WBP5 Expression Influences Prognosis and Treatment Response in Head and Neck Squamous Cell Carcinoma
Simple Summary
Abstract
1. Introduction
2. Results
2.1. Differential and Validated Expression of WBP5 in Various Cancer Types
2.2. Prognostic Value of WBP5 Expression in HNSC
2.3. Association of WBP5 with Immune Cell Infiltration
2.4. Relationship of WBP5 Expression with Tumor Grade, Stage, and Metastasis
2.5. Correlation Between WBP5 and Epidermal Growth Factor Receptor (EGFR) Expression
2.6. Functional Validation of WBP5 in Tumorigenesis
3. Discussion
4. Materials and Methods
4.1. GEPIA2
4.2. Microarray Data
4.3. Kaplan–Meier Plotter Analysis
4.4. UALCAN
4.5. TNM Plot
4.6. Transfection for Small Interfering RNA (siRNA)
4.7. Total RNA Extraction and qRT-PCR
4.8. Cell Culturing and Viability Assessment
4.9. Evaluation of Caspase 3/7 Activity
4.10. Colony Formation Analysis
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ACC | Adrenocortical carcinoma |
| BLCA | Bladder Urothelial carcinoma |
| BRCA | Breast invasive carcinoma |
| CESC | Cervical squamous cell carcinoma and endocervical adenocarcinoma |
| CHOL | Cholangio carcinoma |
| COAD | Colon adenocarcinoma |
| DLBC | Lymphoid neoplasm diffuse large B-cell lymphoma |
| ESCA | Esophageal carcinoma |
| GBM | Glioblastoma multiforme |
| HNSC | Head and neck squamous cell carcinoma |
| KICH | Kidney chromophobe |
| KIRC | Kidney renal clear cell carcinoma |
| KIRP | Kidney renal papillary cell carcinoma |
| LAML | Acute myeloid leukemia |
| LGG | Brain lower-grade glioma |
| LIHC | Liver hepatocellular carcinoma |
| LUAD | Lung adenocarcinoma |
| LUSC | Lung squamous cell carcinoma |
| MESO | Mesothelioma |
| OV | Ovarian serous cystadenocarcinoma |
| PAAD | Pancreatic adenocarcinoma |
| PCPG | Pheochromocytoma and Paraganglioma |
| PRAD | Prostate adenocarcinoma |
| READ | Rectum adenocarcinoma |
| SARC | Sarcoma |
| SKCM | Skin cutaneous melanoma |
| STAD | Stomach adenocarcinoma |
| TGCT | Testicular germ cell tumors |
| THCA | Thyroid carcinoma |
| THYM | Thymoma |
| UCEC | Uterine corpus endometrial carcinoma |
| UCS | Uterine carcinosarcoma |
| UVM | Uveal melanoma |
References
- Lee, A.M.; Weaver, A.N.; Acosta, P.; Harris, L.; Bowles, D.W. Review of Current and Future Medical Treatments in Head and Neck Squamous Cell Carcinoma. Cancers 2024, 16, 3488. [Google Scholar] [CrossRef] [PubMed]
- Shah, P.A.; Huang, C.; Li, Q.; Kazi, S.A.; Byers, L.A.; Wang, J.; Johnson, F.M.; Frederick, M.J. NOTCH1 Signaling in Head and Neck Squamous Cell Carcinoma. Cells 2020, 2, 2677. [Google Scholar] [CrossRef] [PubMed]
- Ward, C.; Cauchy, P.; Garcia, P.; Frampton, J.; Esteban, M.A.; Volpe, G. High WBP5 expression correlates with elevation of HOX genes levels and is associated with inferior survival in patients with acute myeloid leukaemia. Sci. Rep. 2020, 10, 3505. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.; Lei, Y.; Hu, B.; Yang, J.; Fang, S.; Wang, Q.; Li, M.; Guo, L. WW domain binding protein 5 induces multidrug resistance of small cell lung cancer under the regulation of miR-335 through the Hippo pathway. Br. J. Cancer 2016, 115, 243–251. [Google Scholar] [CrossRef]
- Gylfe, A.E.; Kondelin, J.; Turunen, M.; Ristolainen, H.; Katainen, R.; Pitkanen, E.; Kaasinen, E.; Rantanen, V.; Tanskanen, T.; Varjosalo, M.; et al. Identification of candidate oncogenes in human colorectal cancers with microsatellite instability. Gastroenterology 2013, 145, 540–543.e522. [Google Scholar] [CrossRef] [PubMed]
- Domschke, G.; Linden, F.; Pawig, L.; Hafner, A.; Akhavanpoor, M.; Reymann, J.; Doesch, A.O.; Erbel, C.; Weber, C.; Katus, H.A.; et al. Systematic RNA-interference in primary human monocyte-derived macrophages: A high-throughput platform to study foam cell formation. Sci. Rep. 2018, 8, 10516. [Google Scholar] [CrossRef] [PubMed]
- Suh, Y.S.; Yu, J.; Kim, B.C.; Choi, B.; Han, T.S.; Ahn, H.S.; Kong, S.H.; Lee, H.J.; Kim, W.H.; Yang, H.K. Overexpression of Plasminogen Activator Inhibitor-1 in Advanced Gastric Cancer with Aggressive Lymph Node Metastasis. Cancer Res. Treat. 2015, 47, 718–726. [Google Scholar] [CrossRef] [PubMed]
- Qian, Y.; Pan, Z.; Guo, Z.; Ge, X.; Zheng, G.; Cao, J.; Huang, P.; Zhu, X.; Zhu, X.; Wen, Q.; et al. Clinicopathological and Prognostic Significance of WW Domain Binding Protein 5 Expression in Papillary Thyroid Carcinoma. Biomed. Res. Int. 2019, 2019, 1791065. [Google Scholar] [CrossRef] [PubMed]
- Maiti, G.P.; Mondal, P.; Mukherjee, N.; Ghosh, A.; Ghosh, S.; Dey, S.; Chakrabarty, J.; Roy, A.; Biswas, J.; Roychoudhury, S.; et al. Overexpression of EGFR in head and neck squamous cell carcinoma is associated with inactivation of SH3GL2 and CDC25A genes. PLoS ONE 2013, 8, e63440. [Google Scholar] [CrossRef]
- Jeong, E.J.; Kim, E.; Kim, Y.S. Identification of novel therapeutic targets for head and neck squamous cell carcinoma through bioinformatics analysis. Sci. Rep. 2024, 14, 32102. [Google Scholar] [CrossRef] [PubMed]
- Ge, H.; Ferris, R.L.; Wang, J.H. Cetuximab Responses in Patients with HNSCC Correlate to Clonal Expansion Feature of Peripheral and Tumor-Infiltrating T Cells with Top T-Cell Receptor Clonotypes. Clin. Cancer Res. 2023, 29, 647–658. [Google Scholar] [CrossRef]
- Vermorken, J.B.; Mesia, R.; Rivera, F.; Remenar, E.; Kawecki, A.; Rottey, S.; Erfan, J.; Zabolotnyy, D.; Kienzer, H.R.; Cupissol, D.; et al. Platinum-based chemotherapy plus cetuximab in head and neck cancer. N. Engl. J. Med. 2008, 359, 1116–1127. [Google Scholar] [CrossRef] [PubMed]
- Adelstein, D.J.; Li, Y.; Adams, G.L.; Wagner, H., Jr.; Kish, J.A.; Ensley, J.F.; Schuller, D.E.; Forastiere, A.A. An intergroup phase III comparison of standard radiation therapy and two schedules of concurrent chemoradiotherapy in patients with unresectable squamous cell head and neck cancer. J. Clin. Oncol. 2003, 21, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Bernier, J.; Cooper, J.S.; Pajak, T.F.; van Glabbeke, M.; Bourhis, J.; Forastiere, A.; Ozsahin, E.M.; Jacobs, J.R.; Jassem, J.; Ang, K.K.; et al. Defining risk levels in locally advanced head and neck cancers: A comparative analysis of concurrent postoperative radiation plus chemotherapy trials of the EORTC (#22931) and RTOG (# 9501). Head Neck 2005, 27, 843–850. [Google Scholar] [CrossRef] [PubMed]
- Lacas, B.; Carmel, A.; Landais, C.; Wong, S.J.; Licitra, L.; Tobias, J.S.; Burtness, B.; Ghi, M.G.; Cohen, E.E.W.; Grau, C.; et al. Meta-analysis of chemotherapy in head and neck cancer (MACH-NC): An update on 107 randomized trials and 19,805 patients, on behalf of MACH-NC Group. Radiother Oncol. 2021, 156, 281–293. [Google Scholar] [CrossRef] [PubMed]
- Faraji, F.; Ramirez, S.I.; Anguiano Quiroz, P.Y.; Mendez-Molina, A.N.; Gutkind, J.S. Genomic Hippo Pathway Alterations and Persistent YAP/TAZ Activation: New Hallmarks in Head and Neck Cancer. Cells 2022, 11, 1370. [Google Scholar] [CrossRef]
- Tang, Z.; Kang, B.; Li, C.; Chen, T.; Zhang, Z. GEPIA2: An enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019, 47, W556–W560. [Google Scholar] [CrossRef]
- Tang, Z.; Li, C.; Kang, B.; Gao, G.; Li, C.; Zhang, Z. GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017, 45, W98–W102. [Google Scholar] [CrossRef]
- Garrido, A.; Kim, E.; Teijeiro, A.; Sanchez Sanchez, P.; Gallo, R.; Nair, A.; Matamala Montoya, M.; Perna, C.; Vicent, G.P.; Munoz, J.; et al. Histone acetylation of bile acid transporter genes plays a critical role in cirrhosis. J. Hepatol. 2022, 76, 850–861. [Google Scholar] [CrossRef] [PubMed]
- Lobert, S.; Graichen, M.E.; Hamilton, R.D.; Pitman, K.T.; Garrett, M.R.; Hicks, C.; Koganti, T. Prognostic biomarkers for HNSCC using quantitative real-time PCR and microarray analysis: Beta-tubulin isotypes and the p53 interactome. Cytoskeleton 2014, 71, 628–637. [Google Scholar] [CrossRef]
- Kondratyev, M.; Pesic, A.; Ketela, T.; Stickle, N.; Beswick, C.; Shalev, Z.; Marastoni, S.; Samadian, S.; Dvorkin-Gheva, A.; Sayad, A.; et al. Identification of acquired Notch3 dependency in metastatic Head and Neck Cancer. Commun. Biol. 2023, 6, 538. [Google Scholar] [CrossRef] [PubMed]
- Stansfield, J.C.; Rusay, M.; Shan, R.; Kelton, C.; Gaykalova, D.A.; Fertig, E.J.; Califano, J.A.; Ochs, M.F. Toward Signaling-Driven Biomarkers Immune to Normal Tissue Contamination. Cancer Inform. 2016, 15, 15–21. [Google Scholar] [CrossRef]
- Hou, G.X.; Liu, P.; Yang, J.; Wen, S. Mining expression and prognosis of topoisomerase isoforms in non-small-cell lung cancer by using Oncomine and Kaplan-Meier plotter. PLoS ONE 2017, 12, e0174515. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.; Varambally, S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia 2017, 19, 649–658. [Google Scholar] [CrossRef]
- Chandrashekar, D.S.; Karthikeyan, S.K.; Korla, P.K.; Patel, H.; Shovon, A.R.; Athar, M.; Netto, G.J.; Qin, Z.S.; Kumar, S.; Manne, U.; et al. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia 2022, 25, 18–27. [Google Scholar] [CrossRef]
- Bartha, A.; Gyorffy, B. TNMplot.com: A Web Tool for the Comparison of Gene Expression in Normal, Tumor and Metastatic Tissues. Int. J. Mol. Sci. 2021, 22, 2622. [Google Scholar] [CrossRef]
- Jeong, E.J.; Choi, J.J.; Lee, S.Y.; Kim, Y.S. The Effects of ML385 on Head and Neck Squamous Cell Carcinoma: Implications for NRF2 Inhibition as a Therapeutic Strategy. Int. J. Mol. Sci. 2024, 25, 7011. [Google Scholar] [CrossRef] [PubMed]
- Killinger, M.; Vesela, B.; Prochazkova, M.; Matalova, E.; Kleparnik, K. A single-cell analytical approach to quantify activated caspase-3/7 during osteoblast proliferation, differentiation, and apoptosis. Anal. Bioanal. Chem. 2021, 413, 5085–5093. [Google Scholar] [CrossRef] [PubMed]
- Ledvina, V.; Janeckova, E.; Matalova, E.; Kleparnik, K. Parallel single-cell analysis of active caspase-3/7 in apoptotic and non-apoptotic cells. Anal. Bioanal. Chem. 2017, 409, 269–274. [Google Scholar] [CrossRef]
- Kang, Y.S.; Jeong, E.J.; Seok, H.J.; Kim, S.K.; Hwang, J.S.; Choi, M.L.; Jo, D.G.; Kim, Y.; Choi, J.; Lee, Y.J.; et al. Cks1 regulates human hepatocellular carcinoma cell progression through osteopontin expression. Biochem. Biophys. Res. Commun. 2019, 508, 275–281. [Google Scholar] [CrossRef] [PubMed]








| Reference | GEO | Platform | Sample | Normal | Tumor | Metastasis |
|---|---|---|---|---|---|---|
| Lobert et al. [20] | GSE58911 | GPL6244 | Head and neck squamous cell carcinoma | 15 | 15 | |
| Cheng et al. [21] | GSE178537 | GPL16791 GPL18573 | Head and neck squamous cell carcinoma | 20 | 19 | 9 |
| Stansfield et al. [22] | GSE33232 | GPL5175 | Head and neck squamous cell carcinoma | 25 | 44 |
| Gene | Sense | Antisense |
|---|---|---|
| siWBP5 | CUGGUCAUCUGGUCCUUGU | ACAAGGACCAGAUUACCAG |
| Gene | Sense | Antisense |
|---|---|---|
| WBP5 | AGCTAGAGGAGGAGGCCAAA | TCCTGGAGAGATTGAATCAGCC |
| β-actin | TCCTCTCCCAAGTCCACACAGG | GGGCACGAAGGCTCATCATTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeong, E.-j.; Kim, E.; Jung, K.-Y.; Baek, S.-K.; Kim, Y.S. WBP5 Expression Influences Prognosis and Treatment Response in Head and Neck Squamous Cell Carcinoma. Cancers 2025, 17, 587. https://doi.org/10.3390/cancers17040587
Jeong E-j, Kim E, Jung K-Y, Baek S-K, Kim YS. WBP5 Expression Influences Prognosis and Treatment Response in Head and Neck Squamous Cell Carcinoma. Cancers. 2025; 17(4):587. https://doi.org/10.3390/cancers17040587
Chicago/Turabian StyleJeong, Eun-jeong, Eunjeong Kim, Kwang-Yoon Jung, Seung-Kuk Baek, and Yeon Soo Kim. 2025. "WBP5 Expression Influences Prognosis and Treatment Response in Head and Neck Squamous Cell Carcinoma" Cancers 17, no. 4: 587. https://doi.org/10.3390/cancers17040587
APA StyleJeong, E.-j., Kim, E., Jung, K.-Y., Baek, S.-K., & Kim, Y. S. (2025). WBP5 Expression Influences Prognosis and Treatment Response in Head and Neck Squamous Cell Carcinoma. Cancers, 17(4), 587. https://doi.org/10.3390/cancers17040587

