displayed increased resistance to both 13b-K and nirmatrelvir, with resistance factors of 4.7 and 23.4, respectively (see Table 1 and Figure 2).
After the substitution of Glu166 with Val, the enzyme activity decreased by more than 84% (kcat/Km = 860.28 ± 361.93 M−1·s−1). Compared to the WT, the E166V mutant is 2.8-fold more resistant to 13b-K and exhibits exceptionally high 410.0-fold resistance to nirmatrelvir (see Table 1 and Figure 1 and Figure 2). The stability of the enzyme in complex with nirmatrelvir is more affected by the E166V mutation (~17 °C decrease in the melting temperature, Tm) compared to the complex with 13b-K (~8 °C decrease in the Tm value). However, only a slight reduction in the Tm value is observed for the free E166V enzyme (~2 °C) (see Table 1 and Figure S2, in Supplementary Materials).
For the Q189K mutant, a decrease in the enzymatic activity of the free enzyme is observed (more than 67% of the enzymatic activity is lost (kcat/Km =1736.16 ± 533.05 M−1·s−1)). However, the stability of the Mpro is not affected (Tm values of Q189K are comparable to the WT values; see Table 1).
Confirming Pfizer’s report for healthcare providers [8] (FDA, 2021), S144A has slightly reduced enzymatic activity (kcat/Km = 4983.46 ± 1700.84 M−1·s−1) compared to the WT (kcat/Km = 5355.26 ± 1447.83 M−1·s−1). About 93% of the wild-type activity is preserved (Table 1 and Figure 2). Based on the Tm values of the S144A mutant (58 °C for the free enzyme, 62.8 °C for the complex with 13b-K, and 66.4 °C for the complex with nirmatrelvir), we conclude that the stability of the S144A free enzyme is not affected compared to the WT free enzyme (57.5 °C). However, the S144A complexes with 13b-K and nirmatrelvir show significant decreases in their Tm values (67.5 °C for the WT in complex with 13b-K and 74 °C for the WT in complex with nirmatrelvir) (Table 1 and Figure S2).

3.2. Stability of Protein Dimers in Sedimentation Velocity Experiments

AUC experiments reveal the lower stability of the H172Y Mpro dimer compared to the WT Mpro (see Figure 3c and Figure S1b,d). The H172Y mutant dissociates partially in the concentration range investigated. Kd values below 0.25 µM for the WT and of about 0.3 µM for H172Y were estimated from the sw isotherms. For the WT Mpro and the H172Y Mpro mutant, we address the question of whether the 13b-K and nirmatrelvir inhibitors influence the stability of the dimer. A concentration of 12 µM of either inhibitor has a significant stabilizing effect on both protein complexes (Figure S1c,d and Figure 4a–d). Both the WT and the H172Y mutant no longer show any tendency to dissociate, even at a concentration of 0.25 µM. A possible difference in the stabilizing effects of 13b-K and nirmatrelvir on the dimer stability of the WT or the H172Y mutant could not be determined, since neither protein showed any dissociation in the presence of either inhibitor in the concentration range studied.
The sedimentation velocity analyses show that the dimer of E166V Mpro is even less stable than that of H172Y (see Figure 3c,d and Figure S1b,e). The Mpro E166V dimer dissociates significantly even in the presence of 1 mM TCEP. In contrast to the dissociation observed for the WT in the absence of a reductant, in the case of E166V and H172Y, the reaction seems to be fast relative to the time scale of sedimentation in the presence of TCEP. This can be seen from the fact that, in the c(s) distributions, the peak position gradually increases with the protein concentration [40]. For the E166V dimer, a Kd value of about 3 µM can be determined from the fit of the sw isotherm. A concentration of 12 µM of nirmatrelvir or 13b-K has a stabilizing effect on the E166V mutant (Figure S1e). Interestingly, 13b-K stabilizes the E166V dimer even more strongly than nirmatrelvir (see Figure S1e and Figure 4e,f).
Confirming the stability study, the sedimentation velocity analysis reveals that Q189K forms stable dimers in the presence of 1 mM TCEP, even without an inhibitor, showing that the Q189K mutation does not significantly influence the monomer–dimer equilibrium (Figure 3a). The S144A mutation slightly destabilizes the Mpro dimer. However, this effect is less pronounced than that seen with the H172Y mutant (Figure S1b and Figure 3b).

3.3. Structural Analysis

3.3.1. H172Y-SARS-CoV-2 Mpro

The overall structural alignment of the WT enzyme with the mutant reveals root mean square (r.m.s.) deviations of 0.3 Å, 0.3 Å, and 0.5 Å for the Cα positions in the free Mpro in complex with 13b-K and in complex with nirmatrelvir, respectively (Figure 5 show the 2D structure of nirmatrelvir and nitrile 13b-K).
These r.m.s. differences are only slightly above the typical experimental errors associated with crystal structure determinations, indicating that the overall backbone conformation remains largely conserved despite the H172Y mutation.
Although the overall backbone conformation remains largely unchanged, the structural element most affected by the displacement involves residues 1–4 (Ser1, Gly2, Phe3, Arg4) (Figure 6A,B). These residues are part of the N-finger, which is critical for dimer formation [6]. In the H172Y mutant, displacement of the Ser1 backbone results in an increased distance (>5.3 Å) between the backbone carbonyl oxygen of Phe140 and the amino group of Ser1* from the adjacent protomer. This disrupts the hydrogen bond typically observed between the carbonyl of Phe140 and Ser1* in the WT Mpro (2.6–2.8 Å), which plays a key role in stabilizing the Mpro homodimer.
Notable structural differences are observed in the oxyanion hole of the H172Y mutant. In the free enzyme, the backbone atoms of the two key residues forming the oxyanion hole, Gly143 and Cys145, are displaced by approximately 0.7–0.8 Å relative to the WT Mpro. This local perturbation is influenced by the broader displacement of residues 19–94, with a root mean square deviation (r.m.s.d.) of 0.54 Å in the H172Y free enzyme structure.
In both the 13b-K and nirmatrelvir complex structures, the H172Y mutation results in the loss of several key hydrogen bonds and intermolecular contacts that are preserved in the wild-type enzyme. Specifically, interactions between Glu166 Oε1/Oε2 and Ser1* Oγ (~2.6 Å), Gly138 N and His172 Nδ1 (~3.1 Å), and His172 Nε2 and Glu166 Oε1/Oε2 (~2.9 Å) are no longer observed in the mutant, consistent across the free enzyme and both inhibitor-bound structures. However, the H-bond between His172 Nε2 and Glu166 Oε1/Oε2 is only present in chain A (not in chain B) for the wild-type complex with 13b-K. The H-bond between His172 Nε2 and Ser1* O ~3.0 Å is lost only in chain B for the complex with 13b-K. The distance between the amide nitrogen of the P1-lactam moiety and the carbonyl oxygen of Phe140 becomes larger for the complex with 13b-K (from 3.0 Å in the WT to 3.7 Å in the mutant) but not in the complex with nirmatrelvir (Figure 7C,D).

3.3.2. E166V-SARS-CoV-2 Mpro

In contrast to H172Y, no relevant backbone displacement of the N-finger is found for the E166V mutation. However, an examination of the E166V-SARS-CoV-2 Mpro structure in complex with 13b-K shows the displacement of the backbone of a series of residues from Glu46 to His80 (r.m.s. displacement of about 0.8 Å compared to the WT), from Asn214 to Thr224 (0.5 Å), and from Gln273 to Thr280 (0.6 Å). All these residues are situated at the protein surface (Figure 6C,D).
The strong binding of inhibitors in the S1 binding side of the Mpro enzyme requires a series of interactions between the P1 ɣ-lactam of the inhibitor and four different amino acid residues (His163, Glu166, His 172, and Ser1*).
A series of H-bonds (between Glu166 Oε2 and Ser1* N, 2.6 Å; between His172 Nε2 and Glu166 Oε2, 2.9 Å; between Phe140 O and the nitrogen of the P1-lactam moiety, 3.0 Å; and between Glu166 Oε2 and the nitrogen of the P1-lactam moiety, 3.1 Å) are totally lost. This leads to an increased distance between the carbonyl oxygen of the P1 ɣ-lactam and the His163 Nε2 (from ~2.6–2.8 to ~3.3 Å), possibly leading to the decreased binding affinity of the P1 moiety of the inhibitor.
However, two new contacts between Ser1* Oγ and Gly170 O (2.9 Å) in the free enzyme and between the nitrogen of the P1 ɣ-lactam and Ser1* Oγ (3.3 Å) in the complex with 13b-K are formed (Figure 7G).
Interestingly, after the nucleophilic attack on the 13b-K Cα by the thiol of Cys145, the oxygen atom of the P1′ benzyl group (originally pointing into the oxyanion hole in the SARS-CoV-2 Mpro wild type in complex with 13b-K) points away from the oxyanion hole, resulting in the loss of two strong H-bonds to Ser144 N (2.9 Å) and Cys145 N (2.5 Å) and forming a new H-bond with His41 (2.6 Å). Due to the change in configuration of the chiral carbon bearing the hydroxyl group, from S to R, the oxygen atom of the P1 γ-lactam points into the oxyanion hole, losing the H-bond with His41 NE2 and forming three new H-bonds with Gly 143 N (3.3 Å), Ser 144 N (3.5 Å), and Cys145 N (3.1 Å).

3.3.3. Q189K-SARS-CoV-2 Mpro

Upon superimposing the wild type with the mutant structures, overall RMSD values of 0.5 Å, 0.3 Å, and 0.4 Å for the free enzyme, the complex with nirmatrelvir, and the complex with 13b-K, respectively, are obtained (Figure 6E,F).
The Q189K mutation leads to the displacement of a number of residues from His41 to Ser81, from Met165 to Thr198, and from Phe220 to Ser301 in the free enzyme. However, no significant displacement for the enzyme in complex with 13b-K and nirmatrelvir is observed.
The displacement of the most conserved amino acid residues, Glu166 and His172 (with an RMSD value of 0.8 Å), explains the drastic decrease in the enzymatic activity of the free Q189K enzyme.
Moreover, the H-bond between Glu166 Oε1/Oε2 and H172 Nε2 (~2.9 Å) is lost in Q189K in complex with 13b-K, but not in the free Q189K enzyme or in complex with nirmatrelvir. No new interactions created by the newly introduced Lys189 were observed (Figure 7E,F).

3.3.4. S144A-SARS-CoV-2 Mpro

The polypeptide regions most affected by the backbone displacement in the free enzyme comprise Ser1–Arg4 (from the N-finger), Met165–Val171, Gln192–Asp197, and Arg298 to the C-terminus (Figure 6G,H).
An examination of the S144A Mpro structure in complex with 13b-K shows that chain B is more affected by the displacement compared to chain A. The displacement of the backbone of a series of residues from Ile59 to Pro96 (~0.3 Å RMSD compared to the WT), from Ile213 to Phe230 (~0.4 Å RMSD), and from Gly251 to Thr280 (~0.4 Å RMSD) in chain B is observed. Interestingly, all these displaced residues are situated at the protein surface.
Due to the mutation, the weak interaction between Ser144 Oγ and the oxygen of the P1′ moiety (~3.7 Å) is lost. Furthermore, the H-bond between Ser144 Oγ and Leu141 O (~2.6–2.7 Å) in the free enzyme and the complex with 13b-K is lost, explaining the small decrease in the enzymatic activity (Figure 7H).

4. Discussion

We characterized the nirmatrelvir-resistant Mpro mutants H172Y, E166V, Q189K, and S144A in terms of enzyme kinetics and by biophysical as well as crystallographic methods. In addition, we tested our own Mpro inhibitor 13b-K against these mutant Mpro enzymes. Sedimentation velocity characterization of the Mpro WT and all four mutants was carried out using analytical ultracentrifugation (AUC).
The AUC results show that, while the Q189K mutation does not affect the stability of the Mpro dimer, increasing dissociation is observed for the S144A, H172Y, and E166V mutants (see Figure 3 and Figure S1). From the obtained sedimentation coefficient distributions, signal-weighted average s-values (sw) have been determined at each protein concentration. For the least stable mutants, H172Y and E166V, the resulting binding isotherms were used to fit a monomer–dimer self-association model to the data and yielded Kd values of 0.3 µM and 3 µM, respectively (Figure S1b).
According to the nanoDSF results, 13b-K stabilizes the E166V even more strongly than nirmatrelvir (see Figure S2). The melting curves show that the stability of the Mpro dimer decreases in the following order: WT = Q189K > S144A > H172Y > E166V.
Consistent with previously reported results (Lewandowski and Tan) [41], our data demonstrate that the free enzyme S144A exhibits comparable enzyme activity to the free WT enzyme.
One might suppose that the structural difference between histidine and tyrosine is not large, but, in fact, the structural consequences of the H172Y mutation are significant. The hydroxyl group of Tyr172 introduces a new, relatively weak hydrogen-bonding interaction with the backbone amide of Phe140 (with a distance of 3.0 Å; Figure 4c). Clayton et al.’s MD simulation data suggested significant disruption in the S1 pocket interactions with the N-terminus due to the mutation [22]. Our X-ray structures of the H172Y free enzyme and H172Y in complex with nirmatrelvir confirm this suggestion.
The Mpro’s thermal stability is strongly reduced by the H172Y and E166V mutations, even upon inhibitor binding. The melting temperatures of the enzyme–inhibitor complexes decrease significantly compared to the WT. Four H-bonds are lost for both mutants, and the resistance against nirmatrelvir is very high compared to the WT, Q189K, and S144A enzyme–inhibitor complexes (IC50 values about 23.4-fold for H172Y and 410.0-fold for E166V in complex with nirmatrelvir, compared to the WT enzyme–nirmatrelvir complex). Glu166 forms three H-bonds with nirmatrelvir and four H-bonds with 13b-K. The E166V mutation eliminates the interactions with the gamma-lactam moiety, which is crucial for inhibitor binding [42]. We determined also the structure of E166V in complex with nirmatrelvir (data not shown); however, the occupancy of the inhibitor is too low (about 0.5), confirming the high resistance of the SARS-CoV-2 E166V mutant against nirmatrelvir and the low potency of the inhibitor against the mutant. The higher Tm value of the complex, compared to the free enzyme, confirms the relative binding of nirmatrelvir to the enzyme, albeit with low occupancy.
Our own inhibitor, 13b-K, shows cross-resistance with nirmatrelvir against all four mutations, with IC50 values increased 2.8–4.7-fold. However, S144A’s resistance is less pronounced against nirmatrelvir than 13b-K, whereas H172Y, E166V, and Q189K show greater resistance to nirmatrelvir than to 13b-K.
The structural and biochemical analysis indicates that H172Y and E166V display severe disturbances of the Mpro homodimer formation and therefore highly reduced catalytic activity. In contrast, Q189K and S144A display relatively undisturbed three-dimensional structures and retain much of their catalytic activity while showing significant nirmatrelvir resistance. Accordingly, it can be assumed that these two mutations pose a higher threat should they spread in the population.
In order to overcome drug resistance and reduce the duration of treatment, Li et al. [2] suggested the development of dual- or triple-drug combinations for COVID-19 treatment. This treatment is a combination of a protease inhibitor and a polymerase inhibitor with a pharmacokinetic booster. Previous studies on HIV and HCV treatments based on multiple-drug combinations were very successful in preventing the development of resistance [43,44].

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cryst15090758/s1. 1. Figure S1: Dimer stability and the influence of nirmatrelvir and 13b-K on dimerization; 2. Table S1: Summary of the important existing, lost and newly formed contacts and hydrogen bonds due to the mutations; 3. Figure S2: Melting curves; 4. Table S2: Diffraction data and model refinement statistics of H172Y and E166V mutants; 5. Table S3: Diffraction data and model refinement statistics of H172Y and E166V mutants.

Author Contributions

Conceptualization, H.E.K. and R.H.; Formal analysis, H.E.K., X.S., M.F.I. and U.C.; Funding acquisition, H.E.K. and R.H.; Investigation, H.E.K., X.S., M.F.I., U.C. and R.H.; Project administration, H.E.K. and R.H.; Resources, U.C. and R.H.; Supervision, H.E.K. and R.H.; Validation, H.E.K., U.C. and R.H.; Visualization, H.E.K., X.S., M.F.I. and U.C.; Writing—original draft, H.E.K.; Writing—review and editing, H.E.K., X.S., U.C. and R.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the German Center for Infection Research (DZIF): FF 01.905 and TTU 01.810. The Beckman Coulter Optima AUC was funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation)—INST 192/534-1 FUGG.

Acknowledgments

This work is dedicated to Rolf Hilgenfeld, whose scientific expertise and intellectual contributions were crucial to this project. His scientific rigor and collaborative spirit left a lasting impression on all who had the privilege of working with him. We thank Lidia Litz for the excellent technical assistance.. Diffraction data were collected using beamline P11 at PETRA III, DESY, Hamburg.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wu, F.; Zhao, S.; Yu, B.; Chen, Y.M.; Wang, W.; Song, Z.G.; Hu, Y.; Tao, Z.W.; Tian, J.H.; Pei, Y.Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [PubMed]
  2. Li, G.; Hilgenfeld, R.; Whitley, R.; De Clercq, E. Therapeutic strategies for COVID-19: Progress and lessons learned. Nat. Rev. Drug Discov. 2023, 22, 449–475. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  3. Chan, A.P.; Choi, Y.; Schork, N.J. Conserved genomic terminals of SARS-CoV-2 as coevolving functional elements and potential therapeutic targets. mSphere 2020, 5, e00754-20. [Google Scholar] [CrossRef] [PubMed]
  4. V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
  5. Yang, H.; Yang, M.; Ding, Y.; Liu, Y.; Lou, Z.; Zhou, Z.; Sun, L.; Mo, L.; Ye, S.; Pang, H.; et al. The Crystal Structures of Severe Acute Respiratory Syndrome Virus Main Protease and Its Complex with an Inhibitor. Proc. Natl. Acad. Sci. USA 2003, 100, 13190–13195. [Google Scholar] [CrossRef]
  6. Tan, J.; Verschueren, K.H.; Anand, K.; Shen, J.; Yang, M.; Xu, Y.; Rao, Z.; Bigalke, J.; Heisen, B.; Mesters, J.R.; et al. pH-dependent conformational flexibility of the SARS-CoV main proteinase (M(pro)) dimer: Molecular dynamics simulations and multiple X-ray structure analyses. J. Mol. Biol. 2005, 354, 25–40. [Google Scholar] [CrossRef]
  7. Anand, K.; Palm, G.J.; Mesters, J.R.; Siddell, S.G.; Ziebuhr, J.; Hilgenfeld, R. Structure of coronavirus main proteinase reveals combination of a chymotrypsin fold with an extra alpha-helical domain. EMBO J. 2002, 21, 3213–3224. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  8. US Food and Drug Administration (FDA): Emergency Use Authorization for Paxlovid. 2021. Available online: https://www.fda.gov/media/155050/download (accessed on 26 June 2023).
  9. Beigel, J.H.; Tomashek, K.M.; Dodd, L.E.; Mehta, A.K.; Zingman, B.S.; Kalil, A.C.; Hohmann, E.; Chu, H.Y.; Luetkemeyer, A.; Kline, S.; et al. Remdesivir for the treatment of COVID-19—Final report. N. Engl. J. Med. 2020, 383, 1813–1826. [Google Scholar] [CrossRef]
  10. Gottlieb, R.L.; Vaca, C.E.; Paredes, R.; Mera, J.; Webb, B.J.; Perez, G.; Oguchi, G.; Ryan, P.; Nielsen, B.U.; Brown, M.; et al. Early remdesivir to prevent progression to severe Covid-19 in outpatients. N. Engl. J. Med. 2022, 386, 305–315. [Google Scholar] [CrossRef]
  11. Fischer, W.A., 2nd; Eron, J.J., Jr.; Holman, W.; Cohen, M.S.; Fang, L.; Szewczyk, L.J.; Sheahan, T.P.; Baric, R.; Mollan, K.R.; Wolfe, C.R.; et al. A phase 2a clinical trial of molnupiravir in patients with COVID-19 shows accelerated SARS-CoV-2 RNA clearance and elimination of infectious virus. Sci. Transl. Med. 2022, 14, eabl7430. [Google Scholar]
  12. Painter, W.P.; Holman, W.; Bush, J.A.; Almazedi, F.; Malik, H.; Eraut, N.C.J.E.; Morin, M.J.; Szewczyk, L.J.; Painter, G.R. Human safety, tolerability, and pharmacokinetics of molnupiravir, a novel broad-spectrum oral antiviral agent with activity against SARS-CoV-2. Antimicrob. Agents Chemother. 2021, 65, e02428-20. [Google Scholar] [CrossRef] [PubMed]
  13. Jayk Bernal, A.; Gomes da Silva, M.M.; Musungaie, D.B.; Kovalchuk, E.; Gonzalez, A.; Delos Reyes, V.; Martín-Quirós, A.; Caraco, Y.; Williams-Diaz, A.; Brown, M.L.; et al. Molnupiravir for oral treatment of COVID-19 in nonhospitalized patients. N. Engl. J. Med. 2022, 386, 509–520. [Google Scholar] [CrossRef] [PubMed]
  14. Owen, D.R.; Allerton, C.M.N.; Anderson, A.S.; Aschenbrenner, L.; Avery, M.; Berritt, S.; Boras, B.; Cardin, R.D.; Carlo, A.; Coffman, K.J.; et al. An oral SARS-CoV-2 M(pro) inhibitor clinical candidate for the treatment of COVID-19. Science 2021, 374, 1586–1593. [Google Scholar] [CrossRef] [PubMed]
  15. Hammond, J.; Leister-Tebbe, H.; Gardner, A.; Abreu, P.; Bao, W.; Wisemandle, W.; Baniecki, M.; Hendrick, V.M.; Damle, B.; Simón-Campos, A.; et al. Oral nirmatrelvir for high-risk, nonhospitalized adults with COVID-19. N. Engl. J. Med. 2022, 386, 1397–1408. [Google Scholar] [CrossRef]
  16. Elbe, S.; Buckland-Merrett, G. Data, Disease and Diplomacy: GISAID’s Innovative Contribution to Global Health. Glob. Chall. 2017, 1, 33–46. [Google Scholar] [CrossRef]
  17. Iketani, S.; Mohri, H.; Culbertson, B.; Hong, S.J.; Duan, Y.; Luck, M.I.; Annavajhala, M.K.; Guo, Y.; Sheng, Z.; Uhlemann, A.C.; et al. Multiple pathways for SARS-CoV-2 resistance to nirmatrelvir. Nature 2023, 613, 558–564. [Google Scholar] [CrossRef]
  18. Greasley, S.E.; Noell, S.; Plotnikova, O.; Ferre, R.; Liu, W.; Bolanos, B.; Fennell, K.; Nicki, J.; Craig, T.; Zhu, Y.; et al. Structural Basis for the in Vitro Efficacy of Nirmatrelvir against SARS-CoV-2 Variants. J. Biol. Chem. 2022, 298, 101972. [Google Scholar] [CrossRef]
  19. Ullrich, S.; Ekanayake, K.B.; Otting, G.; Nitsche, C. Main Protease Mutants of SARS-CoV-2 Variants Remain Susceptible to Nirmatrelvir. Bioorg. Med. Chem. Lett. 2022, 62, 128629. [Google Scholar] [CrossRef]
  20. Zhang, L.; Lin, D.; Sun, X.; Curth, U.; Drosten, C.; Sauerhering, L.; Becker, S.; Rox, K.; Hilgenfeld, R. Crystal structure of SARS-CoV-2 main protease provides a basis for design of improved α-ketoamide inhibitors. Science 2020, 368, 409–412. [Google Scholar] [CrossRef]
  21. Cooper, M.S.; Zhang, L.; Ibrahim, M.; Zhang, K.; Sun, X.; Röske, J.; Göhl, M.; Brönstrup, M.; Cowell, J.K.; Sauerhering, L.; et al. Diastereomeric Resolution Yields Highly Potent Inhibitor of SARS-CoV-2 Main Protease. J. Med. Chem. 2022, 65, 13328–13342. [Google Scholar] [CrossRef]
  22. Clayton, J.; de Oliveira, V.M.; Ibrahim, M.F.; Sun, X.; Mahinthichaichan, P.; Shen, M.; Hilgenfeld, R.; Shen, J. Integrative Approach to Dissect the Drug Resistance Mechanism of the H172Y Mutation of SARS-CoV-2 Main Protease. J. Chem. Inf. Model. 2023, 63, 3521–3533. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  23. Liu, Y.; Kati, W.; Chen, C.M.; Tripathi, R.; Molla, A.; Kohlbrenner, W. Use of a fluorescence plate reader for measuring kinetic parameters with inner filter effect correction. Anal. Biochem. 1999, 267, 331–335. [Google Scholar] [CrossRef] [PubMed]
  24. Schuck, P. Size-Distribution Analysis of Macromolecules by Sedimentation Velocity Ultracentrifugation and Lamm Equation Modeling. Biophys. J. 2000, 78, 1606–1619. [Google Scholar] [CrossRef] [PubMed]
  25. Laue, M.T.; Shah, B.D.; Rigdeway, T.M.; Pelletier, S.L. Computer-Aided Interpretation of Analytical Sedimentation Data for Proteins. In Analytical Ultracentrifugation in Biochemistry and Polymer Science; Harding, S.E., Horton, J.C., Rowe, A.J., Eds.; Royal Society of Chemistry: Cambridge, UK, 1992; pp. 90–125. [Google Scholar]
  26. Brautigam, C.A. Calculations and Publication-Quality Illustrations for Analytical Ultracentrifugation Data. Methods Enzym. 2015, 562, 109–133. [Google Scholar]
  27. Zhao, H.; Schuck, P. Combining Biophysical Methods for the Analysis of Protein Complex Stoichiometry and Affinity in SEDPHAT. Acta Crystallogr. D Biol. Crystallogr. 2015, 71, 3–14. [Google Scholar] [CrossRef]
  28. Pace, C.N.; Vajdos, F.; Fee, L.; Grimsley, G.; Gray, T. How to Measure and Predict the Molar Absorption Coefficient of a Protein. Protein Sci. 1995, 4, 2411–2423. [Google Scholar] [CrossRef]
  29. Krug, M.; Weiss, M.S.; Heinemann, U.; Mueller, U. XDSAPP: A graphical user interface for the convenient processing of diffraction data using XDS. J. Appl. Crystallogr. 2012, 45, 568–572. [Google Scholar] [CrossRef]
  30. Evans, P. Scaling and assessment of data quality. Acta Crystallogr. D Biol. Crystallogr. 2006, 62, 72–82. [Google Scholar] [CrossRef]
  31. Winn, M.D.; Ballard, C.C.; Cowtan, K.D.; Dodson, E.J.; Emsley, P.; Evans, P.R.; Keegan, R.M.; Krissinel, E.B.; Leslie, A.G.W.; McCoy, A.; et al. Overview of the CCP4 suite and current developments. Acta Crystallogr. D Biol. Crystallogr. 2011, 67, 235–242. [Google Scholar] [CrossRef]
  32. Vagin, A.; Teplyakov, A. Molecular replacement with MOLREP. Acta Crystallogr. D Biol. Crystallogr. 2010, 66, 22–25. [Google Scholar] [CrossRef]
  33. Emsley, P.; Lohkamp, B.; Scott, W.G.; Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 2010, 66, 486–501. [Google Scholar] [CrossRef]
  34. Murshudov, G.N.; Skubák, P.; Lebedev, A.A.; Pannu, N.S.; Steiner, R.A.; Nicholls, R.A.; Winn, M.D.; Long, F.; Vagin, A.A. REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr. D Biol. Crystallogr. 2011, 67, 355–367. [Google Scholar] [CrossRef]
  35. Schrödinger, L.; DeLano, W. PyMOL. 2020. Available online: http://www.pymol.org/pymol (accessed on 2 March 2020).
  36. Weiss, M.S.; Hilgenfeld, R. On the use of the merging R factor as a quality indicator for X-ray data. J. Appl. Cryst. 1997, 30, 203–205. [Google Scholar] [CrossRef]
  37. Karplus, P.A.; Diederichs, K. Linking crystallographic model and data quality. Science 2012, 336, 1030–1033. [Google Scholar] [CrossRef]
  38. Chen, V.B.; Arendall, W.B.; Headd, J.J.; Keedy, D.A.; Immormino, R.M.; Kapral, G.J.; Murray, L.W.; Richardson, J.S.; Rich-ardson, D.C. MolProbity: All-atom structure validation for macromolecular crystallography. Acta Crystallogr. D Biol. Crystallogr. 2010, 66, 12–21. [Google Scholar] [CrossRef] [PubMed]
  39. Funk, L.M.; Poschmann, G.; Rabe von Pappenheim, F.; Chari, A.; Stegmann, K.M.; Dickmanns, A.; Wensien, M.; Eulig, N.; Paknia, E.; Heyne, G.; et al. Multiple redox switches of the SARS-CoV-2 main protease in vitro provide opportunities for drug design. Nat. Commun. 2024, 15, 411. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  40. Brown, P.H.; Balbo, A.; Schuck, P. Characterizing protein-protein interactions by sedimentation velocity analytical ultracentrifugation. Curr. Protoc. Immunol. 2008, 18, 18.15.1–18.15.39. [Google Scholar] [CrossRef]
  41. Hu, Y.; Lewandowski, E.M.; Tan, H.; Zhang, X.; Morgan, R.T.; Zhang, X.; Jacobs, L.M.C.; Butler, S.G.; Gongora, M.V.; Choy, J.; et al. Naturally Occurring Mutations of SARS-CoV-2 Main Protease Confer Drug Resistance to Nirmatrelvir. ACS Cent. Sci. 2023, 9, 1658–1669. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  42. Jochmans, D.; Liu, C.; Donckers, K.; Stoycheva, A.; Boland, S.; Stevens, S.K.; De Vita, C.; Vanmechelen, B.; Maes, P.; Trüeb, B.; et al. The Substitutions L50F, E166A, and L167F in SARS-CoV-2 3CLpro Are Selected by a Protease Inhibitor In Vitro and Confer Resistance To Nirmatrelvir. mBio 2023, 14, e02815-22. [Google Scholar] [CrossRef]
  43. Jiang, S.; Lin, K.; Strick, N.; Neurath, A.R. HIV-1 inhibition by a peptide. Nature 1993, 365, 113. [Google Scholar] [CrossRef]
  44. Ghosh, A.K.; Osswald, H.L.; Prato, G. Recent progress in the development of HIV-1 protease inhibitors for the treatment of HIV/AIDS. J. Med. Chem. 2016, 59, 5172–5208. [Google Scholar] [CrossRef] [PubMed]
Crystals 15 00758 g001
Figure 1. Reaction rate vs. substrate concentration using the FRET assay for 50 nM SARS-CoV-2 Mpro WT, 400 nM H172Y, 500 nM E166V, 300 nM Q189K, and 100 nM S144A.
Figure 1. Reaction rate vs. substrate concentration using the FRET assay for 50 nM SARS-CoV-2 Mpro WT, 400 nM H172Y, 500 nM E166V, 300 nM Q189K, and 100 nM S144A.
Crystals 15 00758 g001
Crystals 15 00758 g002
Figure 2. Inhibition rates of nirmatrelvir and 13b-K against SARS-CoV-2 Mpro WT, H172Y, E166V, Q189K, and S144A. Inhibition rate vs. Log[I], where [I] is the concentration of the inhibitor. (a) Illustrate the Inhibition of Nirmatrelvir against Mpro and (b) Illustrate the Inhibition of 13b-K against Mpro.
Figure 2. Inhibition rates of nirmatrelvir and 13b-K against SARS-CoV-2 Mpro WT, H172Y, E166V, Q189K, and S144A. Inhibition rate vs. Log[I], where [I] is the concentration of the inhibitor. (a) Illustrate the Inhibition of Nirmatrelvir against Mpro and (b) Illustrate the Inhibition of 13b-K against Mpro.
Crystals 15 00758 g002
Crystals 15 00758 g003
Figure 3. Naturally occurring point mutations affect the dimer stability of the SARS-CoV-2 Mpro. Mutants of the SARS-CoV-2 Mpro were analyzed by sedimentation velocity analysis in an analytical centrifuge under reducing conditions. Sedimentation coefficient distributions c(s) in a concentration range of 0.25 to 10 µM Mpro were obtained for mutants Q189K (a), S144A (b), H172Y (c), and E166V (d). Whereas the Q189K mutation has no influence on the monomer–dimer equilibrium of the SARS-CoV-2 Mpro (compare to Figure S1a), the other mutants show increased dissociation at decreasing protein concentrations. From the extent of dissociation, the stability of the dimers can be ranked as WT = Q189K > S144A > H172Y > E166V. As the peak positions shift with decreasing protein concentrations, the dissociation seems to be fast relative to the time scale of sedimentation [40]. For better visibility, c(s) distributions were normalized to the same peak areas.
Figure 3. Naturally occurring point mutations affect the dimer stability of the SARS-CoV-2 Mpro. Mutants of the SARS-CoV-2 Mpro were analyzed by sedimentation velocity analysis in an analytical centrifuge under reducing conditions. Sedimentation coefficient distributions c(s) in a concentration range of 0.25 to 10 µM Mpro were obtained for mutants Q189K (a), S144A (b), H172Y (c), and E166V (d). Whereas the Q189K mutation has no influence on the monomer–dimer equilibrium of the SARS-CoV-2 Mpro (compare to Figure S1a), the other mutants show increased dissociation at decreasing protein concentrations. From the extent of dissociation, the stability of the dimers can be ranked as WT = Q189K > S144A > H172Y > E166V. As the peak positions shift with decreasing protein concentrations, the dissociation seems to be fast relative to the time scale of sedimentation [40]. For better visibility, c(s) distributions were normalized to the same peak areas.
Crystals 15 00758 g003
Crystals 15 00758 g004
Figure 4. Inhibitors nirmatrelvir and 13b-K stabilize SARS-CoV-2 Mpro dimers. Sedimentation coefficient distributions of WT SARS-CoV-2 Mpro (a,b), H172Y (c,d), and E166V (e,f) in a concentration range of 0.25 to 10 µM in the presence of 12 µM nirmatrelvir (a,c,e) or 13b-K (b,d,f), respectively. Both inhibitors stabilize the dimeric forms of all three proteins. In the case of E166V, the stabilizing effect of 13b-K is even more pronounced. For better visibility, c(s) distributions were normalized to the same peak areas.
Figure 4. Inhibitors nirmatrelvir and 13b-K stabilize SARS-CoV-2 Mpro dimers. Sedimentation coefficient distributions of WT SARS-CoV-2 Mpro (a,b), H172Y (c,d), and E166V (e,f) in a concentration range of 0.25 to 10 µM in the presence of 12 µM nirmatrelvir (a,c,e) or 13b-K (b,d,f), respectively. Both inhibitors stabilize the dimeric forms of all three proteins. In the case of E166V, the stabilizing effect of 13b-K is even more pronounced. For better visibility, c(s) distributions were normalized to the same peak areas.
Crystals 15 00758 g004
Crystals 15 00758 g005
Figure 5. The 2D structure of nirmatrelvir with the nitrile warhead vs. 13b-K with an α-ketoamide (P1′ groups are marked in red circles).
Figure 5. The 2D structure of nirmatrelvir with the nitrile warhead vs. 13b-K with an α-ketoamide (P1′ groups are marked in red circles).
Crystals 15 00758 g005
Crystals 15 00758 g006
Figure 6. Structural interactions of the N-finger (Ser1) at the dimer interface of the Mpro WT free enzyme ((A,C,E,G); PDB: 6Y2E), H172Y free enzyme ((B); PDB: 8CA8), E166V free enzyme ((D); PDB: 8C9P), Q189K free enzyme ((F); PDB: 8CA6), and S144A free enzyme ((H); PDB: 8C9L). Mutated amino acids are colored in orange, and the corresponding amino acids in the WT are colored in light green. Red and black dashes highlight H-bonds.
Figure 6. Structural interactions of the N-finger (Ser1) at the dimer interface of the Mpro WT free enzyme ((A,C,E,G); PDB: 6Y2E), H172Y free enzyme ((B); PDB: 8CA8), E166V free enzyme ((D); PDB: 8C9P), Q189K free enzyme ((F); PDB: 8CA6), and S144A free enzyme ((H); PDB: 8C9L). Mutated amino acids are colored in orange, and the corresponding amino acids in the WT are colored in light green. Red and black dashes highlight H-bonds.
Crystals 15 00758 g006
Crystals 15 00758 g007
Figure 7. Crystal structures of Mpro WT in complex with nirmatrelvir ((A); PDB: 7VH8), Mpro WT in complex with 13b-K ((B); PDB: 6Y2G), H172Y in complex with nirmatrelvir ((C); PDB: 8CAE), H172Y in complex with 13b-K ((D); PDB: 8CAC), Q189K in complex with nirmatrelvir ((E); PDB: 8C9U), Q189K in complex with 13b-K ((F); PDB: 8C9Q), E166V in complex with 13b-K ((G); PDB: 8CAJ), and S144A in complex with 13b-K ((H); PDB: 8C90). Nirmatrelvir and 13b-K are highlighted in magenta for the WT and in tint for the mutant. The mutated amino acid residues are highlighted in orange. Black dashes highlight H-bonds, yellow dashes highlight other interactions (not H-bonds), and stars highlight Ser1* from the adjacent molecule.
Figure 7. Crystal structures of Mpro WT in complex with nirmatrelvir ((A); PDB: 7VH8), Mpro WT in complex with 13b-K ((B); PDB: 6Y2G), H172Y in complex with nirmatrelvir ((C); PDB: 8CAE), H172Y in complex with 13b-K ((D); PDB: 8CAC), Q189K in complex with nirmatrelvir ((E); PDB: 8C9U), Q189K in complex with 13b-K ((F); PDB: 8C9Q), E166V in complex with 13b-K ((G); PDB: 8CAJ), and S144A in complex with 13b-K ((H); PDB: 8C90). Nirmatrelvir and 13b-K are highlighted in magenta for the WT and in tint for the mutant. The mutated amino acid residues are highlighted in orange. Black dashes highlight H-bonds, yellow dashes highlight other interactions (not H-bonds), and stars highlight Ser1* from the adjacent molecule.
Crystals 15 00758 g007
Table 1. Summary of the kinetic constants, IC50 values, resistance factors, and melting temperatures of the Mpro WT, H172Y, E166V, Q189K, and S144A mutants.
Table 1. Summary of the kinetic constants, IC50 values, resistance factors, and melting temperatures of the Mpro WT, H172Y, E166V, Q189K, and S144A mutants.
Enzyme Activity (kcat/Km, M−1·S−1) IC50 (nM) ± SD rRKiTm
Nirm.
(nM)		13b-K
(nM)		Nirm.13b-KNirm.
(nM)		 13b-K
(nM)		Free Enzyme
(°C)		Nirm.
(°C)		13b-K
(°C)
WT5355.26 ± 1447.8315 ± 2210 ± 47110.86~457.574.067.5
H172Y863.34 ± 380.32/16.12%344 ± 88997 ± 46823.44.71211166953.458.557.7
E166V860,28 ± 361.93/16.06%6030 ± 1911595 ± 154410.02.828,57529,44655.356.859.4
Q189K1736,16 ± 533.05/32.42%60 ± 21790 ± 2084.13.86115716057.473.168.3
S144A4983.46 ± 1700.84/93.05%40 ± 9910 ± 2902.74.33598448458.066.462.8
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

El Kilani, H.; Sun, X.; Ibrahim, M.F.; Curth, U.; Hilgenfeld, R. 13b-K and Nirmatrelvir Resistance Mutations of SARS-CoV-2 Main Protease: Structural, Biochemical, and Biophysical Characterization of Free Enzymes and Inhibitor Complexes. Crystals 2025, 15, 758. https://doi.org/10.3390/cryst15090758

AMA Style

El Kilani H, Sun X, Ibrahim MF, Curth U, Hilgenfeld R. 13b-K and Nirmatrelvir Resistance Mutations of SARS-CoV-2 Main Protease: Structural, Biochemical, and Biophysical Characterization of Free Enzymes and Inhibitor Complexes. Crystals. 2025; 15(9):758. https://doi.org/10.3390/cryst15090758

Chicago/Turabian Style

El Kilani, Haifa, Xinyuanyuan Sun, Mohamed Fouad Ibrahim, Ute Curth, and Rolf Hilgenfeld. 2025. "13b-K and Nirmatrelvir Resistance Mutations of SARS-CoV-2 Main Protease: Structural, Biochemical, and Biophysical Characterization of Free Enzymes and Inhibitor Complexes" Crystals 15, no. 9: 758. https://doi.org/10.3390/cryst15090758

APA Style

El Kilani, H., Sun, X., Ibrahim, M. F., Curth, U., & Hilgenfeld, R. (2025). 13b-K and Nirmatrelvir Resistance Mutations of SARS-CoV-2 Main Protease: Structural, Biochemical, and Biophysical Characterization of Free Enzymes and Inhibitor Complexes. Crystals, 15(9), 758. https://doi.org/10.3390/cryst15090758

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop