Functional Characterization and Metabolic Engineering of Key Genes in L-Cysteine Biosynthesis in Bacillus licheniformis
Abstract
1. Introduction
2. Results
2.1. Key Genes in the Cysteine Biosynthesis Pathway
2.1.1. Serine and Cysteine Utilization by the Wild-Type Strain
2.1.2. Identification of Key Genes in the Cysteine Biosynthesis Pathway
2.2. Transcriptional Profiling of Key Pathway Genes
2.3. Knockout of Key Genes in Competing and Catabolic Pathways
Growth Kinetics and Serine Utilization of Knockout Strains
2.4. Biosynthesis of L-Cysteine
Combinatorial Gene Expression for L-Cysteine Production
3. Discussion
4. Materials and Methods
4.1. Materials
4.1.1. Strains and Plasmids
4.1.2. Reagents and Instrumentation
4.1.3. Media and Reagent Preparation
- Fermentation Media
- 2.
- Media and Reagents for B. licheniformis Electrotransformation
4.1.4. Primers
4.2. Experimental Methods
4.2.1. Real-Time Quantitative PCR Analysis
4.2.2. Preparation and Electroporation of B. licheniformis Competent Cells
4.2.3. Gene Knockout
- Construction of Knockout Plasmids
- 2.
- Construction of Knockout Strains
4.2.4. Construction of Overexpression Recombinant Strains
4.2.5. Fermentation Conditions
4.2.6. Detection of Fermentation Parameters
- Biomass Determination
- 2.
- Glucose Determination
- 3.
- Amino Acid Detection
4.2.7. Statistical Analysis Methods
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kredich, N.M. Biosynthesis of cysteine. EcoSal Plus 2008, 3, 10-1128. [Google Scholar] [CrossRef] [Scilit]
- Takagi, H.; Ohtsu, I. L-Cysteine metabolism and fermentation in microorganisms. Adv. Biochem. Eng. Biotechnol. 2017, 159, 129–151. [Google Scholar] [CrossRef] [Scilit]
- Romero, L.C.; Aroca, M.; Laureano-Marín, A.M.; Moreno, I.; García, I.; Gotor, C. Cysteine and cysteine-related signaling pathways in Arabidopsis thaliana. Mol. Plant 2014, 7, 264–276. [Google Scholar] [CrossRef] [Scilit]
- Hicks, J.L.; Oldham, K.E.A.; McGarvie, J.; Walker, E.J. Combatting antimicrobial resistance via the cysteine biosynthesis pathway in bacterial pathogens. Biosci. Rep. 2022, 42, BSR20220368. [Google Scholar] [CrossRef] [Scilit]
- Cerbon, D.A.C.; Weuster-Botz, D. Exchange of the L-cysteine exporter after in-vivo metabolic control analysis improved the L-cysteine production process with engineered Escherichia coli. Microb. Cell Factories 2025, 24, 95. [Google Scholar] [CrossRef] [Scilit]
- Caballero Cerbon, D.A.; Gebhard, L.; Dokuyucu, R.; Ertl, T.; Härtl, S.; Mazhar, A.; Weuster-Botz, D. Challenges and advances in the bioproduction of L-cysteine. Molecules 2024, 29, 486. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Guo, Y.; Shen, Y.; Yang, K.; Cai, X.; Zhang, B.; Liu, Z.; Zheng, Y. Microbial production of sulfur-containing amino acids using metabolically engineered Escherichia coli. Biotechnol. Adv. 2024, 73, 108353. [Google Scholar] [CrossRef] [Scilit]
- Ohtsu, I.; Wiriyathanawudhiwong, N.; Morigasaki, S.; Nakatani, T.; Kadokura, H.; Takagi, H. The L-cysteine/L-cystine shuttle system provides reducing equivalents to the periplasm in Escherichia coli. J. Biol. Chem. 2010, 285, 17479–17487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wendisch, V.F. Metabolic engineering advances and prospects for amino acid production. Metab. Eng. 2020, 58, 17–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hicks, J.L.; Mullholland, C.V. Cysteine biosynthesis in Neisseria species. Microbiology 2018, 164, 1471–1480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Liang, X.; Lin, Y. Study on preparation and properties of environment protected type iron and steel blackening liquid at normal temperature. Chem. Times 2002, 3, 46–47. [Google Scholar]
- Liu, H.; Fang, G.; Wu, H.; Li, Z.; Ye, Q. L-Cysteine production in Escherichia coli based on rational metabolic engineering and modular strategy. Biotechnol. J. 2018, 13, e1700695. [Google Scholar] [CrossRef] [Scilit]
- Caballero Cerbon, D.A.; Widmann, J.; Weuster-Botz, D. Metabolic control analysis enabled the improvement of the L-cysteine production process with Escherichia coli. Appl. Microbiol. Biotechnol. 2024, 108, 108. [Google Scholar] [CrossRef] [Scilit]
- Heieck, K.; Arnold, N.D.; Brück, T.B. Metabolic stress constrains microbial L-cysteine production in Escherichia coli by accelerating transposition through mobile genetic elements. Microb. Cell Factories 2023, 22, 10. [Google Scholar] [CrossRef] [Scilit]
- Li, W.W.; Zhou, Z.; Wang, D. Recent advances, challenges, and metabolic engineering strategies in L-cysteine biosynthesis. Fermentation 2023, 9, 802. [Google Scholar] [CrossRef] [Scilit]
- Wei, L.; Wang, H.; Xu, N.; Zhou, W.; Ju, J.; Liu, J.; Ma, Y. Metabolic engineering of Corynebacterium glutamicum for L-cysteine production. Appl. Microbiol. Biotechnol. 2019, 103, 1325–1338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, H.; Qi, Y.; Qiao, J.; Li, L.; Xu, N.; Shao, L.; Wei, L.; Liu, J. Balancing redox homeostasis to improve l-cysteine production in Corynebacterium glutamicum. J. Agric. Food Chem. 2023, 71, 13848–13856. [Google Scholar] [CrossRef] [Scilit]
- Gao, J.; Du, M.; Zhao, J.; Yue, Z.; Xu, N.; Du, H.; Ju, J.; Wei, L.; Liu, J. Design of a genetically encoded biosensor to establish a high-throughput screening platform for L-cysteine overproduction. Metab. Eng. 2022, 73, 144–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Hou, Y.; Wang, Y.; Li, Z. Enhancement of sulfur conversion rate in the production of l-cysteine by engineered Escherichia coli. J. Agric. Food Chem. 2020, 68, 250–257. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Wang, Y.; Hou, Y.; Li, Z. Fitness of chassis cells and metabolic pathways for l-cysteine overproduction in Escherichia coli. J. Agric. Food Chem. 2020, 68, 14928–14937. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Shi, Y.; Yang, H.; Wu, Z.; Chen, K.; Cai, X.; Liu, Z.; Zheng, Y. Enhancement of L-cysteine production in Escherichia coli through fermentation optimization. Food Ferment. Ind. 2021, 47, 6. [Google Scholar] [CrossRef]
- Yang, H.; Zhang, B.; Wu, Z.D.; Chen, L.F.; Pan, J.Y.; Xiu, X.L.; Cai, X.; Liu, Z.Q.; Zheng, Y.G. Combinatorial metabolic engineering of Escherichia coli for enhanced L-cysteine production: Insights into crucial regulatory modes and optimization of carbon-sulfur metabolism and cofactor availability. J. Agric. Food Chem. 2023, 71, 13409–13418. [Google Scholar] [CrossRef] [Scilit]
- Xiao, F.; Li, Y.; Zhang, Y.; Wang, H.; Zhang, L.; Ding, Z.; Gu, Z.; Xu, S.; Shi, G. Construction of a novel sugar alcohol-inducible expression system in Bacillus licheniformis. Appl. Microbiol. Biotechnol. 2020, 104, 5409–5425. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Li, Y.; Xiao, F.; Wang, H.; Zhang, L.; Ding, Z.; Xu, S.; Gu, Z.; Shi, G. Engineering of a biosensor in response to malate in Bacillus licheniformis. ACS Synth. Biol. 2021, 10, 1775–1784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schallmey, M.; Singh, A.; Ward, O.P. Developments in the use of Bacillus species for industrial production. Can. J. Microbiol. 2004, 50, 1–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.S.; Hwang, B.J. Methionine biosynthesis and its regulation in Corynebacterium glutamicum: Parallel pathways of transsulfuration and direct sulfhydrylation. Appl. Microbiol. Biotechnol. 2003, 62, 459–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wada, M.; Takagi, H. Metabolic pathways and biotechnological production of L-cysteine. Appl. Microbiol. Biotechnol. 2006, 73, 48–54. [Google Scholar] [CrossRef] [Scilit]
- Tjalsma, H.; Antelmann, H.; Jongbloed, J.D.; Braun, P.G.; Darmon, E.; Dorenbos, R.; Dubois, J.Y.; Westers, H.; Zanen, G.; Quax, W.J.; et al. Proteomics of protein secretion by Bacillus subtilis: Separating the “secrets” of the secretome. Microbiol. Mol. Biol. Rev. 2004, 68, 207–233. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.Z.; Hunt, D.M.; Singha, B.; Kapoor, Y.; Singh, N.K.; Prasad, D.V.S.; Dharmarajan, S.; Sowpati, D.T.; de Carvalho, L.P.S.; Nandicoori, V.K. Divergent downstream biosynthetic pathways are supported by L-cysteine synthases of Mycobacterium tuberculosis. Elife 2024, 12, RP91970. [Google Scholar] [CrossRef] [Scilit]
- Albanesi, D.; Mansilla, M.C.; Schujman, G.E.; de Mendoza, D. Bacillus subtilis cysteine synthetase is a global regulator of the expression of genes involved in sulfur assimilation. J. Bacteriol. 2005, 187, 7631–7638. [Google Scholar] [CrossRef] [Scilit]
- Hullo, M.F.; Auger, S.; Soutourina, O.; Barzu, O.; Yvon, M.; Danchin, A.; Martin-Verstraete, I. Conversion of methionine to cysteine in Bacillus subtilis and its regulation. J. Bacteriol. 2007, 189, 187–197. [Google Scholar] [CrossRef] [Scilit]
- Maier, T.H. Semisynthetic production of unnatural L-alpha-amino acids by metabolic engineering of the cysteine-biosynthetic pathway. Nat. Biotechnol. 2003, 21, 422–427. [Google Scholar] [CrossRef] [Scilit]
- Cicchillo, R.M.; Baker, M.A.; Schnitzer, E.J.; Newman, E.B.; Krebs, C.; Booker, S.J. Escherichia coli L-serine deaminase requires a [4Fe-4S] cluster in catalysis. J. Biol. Chem. 2004, 279, 32418–32425. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; El-Hajj, Z.W.; Newman, E. Deficiency in L-serine deaminase interferes with one-carbon metabolism and cell wall synthesis in Escherichia coli K-12. J. Bacteriol. 2010, 192, 5515–5525. [Google Scholar] [CrossRef] [Scilit]
- Schweitzer, J.E.; Stolz, M.; Diesveld, R.; Etterich, H.; Eggeling, L. The serine hydroxymethyltransferase gene glyA in Corynebacterium glutamicum is controlled by GlyR. J. Biotechnol. 2009, 139, 214–221. [Google Scholar] [CrossRef] [Scilit]
- Peters-Wendisch, P.; Stolz, M.; Etterich, H.; Kennerknecht, N.; Sahm, H.; Eggeling, L. Metabolic engineering of Corynebacterium glutamicum for L-serine production. Appl. Environ. Microbiol. 2005, 71, 7139–7144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Li, Y.; Zhang, L.; Ding, Z.; Xu, S.; Gu, Z.; Shi, G. The transcriptional regulation characteristics of xylose-inducible promoter in Bacillus licheniformis. Chin. J. Appl. Environ. Biol. 2019, 25, 695–701. [Google Scholar] [CrossRef]
- Liu, S.; Xiao, F.; Li, Y.; Zhang, Y.; Wang, Y.; Shi, G. Establishment of the CRISPR-Cpf1 gene editing system in Bacillus licheniformis and multiplexed gene knockout. Synth. Syst. Biotechnol. 2025, 10, 39–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Strains | Main Engineering Strategies | Fermentation Conditions | Titer (mg/L) | References |
|---|---|---|---|---|
| CYS-19 (C. glutamicum) | Knockout of L-cysteine degradation genes, expression of feedback-insensitive key enzymes (CysE mutants), overexpression of synthase (CysK) and efflux transporter (Bcr), enhancement of the synthesis of the precursor L-serine, and use of sodium thiosulfate as a low-energy-consuming sulfur source. | Shake flask | 0.9479 ± 0.0465 | [16] |
| BW25113 (E. coli) | Enhancing precursor biosynthetic pathways and the thiosulfate assimilation pathway, optimizing synthetic pathway gene expression through two constitutive promoters, and disrupting major degradation pathway genes. | Shake flask | 1.724 ± 0.0314 | [20] |
| 1.5 L bioreactors | 8.34 | |||
| MCYS-7 (E. coli) | Combining the optimization of medium components by response surface methodology, 2L fermenters were employed for scale-up cultivation. | Shake flask | 3.85 | [21] |
| 2 L bioreactors | 10.25 | |||
| BW15-3/PED (E. coli) | Knock out L-cysteine degradation-related genes, overexpress feedback inhibition-resistant mutant synthetic genes and key thiosulfate assimilation genes, modify the glyA promoter to optimize C1 unit metabolism, use CRISPRi to screen and regulate glycolytic node genes, optimize NADPH regeneration, and introduce the L-cysteine transporter gene ydeD. | 5 L bioreactors | 12.60 | [22] |
| E. coli W3110 pCysK (E. coli) | The coding gene of the L-cysteine exporter YdeD in plasmid pCysK was replaced via Gibson assembly. Subsequently, the coding gene of YfiK with higher selectivity was introduced, and its ribosome binding site was engineered to match the original expression level. | 15 L bioreactors | 33.80 | [5] |
| epWBn-cysEf-eamA/BL2Δ3 (B. licheniformis) | Reduce precursor diversion and product degradation, while combining gene overexpression with the introduction of the feedback inhibition-relieved mutant cysEf and the transporter protein eamA. | Shake flask | 1.075 | This study |
| Gene | Function | Homology | ||
|---|---|---|---|---|
| E. coli | B. subtilis | |||
| cysE | L-Cysteine biosynthetic pathway | Encodes L-serine O-acetyltransferase (SAT), catalyzing the reaction between L-serine and acetyl-CoA to produce O-acetyl-L-serine (OAS) | 27.15% | 84.79% |
| cysK | Encodes O-acetylserine (thiol)-lyase, catalyzing the synthesis of L-cysteine from sulfide and O-acetyl-L-serine (OAS) | 50.31% | 86.60% | |
| metI/metB | L-Cysteine catabolic pathway | Encodes cystathionine γ-synthase, catalyzing the synthesis of cystathionine from O-acetylhomoserine and L-cysteine | 38.78% | 85.29% |
| metC | Encodes cystathionine β-lyase, catalyzing the conversion of cystathionine to L-homocysteine | 27.83% | 83.12% | |
| sdaAA | L-Serine catabolic pathway (competing with L-cysteine biosynthesis) | Encodes L-serine ammonia-lyase, catalyzing the conversion of L-serine to pyruvate | - | 85.33% |
| sdaAB | Encodes L-serine dehydratase, catalyzing the conversion of L-serine to pyruvate | - | 83.18% | |
| glyA | Encodes serine hydroxymethyltransferase, catalyzing the conversion of L-serine to glycine | 56.87% | 90.36% | |
| Strains/Plasmids | Correlated Characteristic | Sources |
|---|---|---|
| Strains | ||
| Escherichia coli JM109 | Wild type, used for gene cloning | This lab |
| BL2 | Bacillus licheniformis CICIM B1391, Wild type | This lab |
| BL2ΔglyA | B. licheniformis CICIM B1391, ∆glyA | This work |
| BL2ΔsdaAA | B. licheniformis CICIM B1391, ∆sdaAA | This work |
| BL2ΔmetC | B. licheniformis CICIM B1391, ∆metC | This work |
| BL2Δ2 | B. licheniformis CICIM B1391, ∆glyAΔsdaAA | This work |
| BL2Δ3 | B. licheniformis CICIM B1391, ∆glyAΔsdaAAΔmetC | This work |
| epWBn-cysE-ydeD/BL2 | Wild type, harboring epWBn-cysE-ydeD | This work |
| epWBn-cysE-eamA/BL2 | Wild type, harboring epWBn-cysE-eamA | This work |
| epWBn-cysEf-ydeD/BL2 | Wild type, harboring epWBn-cysEf-ydeD | This work |
| epWBn-cysEf-eamA/BL2 | Wild type, harboring epWBn-cysEf-eamA | This work |
| epWBn-cysE-ydeD/BL2Δ3 | BL2Δ3, harboring epWBn- cysE-ydeD | This work |
| epWBn-cysE-eamA/BL2Δ3 | BL2Δ3, harboring epWBn-cysE-eamA | This work |
| epWBn-cysEf-ydeD/BL2Δ3 | BL2Δ3, harboring epWBn-cysEf-ydeD | This work |
| epWBn-cysEf-eamA/BL2Δ3 | BL2Δ3, harboring epWBn-cysEf-eamA | This work |
| Plasmids | ||
| pJOE8999-glyA | pJOE8999, carrying glyA gene knockout cassette | This work |
| pJOE8999-sdaAA | pJOE8999, carrying sdaAA gene knockout cassette | This work |
| pJOE8999-metC | pJOE8999, carrying metC gene knockout cassette | This work |
| epWBn-cysE-ydeD | epWBn, with the cysE and ydeD gene mediated by P2 promoter | This work |
| epWBn-cysE-eamA | epWBn, with the cysE and eamA gene mediated by P2 promoter | This work |
| epWBn-cysEf-ydeD | epWBn, with the cysEf and ydeD gene mediated by P2 promoter | This work |
| epWBn-cysEf-eamA | epWBn, with the cysEf and eamA gene mediated by P2 promoter | This work |
| Primer Name | Primer Sequence (5′→3′) |
|---|---|
| glyA-STY-F | CTGCAACTGAAAAGTTTATACCCGGGagcttgacataatattcaacaggc |
| glyA-STY-R | atgaaacatttacctgcgcaataccgggcttgattactaagat |
| glyA-XTY-F | ttagtaatcaagcccggtattgcgcaggtaaatgtttcatc |
| glyA-XTY-R | AGTGAATGGTTTTTTACCCGGTACCTGGATCCtgttcctgttccgaaagcg |
| sdaAA-STY-F | CTGCAACTGAAAAGTTTATACCCGGGccttttggattttgatacatttgatgaaag |
| sdaAA-STY-R | ctaagttgcagattgtgttctcttttacatttcgaaacatatcgtctc |
| sdaAA-XTY-F | atgtttcgaaatgtaaaagagaacacaatctgcaacttagtatatctg |
| sdaAA-XTY-R | AGTGAATGGTTTTTTACCCGGTACCTGGATCCaaatggctgcggacg |
| metC-STY-F | CTGCAACTGAAAAGTTTATACCCGGGcaaaaggcgaagagctgtc |
| metC-STY-R | ttatgatcgggcgaacgctcgtccagttttcatgactcatgc |
| metC-XTY-F | atgagtcatgaaaactggacgagcgttcgcccgatcata |
| metC-XTY-R | AGTGAATGGTTTTTTACCCGGTACCTGGATCCgggtgaccagttcctgct |
| PN2-glyA-F | TTCCTTTTTGCGTGTGATGCGAATTCTCTTTTCGATTTTTATGAAACAATTCAACC |
| PN2-glyA-R | aacgcgattccttatgatcctgaATCTACAACAGTAGAAATTAAATGCTCC |
| glyA-F | tcaggatcataaggaatcgcgttAATTTCTACTGTTGTAGATCAAATAAAACGA |
| glyA-R | gttgaatattatgtcaagctCCCGGGTATAAACTTTTCAGTTG |
| PN2-sdaAA-F | TTCCTTTTTGCGTGTGATGCGAATTCTCTTTTCGATTTTTATGAAACAATTCAACC |
| PN2-sdaAA-R | tcgttcccatcgcagcgttgactATCTACAACAGTAGAAATTAAATGCTCC |
| sdaAA-F | agtcaacgctgcgatgggaacgaAATTTCTACTGTTGTAGATCAAATAAAACGA |
| sdaAA-R | atgtatcaaaatccaaaaggCCCGGGTATAAACTTTTCAGTTG |
| PN2-metC-F | TTCCTTTTTGCGTGTGATGCGAATTCTCTTTTCGATTTTTATGAAACAATTCAACC |
| PN2-metC-R | agagccttgatgaaaggttgaggATCTACAACAGTAGAAATTAAATGCTCC |
| metC-F | cctcaacctttcatcaaggctctAATTTCTACTGTTGTAGATCAAATAAAACGA |
| metC-R | agacagctcttcgccttttgCCCGGGTATAAACTTTTCAGTTG |
| glyA-YZ-F | gcccaatccgggaacgatata |
| glyA-YZ-R | ccacatcgtcgtcatcgga |
| metC-YZ-F | ggcactgtttgtagaaacgcc |
| metC-YZ-R | ccggcgcttaaatggtttcaaaag |
| sdaAA-YZ-F | ggaatctgtgtgtaaaagggggataagg |
| sdaAA-YZ-R | gttttaaaggtgtggctgattccgt |
| cysE-F | CCAAAATTAATTAAGAGGTGAAGGAAAgtgttctttaaaatgctgaaagaagatgtagatgtc |
| cysE-R | ATCGTTTTCTTTAAACAAATCACAAATGATATTTTTTGAATTCAGAATCAGTTGTTAATTtcacagctcatcttccctttcttttct |
| ydeD-F | ATTTGTTTAAAGAAAACGATTTAAAAATTTAAAAgccacctaaaaaggagcgatttaatgaaatcagctcatgtgaaaggtgtattg |
| ydeD-R | AAAAAAAAGCGGGCAAAATGGGGCAAAAAGCCACCGCCGCCGGCGGCGGCTctacacccgttcattcacggaa |
| cysEf-F | CCAAAATTAATTAAGAGGTGAAGGAAAatgagctgcgaagaactggaaat |
| cysEf-R | ATCGTTTTCTTTAAACAAATCACAAATGATATTTTTTGAATTCAGAATCAGTTGTTAATTttagattccatctccatattcaaatgtatgattaattccat |
| eamA-F | ATTTGTTTAAAGAAAACGATTTAAAAATTTAAAAgccacctaaaaaggagcgatttaatgagcagaaaagatggcgtcc |
| eamA-R | AAAAAAAAGCGGGCAAAATGGGGCAAAAAGCCACCGCCGCCGGCGGCGGCTttagctgccgactttgaccg |
| ter-R | gtcggggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacgacAAAAAAAAGCGGGCAAAATGGGG |
| ter-ter-R | TTGCATGCCTGCAGGTCGACTCTAGAGGATCCgtcggggtttgtaccgtacacc |
| epWBn-F | GGTCTTAAAGGTTTTATGGTTTTGGTCGG |
| epWBn-R | TGTGCTGAAGCTAGCTTGCATG |
| Primer Name | Primer Sequence (5′→3′) |
|---|---|
| cysE-qPCR-F | acaggaatcgaaattcac |
| cysE-qPCR-R | ttttgcccctgttgaga |
| cysK-qPCR-F | gagatacactgattgaaccg |
| cysK-qPCR-R | ttccgcttttttaatcgc |
| glyA-qPCR-F | tttgaattcgtcttttaaagc |
| glyA-qPCR-R | ctgttccttactctgact |
| metC-qPCR-F | gcacttaccggatgatta |
| metC-qPCR-R | tcaagaaacgtcagacag |
| metI-qPCR-F | cactgtttgtagaaacgc |
| metI-qPCR-R | gaacatttcctcagacagc |
| sdaAA-qPCR-F | tccgctttttatttacatcg |
| sdaAA-qPCR-R | tagaccgagtacgttttt |
| sdaAB-qPCR-F | tgaagaaaagggaatcgc |
| sdaAB-qPCR-R | gttatggacgactaaaatagca |
| rpsE-F | TGGTCGTCGTTTCCGCTTCG |
| rpsE-R | TCGCTTCTGGTACTTCTTGTGCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Yan, J.; Tao, J.; Xiao, F.; Shi, G.; Li, Y. Functional Characterization and Metabolic Engineering of Key Genes in L-Cysteine Biosynthesis in Bacillus licheniformis. Catalysts 2026, 16, 129. https://doi.org/10.3390/catal16020129
Yan J, Tao J, Xiao F, Shi G, Li Y. Functional Characterization and Metabolic Engineering of Key Genes in L-Cysteine Biosynthesis in Bacillus licheniformis. Catalysts. 2026; 16(2):129. https://doi.org/10.3390/catal16020129
Chicago/Turabian StyleYan, Jing, Junbing Tao, Fengxu Xiao, Guiyang Shi, and Youran Li. 2026. "Functional Characterization and Metabolic Engineering of Key Genes in L-Cysteine Biosynthesis in Bacillus licheniformis" Catalysts 16, no. 2: 129. https://doi.org/10.3390/catal16020129
APA StyleYan, J., Tao, J., Xiao, F., Shi, G., & Li, Y. (2026). Functional Characterization and Metabolic Engineering of Key Genes in L-Cysteine Biosynthesis in Bacillus licheniformis. Catalysts, 16(2), 129. https://doi.org/10.3390/catal16020129
