Codisplay of Rhizopus oryzae and Candida rugosa Lipases for Biodiesel Production
Abstract
1. Introduction
2. Results and Discussion
2.1. ROL and CRL1 Localization on P. pastoris GS115
2.2. Functional Activity of Surface-Displayed Recombinant Strains
2.3. Surface-Displayed GS115/KpRS, GS115/ZCS, and GS115/pRCS Characterization
2.4. Application of Surface-Displayed Lipases as Whole-Cell Biocatalysts
3. Materials and Methods
3.1. Strains, Vectors, and Culture Media
3.2. Plasmid Construction
3.3. Yeast Transformation and Inducible Expression
3.4. Immunofluorescence and Flow Cytometric Assays
3.5. Plate Assay
3.6. Displayed Recombinant Activity Assay
3.7. Characterization of the Displayed ROL and CRL1
3.8. Surface-Displayed Recombinants as Whole-Cell Catalysts for Biodiesel Production
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CRL1 | Candida rugosa lipase 1 |
| FITC | Fluorescein Isothiocyanate-Conjugated |
| KpRS | pPIC9K-ROL-Sed1 |
| pNp | p-Nitrophenol Ester |
| ROL | Rhizopus oryzae Lipase |
| ZCS | pPICZα-CRL1-Sed1 |
References
- Reetz, M.T. Lipases as practical biocatalysts. Curr. Opin. Chem. Biol. 2002, 6, 145–150. [Google Scholar] [CrossRef]
- Ribeiro, B.D.; de Castro, A.M.; Coelho, M.A.Z.; Freire, D.M.G. Production and use of lipases in bioenergy: A review from the feedstocks to biodiesel production. Enzym. Res. 2011, 2011, 1–16. [Google Scholar] [CrossRef]
- Lee, N.H.; Kim, J.M.; Shin, H.Y.; Kang, S.W.; Kim, S.W. Biodiesel production using a mixture of immobilized Rhizopus oryzae and Candida rugosa lipases. Biotechnol. Bioprocess Eng. 2006, 11, 522–525. [Google Scholar] [CrossRef]
- Lee, J.H.; Kim, S.B.; Park, C.; Tae, B.; Han, S.O.; Kim, S.W. Development of batch and continuous processes on biodiesel production in a packed-bed reactor by a mixture of immobilized Candida rugosa and Rhizopus oryzae lipases. Appl. Biochem. Biotechnol. 2009, 161, 365–371. [Google Scholar] [CrossRef]
- Lee, J.H.; Kim, S.B.; Kang, S.W.; Song, Y.S.; Park, C.; Han, S.O.; Kim, S.W. Biodiesel production by a mixture of Candida rugosa and Rhizopus oryzae lipases using a supercritical carbon dioxide process. Bioresour. Technol. 2011, 102, 2105–2108. [Google Scholar] [CrossRef]
- Lee, J.H.; Kim, S.B.; Yoo, H.Y.; Lee, J.H.; Han, S.O.; Park, C.; Kim, S.W. Co-immobilization of Candida rugosa and Rhyzopus oryzae lipases and biodiesel production. Korean J. Chem. Eng. 2013, 30, 1335–1338. [Google Scholar] [CrossRef]
- Sirisha, V.; Jain, A.; Jain, A. Enzyme immobilization. Adv. Food Nutr. Res. 2016, 79, 179–211. [Google Scholar] [CrossRef] [PubMed]
- Hanes, J.; Jermutus, L.; Weber-Bornhauser, S.; Bosshard, H.R.; Plückthun, A. Ribosome display efficiently selects and evolves high-affinity antibodies in vitro from immune libraries. Proc. Natl. Acad. Sci. USA 1998, 95, 14130–14135. [Google Scholar] [CrossRef]
- Grabherr, R.; Ernst, W.; Oker-Blom, C.; Jones, I. Developments in the use of baculoviruses for the surface display of complex eukaryotic proteins. Trends Biotechnol. 2001, 19, 231–236. [Google Scholar] [CrossRef]
- Shibasaki, S.; Ueda, M.; Ye, K.; Shimizu, K.; Kamasawa, N.; Osumi, M.; Tanaka, A. Creation of cell surface-engineered yeast that display different fluorescent proteins in response to the glucose concentration. Appl. Microbiol. Biotechnol. 2001, 57, 528–533. [Google Scholar] [CrossRef] [PubMed]
- Samuelson, P.; Gunneriusson, E.; Nygren, P.-Å.; Ståhl, S. Display of proteins on bacteria. J. Biotechnol. 2002, 96, 129–154. [Google Scholar] [CrossRef]
- Pan, X.X.; Xu, L.; Zhang, Y.; Xiao, X.; Wang, X.F.; Liu, Y.; Zhang, H.J.; Yan, Y.-J. Efficient display of active Geotrichum sp. lipase on Pichia pastoris cell wall and its application as a whole-cell biocatalyst to enrich EPA and DHA in fish oil. J. Agric. Food Chem. 2012, 60, 9673–9679. [Google Scholar] [CrossRef]
- Tabañag, I.D.F.; Chu, I.-M.; Wei, Y.-H.; Tsai, S.-L. The Role of yeast-surface-display techniques in creating biocatalysts for consolidated bioprocessing. Catalysts 2018, 8, 94. [Google Scholar] [CrossRef]
- Moura, M.V.H.; Da Silva, G.P.; Machado, A.C.D.O.; Torres, F.A.G.; Freire, D.M.G.; Almeida, R.V. Displaying lipase B from Candida antarctica in Pichia pastoris using the yeast surface display approach: Prospection of a new anchor and characterization of the whole cell biocatalyst. PLoS ONE 2015, 10, e0141454. [Google Scholar] [CrossRef] [PubMed]
- Rockberg, J.; Löfblom, J.; Hjelm, B.; Uhlén, M.; Ståhl, S. Epitope mapping of antibodies using bacterial surface display. Nat. Chem. Biol. 2008, 5, 1039–1045. [Google Scholar] [CrossRef] [PubMed]
- Cherf, G.M.; Cochran, J.R. Applications of yeast surface display for protein engineering. Methods Mol. Biol. 2015, 1319, 155–175. [Google Scholar] [CrossRef] [PubMed]
- Andreu, C.; del Olmo, M.L. Yeast arming systems: Pros and cons of different protein anchors and other elements required for display. Appl. Microbiol. Biotechnol. 2018, 102, 2543–2561. [Google Scholar] [CrossRef]
- Linciano, S.; Pluda, S.; Bacchin, A.; Angelini, A. Molecular evolution of peptides by yeast surface display technology. MedChemComm 2019, 10, 1569–1580. [Google Scholar] [CrossRef]
- Xu, L.; Xiao, X.; Wang, F.; He, Y.; Yang, X.; Hu, J.; Feng, Z.; Yan, Y. Surface-displayed thermostable Candida rugosa Lipase 1 for docosahexaenoic acid enrichment. Appl. Biochem. Biotechnol. 2019, 190, 218–231. [Google Scholar] [CrossRef]
- Rizos, K.; Lattemann, C.T.; Bumann, D.; Meyer, T.F.; Aebischer, T. Autodisplay. Infect. Immun. 2003, 71, 6320–6328. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Vandormael, P.; Verschueren, P.; de Winter, L.; Somers, V. cDNA phage display for the discovery of theranostic autoantibodies in rheumatoid arthritis. Immunol. Res. 2017, 65, 307–325. [Google Scholar] [CrossRef]
- Park, T.J.; Zheng, S.; Kang, Y.J.; Lee, S.Y. Development of a whole-cell biosensor by cell surface display of a gold-binding polypeptide on the gold surface. FEMS Microbiol. Lett. 2009, 293, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Ho, S.-H.; Hasunuma, T.; Chang, J.-S.; Ren, N.-Q.; Kondo, A. Recent advances in yeast cell-surface display technologies for waste biorefineries. Bioresour. Technol. 2016, 215, 324–333. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, R.; Lian, Z.; Wang, S.; Wright, A.T. Yeast cell surface display for lipase whole cell catalyst and its applications. J. Mol. Catal. B Enzym. 2014, 106, 17–25. [Google Scholar] [CrossRef]
- Hama, S.; Tamalampudi, S.; Fukumizu, T.; Miura, K.; Yamaji, H.; Kondo, A.; Fukuda, H. Lipase localization in Rhizopus oryzae cells immobilized within biomass support particles for use as whole-cell biocatalysts in biodiesel-fuel production. J. Biosci. Bioeng. 2006, 101, 328–333. [Google Scholar] [CrossRef]
- Nogueira, L.A. Does biodiesel make sense? Energy 2011, 36, 3659–3666. [Google Scholar] [CrossRef]
- Yan, Y.; Xu, L.; Dai, M. A synergetic whole-cell biocatalyst for biodiesel production. RSC Adv. 2012, 2, 6170–6173. [Google Scholar] [CrossRef]
- Minning, S.; Schmidt-Dannert, C.; Schmid, R.D. Functional expression of Rhizopus oryzae lipase in Pichia pastoris: High-level production and some properties. J. Biotechnol. 1998, 66, 147–156. [Google Scholar] [CrossRef]
- Domínguez de María, P.; Sánchez-Montero, J.M.; Sinisterra, J.V.; Alcántara, A.R. Understanding Candida rugosa lipases: An overview. Biotechnol. Adv. 2006, 24, 180–196. [Google Scholar] [CrossRef]
- Gardossi, L.; Poulsen, P.B.; Ballesteros, A.; Hult, K.; Švedas, V.K.; Vasić-Rački, Đ.; Carrea, G.; Magnusson, A.; Schmid, A.; Wohlgemuth, R.; et al. Guidelines for reporting of biocatalytic reactions. Trends Biotechnol. 2010, 28, 171–180. [Google Scholar] [CrossRef] [PubMed]
- Kojima, Y.; Shimizu, S. Purification and characterization of the lipase from Pseudomonas fluorescens HU380. J. Biosci. Bioeng. 2003, 96, 219–226. [Google Scholar] [CrossRef]
- Bin Ibrahim, N.A.; Guo, Z.; Xu, X. Enzymatic interesterification of palm stearin and coconut oil by a dual lipase system. J. Am. Oil Chem. Soc. 2007, 85, 37–45. [Google Scholar] [CrossRef]
- Huang, Y.; Zheng, H.; Yan, Y. Optimization of lipase-catalyzed transesterification of lard for biodiesel production using response surface methodology. Appl. Biochem. Biotechnol. 2008, 160, 504–515. [Google Scholar] [CrossRef] [PubMed]





| PCR Product | Primer Name | Primer Sequence (5′→3′) | Template | Annotation |
|---|---|---|---|---|
| Sed1 | Sed1-F | AACACGCGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAATTTTCCAACAGTACATCTGCTTC | EBY100 total genomic DNA | MluI site underlined Sequence encoding GS linker in bold italics |
| Sed1-R | ATTAGCGGCCGCTTATAAGAATAACATAGCAACAC | NotI site underlined | ||
| ROL | ROL-F | CATGAATTCGTTCCTGTTTCTGGTAAATCT | ROL-9K | EcoRI site underlined |
| ROL-R | CATACGCGTCTTGTCATCGTCATCCAAGTAGTCCAAACAGCTTCCTTCGTTGAT | MluI site underlined Sequence encoding Flag-tag in italics | ||
| Sed1 | Sed1-F2 | ACACTAGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAATTTTCCAACAGTACATCTGCTTC | EBY100 total genomic DNA | SpeI site underlined Sequence encoding (G4S)3 linker in bold italics |
| Sed1-R2 | CGCGTCTAGATTATAAGAATAACATAGCAACAC | XbaI site underlined | ||
| CRL1 | CRL1-F | CATGAATTCTACCCATACGACGTTCCAGACTACGCTGCCCCCACCGCCACGC | ZXFα-CRL1 | EcoRI site underlined Coding sequence of HA-tag in bold italics |
| CRL1-R | CATACTAGTTCTACCTTCAATCACAAAGAAAGACGGCGG | SpeI site underlined Sequence encoding Factor Xa in bold italics |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Zhang, Y.; Pang, H.; Yuan, S.; Wang, X.; Hu, Z.; Zhou, Q.; He, Y.; Yan, Y.; Xu, L. Codisplay of Rhizopus oryzae and Candida rugosa Lipases for Biodiesel Production. Catalysts 2021, 11, 421. https://doi.org/10.3390/catal11040421
Yang X, Zhang Y, Pang H, Yuan S, Wang X, Hu Z, Zhou Q, He Y, Yan Y, Xu L. Codisplay of Rhizopus oryzae and Candida rugosa Lipases for Biodiesel Production. Catalysts. 2021; 11(4):421. https://doi.org/10.3390/catal11040421
Chicago/Turabian StyleYang, Xiaoxu, Yan Zhang, Huimin Pang, Sheng Yuan, Xuxia Wang, Zhiming Hu, Qinghua Zhou, Yaojia He, Yunjun Yan, and Li Xu. 2021. "Codisplay of Rhizopus oryzae and Candida rugosa Lipases for Biodiesel Production" Catalysts 11, no. 4: 421. https://doi.org/10.3390/catal11040421
APA StyleYang, X., Zhang, Y., Pang, H., Yuan, S., Wang, X., Hu, Z., Zhou, Q., He, Y., Yan, Y., & Xu, L. (2021). Codisplay of Rhizopus oryzae and Candida rugosa Lipases for Biodiesel Production. Catalysts, 11(4), 421. https://doi.org/10.3390/catal11040421

