ECM Stiffness-Induced Redox Signaling Enhances Stearoyl Gemcitabine Efficacy in Pancreatic Cancer
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Matrix Development
2.2. Matrix Characterization
2.3. Patient-Derived Cell Culture
2.4. Three-Dimensional Organoid Culture and Drug Treatment
2.5. Cell Viability and Proliferation Analysis
2.6. Drug Response Studies
2.7. IHC Staining
2.8. Transcriptional Analysis
2.9. Statistical Analysis
3. Results
3.1. Distinct Matrix Mechanics Dictate PDAC Organoid Architecture and Growth
3.2. Matrix Mechanics Drive Distinct Transcriptional Programs in PDAC Organoids
3.3. Matrix Mechanics Modulate Drug Sensitivity and Survival Pathways in PDAC Organoids
3.4. Stearoyl-Modified Gemcitabine Shows Enhanced Efficacy in Stiff Matrices
3.5. Gem-S Efficacy Is Mediated Through Oxidative Stress in Stiff Matrix Environments
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2021. CA Cancer J. Clin. 2021, 71, 7–33. [Google Scholar] [CrossRef] [PubMed]
- Halbrook, C.J.; Lyssiotis, C.A.; di Magliano, M.P.; Maitra, A. Pancreatic cancer: Advances and challenges. Cell 2023, 186, 1729–1754. [Google Scholar] [CrossRef]
- Weniger, M.; Honselmann, K.C.; Liss, A.S. The extracellular matrix and pancreatic cancer: A complex relationship. Cancers 2018, 10, 316. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Li, Y.; Ge, H.; Ghadban, T.; Reeh, M.; Guengoer, C. The extracellular matrix: A key accomplice of cancer stem cell migration, metastasis formation, and drug resistance in PDAC. Cancers 2022, 14, 3998. [Google Scholar] [CrossRef]
- Pothula, S.P.; Pirola, R.C.; Wilson, J.S.; Apte, M.V. Multifunctional role of pancreatic stellate cells in pancreatic cancer. Ann. Pancreat. Cancer 2019, 2, 10. [Google Scholar]
- Sarvepalli, D.; Rashid, M.U.; Rahman, A.U.; Ullah, W.; Hussain, I.; Hasan, B.; Jehanzeb, S.; Khan, A.K.; Jain, A.G.; Khetpal, N. Gemcitabine: A review of chemoresistance in pancreatic cancer. Crit. Rev.™ Oncog. 2019, 24, 199–212. [Google Scholar] [CrossRef]
- Beutel, A.K.; Halbrook, C.J. Barriers and opportunities for gemcitabine in pancreatic cancer therapy. Am. J. Physiol.-Cell Physiol. 2023, 324, C540–C552. [Google Scholar] [CrossRef]
- Gong, M.; Meng, H.; Tan, D.; Li, P.; Qin, J.; An, Q.; Shi, C.; An, J. Establishment of organoid models for pancreatic ductal adenocarcinoma and screening of individualized therapy strategy. Anim. Models Exp. Med. 2023, 6, 409–418. [Google Scholar] [CrossRef] [PubMed]
- Amrutkar, M.; Gladhaug, I.P. Pancreatic cancer chemoresistance to gemcitabine. Cancers 2017, 9, 157. [Google Scholar] [CrossRef]
- Calà, G.; Sina, B.; De Coppi, P.; Giobbe, G.G.; Gerli, M.F.M. Primary human organoids models: Current progress and key milestones. Front. Bioeng. Biotechnol. 2023, 11, 1058970. [Google Scholar] [CrossRef]
- Hosein, A.N.; Brekken, R.A.; Maitra, A. Pancreatic cancer stroma: An update on therapeutic targeting strategies. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 487–505. [Google Scholar] [CrossRef] [PubMed]
- Rossi, G.; Manfrin, A.; Lutolf, M.P. Progress and potential in organoid research. Nat. Rev. Genet. 2018, 19, 671–687. [Google Scholar] [CrossRef] [PubMed]
- Seppälä, T.T.; Zimmerman, J.W.; Suri, R.; Zlomke, H.; Ivey, G.D.; Szabolcs, A.; Shubert, C.R.; Cameron, J.L.; Burns, W.R.; Lafaro, K.J. Precision medicine in pancreatic cancer: Patient-derived organoid pharmacotyping is a predictive biomarker of clinical treatment response. Clin. Cancer Res. 2022, 28, 3296–3307. [Google Scholar] [CrossRef] [PubMed]
- Provenzano, P.P.; Cuevas, C.; Chang, A.E.; Goel, V.K.; Von Hoff, D.D.; Hingorani, S.R. Enzymatic targeting of the stroma ablates physical barriers to treatment of pancreatic ductal adenocarcinoma. Cancer Cell 2012, 21, 418–429. [Google Scholar] [CrossRef]
- Yu, M.; Tannock, I.F. Targeting tumor architecture to favor drug penetration: A new weapon to combat chemoresistance in pancreatic cancer? Cancer Cell 2012, 21, 327–329. [Google Scholar] [CrossRef]
- Tape, C.J.; Ling, S.; Dimitriadi, M.; McMahon, K.M.; Worboys, J.D.; Leong, H.S.; Norrie, I.C.; Miller, C.J.; Poulogiannis, G.; Lauffenburger, D.A. Oncogenic KRAS regulates tumor cell signaling via stromal reciprocation. Cell 2016, 165, 910–920. [Google Scholar] [CrossRef]
- Apte, M.V.; Wilson, J.S.; Lugea, A.; Pandol, S.J.A. starring role for stellate cells in the pancreatic cancer microenvironment. Gastroenterology 2013, 144, 1210–1219. [Google Scholar] [CrossRef]
- Huber, M.; Brehm, C.U.; Gress, T.M.; Buchholz, M.; Alashkar Alhamwe, B.; Pogge von Strandmann, E.; Slater, E.P.; Bartsch, J.W.; Bauer, C.; Lauth, M. The immune microenvironment in pancreatic cancer. Int. J. Mol. Sci. 2020, 21, 7307. [Google Scholar] [CrossRef]
- Tahkola, K.; Ahtiainen, M.; Mecklin, J.-P.; Kellokumpu, I.; Laukkarinen, J.; Tammi, M.; Tammi, R.; Väyrynen, J.P.; Böhm, J. Stromal hyaluronan accumulation is associated with low immune response and poor prognosis in pancreatic cancer. Sci. Rep. 2021, 11, 12216. [Google Scholar] [CrossRef]
- Murphy, K.J.; Chambers, C.R.; Herrmann, D.; Timpson, P.; Pereira, B.A. Dynamic stromal alterations influence tumor-stroma crosstalk to promote pancreatic cancer and treatment resistance. Cancers 2021, 13, 3481. [Google Scholar] [CrossRef]
- Liang, C.; Shi, S.; Meng, Q.; Liang, D.; Ji, S.; Zhang, B.; Qin, Y.; Xu, J.; Ni, Q.; Yu, X. Complex roles of the stroma in the intrinsic resistance to gemcitabine in pancreatic cancer: Where we are and where we are going. Exp. Mol. Med. 2017, 49, e406. [Google Scholar] [CrossRef] [PubMed]
- Capula, M.; Perán, M.; Xu, G.; Donati, V.; Yee, D.; Gregori, A.; Assaraf, Y.G.; Giovannetti, E.; Deng, D. Role of drug catabolism, modulation of oncogenic signaling and tumor microenvironment in microbe-mediated pancreatic cancer chemoresistance. Drug Resist. Updates 2022, 64, 100864. [Google Scholar] [CrossRef] [PubMed]
- Driehuis, E.; Van Hoeck, A.; Moore, K.; Kolders, S.; Francies, H.E.; Gulersonmez, M.C.; Stigter, E.C.; Burgering, B.; Geurts, V.; Gracanin, A. Pancreatic cancer organoids recapitulate disease and allow personalized drug screening. Proc. Natl. Acad. Sci. USA 2019, 116, 26580–26590. [Google Scholar] [CrossRef]
- Wensink, G.E.; Elias, S.G.; Mullenders, J.; Koopman, M.; Boj, S.F.; Kranenburg, O.W.; Roodhart, J.M. Patient-derived organoids as a predictive biomarker for treatment response in cancer patients. NPJ Precis. Oncol. 2021, 5, 30. [Google Scholar] [CrossRef]
- Raimondi, G.; Mato-Berciano, A.; Pascual-Sabater, S.; Rovira-Rigau, M.; Cuatrecasas, M.; Fondevila, C.; Sanchez-Cabus, S.; Begthel, H.; Boj, S.F.; Clevers, H. Patient-derived pancreatic tumour organoids identify therapeutic responses to oncolytic adenoviruses. EBioMedicine 2020, 56, 102786. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.Y.; Tan, S.-J.; Yang, Z.; Tayag, C.; Han, B. Tumor bioengineering using a transglutaminase crosslinked hydrogel. PLoS ONE 2014, 9, e105616. [Google Scholar] [CrossRef]
- Fang, J.Y.; Tan, S.-J.; Wu, Y.-C.; Yang, Z.; Hoang, B.X.; Han, B. From competency to dormancy: A 3D model to study cancer cells and drug responsiveness. J. Transl. Med. 2016, 14, 1–13. [Google Scholar] [CrossRef]
- Eckert, R.L. Transglutaminase 2 takes center stage as a cancer cell survival factor and therapy target. Mol. Carcinog. 2019, 58, 837–853. [Google Scholar] [CrossRef]
- Zaltron, E.; Vianello, F.; Ruzza, A.; Palazzo, A.; Brillo, V.; Celotti, I.; Scavezzon, M.; Rossin, F.; Leanza, L.; Severin, F. The Role of Transglutaminase 2 in Cancer: An Update. Int. J. Mol. Sci. 2024, 25, 2797. [Google Scholar] [CrossRef]
- Kuwahara, K.; Yang, Z.; Slack, G.C.; Nimni, M.E.; Han, B. Cell delivery using an injectable and adhesive transglutaminase-gelatin gel. Tissue Eng. Part C Methods 2010, 16, 609–618. [Google Scholar] [CrossRef]
- Kuwahara, K.; Fang, J.Y.; Yang, Z.; Han, B. Enzymatic crosslinking and degradation of gelatin as a switch for bone morphogenetic protein-2 activity. Tissue Eng. Part A 2011, 17, 2955–2964. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.; Fang, J.Y.; Yang, Z.; Nimni, M.E.; Han, B. The synergetic effect of hydrogel stiffness and growth factor on osteogenic differentiation. Biomaterials 2014, 35, 5294–5306. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Inkoom, A.; Ndemazie, N.B.; Smith, T.; Frimpong, E.; Bulusu, R.; Poku, R.; Zhu, X.; Han, B.; Trevino, J.; Agyare, E. Biological evaluation of novel gemcitabine analog in patient-derived xenograft models of pancreatic cancer. BMC Cancer 2023, 23, 435. [Google Scholar] [CrossRef]
- Eliahoo, P.; Setayesh, H.; Hoffman, T.; Wu, Y.; Li, S.; Treweek, J.B. Viscoelasticity in 3D Cell Culture and Regenerative Medicine: Measurement Techniques and Biological Relevance. ACS Mater. Au 2024, 4, 354–384. [Google Scholar] [CrossRef]
- Saraswathibhatla, A.; Indana, D.; Chaudhuri, O. Cell–extracellular matrix mechanotransduction in 3D. Nat. Rev. Mol. Cell Biol. 2023, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Hadden, M.; Mittal, A.; Samra, J.; Zreiqat, H.; Sahni, S.; Ramaswamy, Y. Mechanically stressed cancer microenvironment: Role in pancreatic cancer progression. Biochim. Biophys. Acta (BBA)-Rev. Cancer 2020, 1874, 188418. [Google Scholar] [CrossRef]
- Hayward, M.-K.; Muncie, J.M.; Weaver, V.M. Tissue mechanics in stem cell fate, development, and cancer. Dev. Cell 2021, 56, 1833–1847. [Google Scholar] [CrossRef]
- Rice, A.; Cortes, E.; Lachowski, D.; Cheung, B.; Karim, S.; Morton, J.; Del Rio Hernandez, A. Matrix stiffness induces epithelial–mesenchymal transition and promotes chemoresistance in pancreatic cancer cells. Oncogenesis 2017, 6, e352. [Google Scholar] [CrossRef]
- Adamska, A.; Falasca, M. ATP-binding cassette transporters in progression and clinical outcome of pancreatic cancer: What is the way forward? World J. Gastroenterol. 2018, 24, 3222. [Google Scholar] [CrossRef]
- Koltai, T.; Reshkin, S.J.; Carvalho, T.M.; Di Molfetta, D.; Greco, M.R.; Alfarouk, K.O.; Cardone, R.A. Resistance to gemcitabine in pancreatic ductal adenocarcinoma: A physiopathologic and pharmacologic review. Cancers 2022, 14, 2486. [Google Scholar] [CrossRef]
- Inkoom, A.; Ndemazie, N.; Smith, T.; Frimpong, E.; Bulusu, R.; Poku, R.; Zhu, X.; Han, B.; Trevino, J.; Agyare, E. Application of modified gemcitabine-loaded solid lipid nanoparticle in the treatment of pancreatic cancer patient-derived xenograft model. 2022. [Google Scholar] [CrossRef]
- Srinivas, P.; Preeti, S. Formulation and evaluation of gemcitabine hydrochloride loaded solid lipid nanoparticles. JGTPS 2014, 5, 2017–2023. [Google Scholar]
- Bae, T.; Hallis, S.P.; Kwak, M.-K. Hypoxia, oxidative stress, and the interplay of HIFs and NRF2 signaling in cancer. Exp. Mol. Med. 2024, 56, 501–514. [Google Scholar] [CrossRef]
- Glasauer, A.; Chandel, N.S. Targeting antioxidants for cancer therapy. Biochem. Pharmacol. 2014, 92, 90–101. [Google Scholar] [CrossRef] [PubMed]
- Gong, T.; Wu, D.; Pan, H.; Sun, Z.; Yao, X.; Wang, D.; Huang, Y.; Li, X.; Guo, Y.; Lu, Y. Biomimetic microenvironmental stiffness boosts stemness of pancreatic ductal adenocarcinoma via augmented autophagy. ACS Biomater. Sci. Eng. 2023, 9, 5347–5360. [Google Scholar] [CrossRef] [PubMed]
- Ishihara, S.; Haga, H. Matrix stiffness contributes to cancer progression by regulating transcription factors. Cancers 2022, 14, 1049. [Google Scholar] [CrossRef]
- Nallanthighal, S.; Heiserman, J.P.; Cheon, D.-J. The role of the extracellular matrix in cancer stemness. Front. Cell Dev. Biol. 2019, 7, 86. [Google Scholar] [CrossRef]
- Sharmin, M.M.; Mizusawa, M.; Hayashi, S.; Arai, W.; Sakata, S.; Yonekura, S. Effects of fatty acids on inducing endoplasmic reticulum stress in bovine mammary epithelial cells. J. Dairy Sci. 2020, 103, 8643–8654. [Google Scholar] [CrossRef]
Primer | Sequence |
---|---|
ABCC1 F | CCGTGTACTCCAACGCTGACAT |
ABCC1 R | ATGCTGTGCGTGACCAAGATCC |
ABCC2 F | GCCAACTTGTGGCTGTGATAGG |
ABCC2 R | ATCCAGGACTGCTGTGGGACAT |
NRF-2 F | AAATTGAGATTGATGGAACAGAGAA |
NRF-2 R | TATGGCCTGGCTTACACATTCA |
HIF 1 F | TATGAGCCAGAAGAACTTTTAGGC |
HIF 1 R | CACCTCTTTTGGCAAGCATCCTG |
PTK 2 F | GCCTTATGACGAAATGCTGGGC |
PTK 2 R | CCTGTCTTCTGGACTCCATCCT |
CD44 F | CCAATGCCTTTGATGGACCA |
CD44 R | TGTGAGTGTCCATCTGATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, S.; Agyare, E.; Zhu, X.; Trevino, J.; Rogers, S.; Velazquez-Villarreal, E.; Brant, J.; Eliahoo, P.; Barajas, J.; Hoang, B.X.; et al. ECM Stiffness-Induced Redox Signaling Enhances Stearoyl Gemcitabine Efficacy in Pancreatic Cancer. Cancers 2025, 17, 870. https://doi.org/10.3390/cancers17050870
Zhao S, Agyare E, Zhu X, Trevino J, Rogers S, Velazquez-Villarreal E, Brant J, Eliahoo P, Barajas J, Hoang BX, et al. ECM Stiffness-Induced Redox Signaling Enhances Stearoyl Gemcitabine Efficacy in Pancreatic Cancer. Cancers. 2025; 17(5):870. https://doi.org/10.3390/cancers17050870
Chicago/Turabian StyleZhao, Shuqing, Edward Agyare, Xueyou Zhu, Jose Trevino, Sherise Rogers, Enrique Velazquez-Villarreal, Jason Brant, Payam Eliahoo, Jonathan Barajas, Ba Xuan Hoang, and et al. 2025. "ECM Stiffness-Induced Redox Signaling Enhances Stearoyl Gemcitabine Efficacy in Pancreatic Cancer" Cancers 17, no. 5: 870. https://doi.org/10.3390/cancers17050870
APA StyleZhao, S., Agyare, E., Zhu, X., Trevino, J., Rogers, S., Velazquez-Villarreal, E., Brant, J., Eliahoo, P., Barajas, J., Hoang, B. X., & Han, B. (2025). ECM Stiffness-Induced Redox Signaling Enhances Stearoyl Gemcitabine Efficacy in Pancreatic Cancer. Cancers, 17(5), 870. https://doi.org/10.3390/cancers17050870