ZFP64 Promotes Gallbladder Cancer Progression through Recruiting HDAC1 to Activate NOTCH1 Signaling Pathway
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Human Specimens and Cell Culture
2.2. Construction of Stable Cell Lines
2.3. Reverse Transcription and Quantitative Real-Time PCR (RT-qPCR)
- ZFP64 forward: GATGCCTTTGTAGCTCACAAGC
- ZFP64 reverse: GTCTGGGTCTCCGAGGTGAT
- NUMB forward: GCAGCAGACATTCCCTCACT
- NUMB reverse: AGAACCGTTGAGGTGCTGAG
2.4. Western Blot
2.5. Immunofluorescence Staining
2.6. Cell Migration and Invasion Assay
2.7. Cell Proliferation Assay (EdU)
2.8. Chromatin Immunoprecipitation (ChIP)-qPCR Assay
2.9. Co-Immunoprecipitation (Co-IP) Assay
2.10. Mouse Subcutaneous Xenograft Model
2.11. Statistical Analysis
3. Results
3.1. ZFP64 Is Overexpressed in GBC Patients and Associated with Poor Prognosis
3.2. ZFP64 Promotes Gallbladder Cancer Progression In Vitro and In Vivo
3.3. ZFP64 Activates Notch1 Signaling Pathways
3.4. ZFP64 Promotes Gallbladder Cancer Proliferation, Migration, and Invasion In Vitro via Activating Notch1 Signaling Pathway
3.5. ZFP64 Activates the Notch1 Signaling Pathway by Recruiting HDAC1 to Inhibit NUMB Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sturm, N.; Schuhbaur, J.S.; Hüttner, F.; Perkhofer, L.; Ettrich, T.J. Gallbladder Cancer: Current Multimodality Treatment Concepts and Future Directions. Cancers 2022, 14, 5580. [Google Scholar] [CrossRef] [Scilit]
- Roa, J.C.; García, P.; Kapoor, V.K.; Maithel, S.K.; Javle, M.; Koshiol, J. Gallbladder cancer. Nat. Rev. Dis. Prim. 2022, 8, 69. [Google Scholar] [CrossRef] [Scilit]
- Cai, Q.; Wang, S.; Jin, L.; Weng, M.; Zhou, D.; Wang, J.; Tang, Z.; Quan, Z. Long non-coding RNA GBCDRlnc1 induces chemoresistance of gallbladder cancer cells by activating autophagy. Mol. Cancer 2019, 18, 82. [Google Scholar] [CrossRef] [Scilit]
- Lv, Y.; Yin, W.; Zhang, Z. Non-coding RNAs as potential biomarkers of gallbladder cancer. Clin. Transl. Oncol. 2022, 25, 1489–1511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradner, J.E.; Hnisz, D.; Young, R.A. Transcriptional Addiction in Cancer. Cell 2017, 168, 629–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Han, M.; Zhang, H.; Liu, F.; Pan, Y.; Zhu, J.; Liao, Z.; Chen, X.; Zhang, B. Structures and biological functions of zinc finger proteins and their roles in hepatocellular carcinoma. Biomark. Res. 2022, 10, 2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Wang, Y.; Dai, Y.; Wang, J.; Suo, T.; Pan, H.; Liu, H.; Shen, S.; Liu, H. CIZ1 promoted the growth and migration of gallbladder cancer cells. Tumour Biol. 2015, 36, 2583–2591. [Google Scholar] [CrossRef] [Scilit]
- Mack, H.G.; Beck, F.; Bowtell, D.D. A search for a mammalian homologue of the Drosophila photoreceptor development gene glass yields Zfp64, a zinc finger encoding gene which maps to the distal end of mouse chromosome 2. Gene 1997, 185, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Sakamoto, K.; Tamamura, Y.; Katsube, K.-I.; Yamaguchi, A. Zfp64 participates in Notch signaling and regulates differentiation in mesenchymal cells. J. Cell Sci. 2008, 121, 1613–1623. [Google Scholar] [CrossRef] [Scilit]
- Qiu, G.; Deng, Y. ZFP64 transcriptionally activates PD-1 and CTLA-4 and plays an oncogenic role in esophageal cancer. Biochem. Biophys. Res. Commun. 2022, 622, 72–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, C.-Y.; Zhu, M.-X.; Zhang, P.-F.; Huang, X.-Y.; Wan, J.-K.; Yao, X.-Z.; Hu, Z.-T.; Chai, X.-Q.; Peng, R.; Yang, X.; et al. PKCα/ZFP64/CSF1 axis resets the tumor microenvironment and fuels anti-PD1 resistance in hepatocellular carcinoma. J. Hepatol. 2022, 77, 163–176. [Google Scholar] [CrossRef] [Scilit]
- Lu, B.; Klingbeil, O.; Tarumoto, Y.; Somerville, T.D.D.; Huang, Y.-H.; Wei, Y.; Wai, D.C.; Low, J.K.K.; Milazzo, J.P.; Wu, X.S.; et al. A Transcription Factor Addiction in Leukemia Imposed by the MLL Promoter Sequence. Cancer Cell 2018, 34, 970–981.e978. [Google Scholar] [CrossRef] [Scilit]
- Zhu, M.; Zhang, P.; Yu, S.; Tang, C.; Wang, Y.; Shen, Z.; Chen, W.; Liu, T.; Cui, Y. Targeting ZFP64/GAL-1 axis promotes therapeutic effect of nab-paclitaxel and reverses immunosuppressive microenvironment in gastric cancer. J. Exp. Clin. Cancer Res. 2022, 41, 14. [Google Scholar] [CrossRef] [Scilit]
- Zhou, B.; Lin, W.; Long, Y.; Yang, Y.; Zhang, H.; Wu, K.; Chu, Q. Notch signaling pathway: Architecture, disease, and therapeutics. Signal Transduct. Target. Ther. 2022, 7, 95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gan, R.-H.; Wei, H.; Xie, J.; Zheng, D.-P.; Luo, E.-L.; Huang, X.-Y.; Xie, J.; Zhao, Y.; Ding, L.-C.; Su, B.-H.; et al. Notch1 regulates tongue cancer cells proliferation, apoptosis and invasion. Cell Cycle 2018, 17, 216–224. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.; Xu, Z.; Xie, J.; Deng, X.; Jiang, L.; Chen, H.; Peng, C.; Li, H.; Zhang, J.; Shen, B. Oncogene APOL1 promotes proliferation and inhibits apoptosis via activating NOTCH1 signaling pathway in pancreatic cancer. Cell Death Dis. 2021, 12, 760. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.-S.; Zhang, Z.-G.; Du, G.-Y.; Sun, H.-L.; Liu, H.-Y.; Zhou, Z.; Gou, X.-M.; Wu, X.-H.; Yu, X.-Y.; Huang, Y.-H. Nrf2 promotes breast cancer cell migration via up-regulation of G6PD/HIF-1α/Notch1 axis. J. Cell. Mol. Med. 2019, 23, 3451–3463. [Google Scholar] [CrossRef] [Scilit]
- Rampias, T.; Vgenopoulou, P.; Avgeris, M.; Polyzos, A.; Stravodimos, K.; Valavanis, C.; Scorilas, A.; Klinakis, A. A new tumor suppressor role for the Notch pathway in bladder cancer. Nat. Med. 2014, 20, 1199–1205. [Google Scholar] [CrossRef] [Scilit]
- McGill, M.A.; McGlade, C.J. Mammalian Numb Proteins Promote Notch1 Receptor Ubiquitination and Degradation of the Notch1 Intracellular Domain. J. Biol. Chem. 2003, 278, 23196–23203. [Google Scholar] [CrossRef] [Scilit]
- McGill, M.A.; Dho, S.E.; Weinmaster, G.; McGlade, C.J. Numb Regulates Post-endocytic Trafficking and Degradation of Notch1. J. Biol. Chem. 2009, 284, 26427–26438. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.; Yang, Z.-L.; Wang, C.; Miao, X.; Liu, Z.; Li, D.; Zou, Q.; Li, J.; Liang, L.; Zeng, G.; et al. The Expression of Notch 1 and Notch 3 in Gallbladder Cancer and Their Clinicopathological Significance. Pathol. Oncol. Res. 2016, 22, 483–492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopan, R.; Ilagan, M.X.G. The Canonical Notch Signaling Pathway: Unfolding the Activation Mechanism. Cell 2009, 137, 216–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Witt, O.; Deubzer, H.E.; Milde, T.; Oehme, I. HDAC family: What are the cancer relevant targets? Cancer Lett. 2009, 277, 8–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreno-Yruela, C.; Zhang, D.; Wei, W.; Bæk, M.; Liu, W.; Gao, J.; Danková, D.; Nielsen, A.L.; Bolding, J.E.; Yang, L.; et al. Class I histone deacetylases (HDAC1–3) are histone lysine delactylases. Sci. Adv. 2022, 8, eabi6696. [Google Scholar] [CrossRef] [Scilit]
- Ertel, A.E.; Bentrem, D.; Abbott, D.E. Gall Bladder Cancer. Cancer Treat. Res. 2016, 168, 101–120. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.; He, M.; Lin, R.; Zhan, M.; Xu, S.; Huang, X.; Xu, C.; Chen, W.; Yao, Y.; Mohan, M.; et al. PLEK2 promotes gallbladder cancer invasion and metastasis through EGFR/CCL2 pathway. J. Exp. Clin. Cancer Res. 2019, 38, 247. [Google Scholar] [CrossRef] [Scilit]
- Audia, J.E.; Campbell, R.M. Histone Modifications and Cancer. Cold Spring Harb. Perspect. Biol. 2016, 8, a019521. [Google Scholar] [CrossRef] [Scilit]
- Seto, E.; Yoshida, M. Erasers of Histone Acetylation: The Histone Deacetylase Enzymes. Cold Spring Harb. Perspect. Biol. 2014, 6, a018713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiao, W.; Liu, H.; Liu, R.; Liu, Q.; Zhang, T.; Guo, W.; Li, P.; Deng, M. Prognostic and clinical significance of histone deacetylase 1 expression in breast cancer: A meta-analysis. Clin. Chim. Acta 2018, 483, 209–215. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Bu, L.; Hu, J.; Xu, Z.; Ruan, L.; Fang, Y.; Wang, P. HDAC1 knockdown inhibits invasion and induces apoptosis in non-small cell lung cancer cells. Biol. Chem. 2018, 399, 603–610. [Google Scholar] [CrossRef] [Scilit]
- Zhang, N.; Zhang, H.; Liu, Y.; Su, P.; Zhang, J.; Wang, X.; Sun, M.; Chen, B.; Zhao, W.; Wang, L.; et al. SREBP1, targeted by miR-18a-5p, modulates epithelial-mesenchymal transition in breast cancer via forming a co-repressor complex with Snail and HDAC1/2. Cell Death Differ. 2019, 26, 843–859. [Google Scholar] [CrossRef] [Scilit]
- Rivas, M.; Johnston, M.E., 2nd; Gulati, R.; Kumbaji, M.; Aguiar, T.F.M.; Timchenko, L.; Krepischi, A.; Shin, S.; Bondoc, A.; Tiao, G.; et al. HDAC1-Dependent Repression of Markers of Hepatocytes and P21 Is Involved in Development of Pediatric Liver Cancer. Cell. Mol. Gastroenterol. Hepatol. 2021, 12, 1669–1682. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.-Y.; Tang, D.-W.; Liu, C.-Y.; Cho, E.-C. A novel HDAC1/2 inhibitor suppresses colorectal cancer through apoptosis induction and cell cycle regulation. Chem. Biol. Interact. 2022, 352, 109778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sixto-López, Y.; Gómez-Vidal, J.A.; de Pedro, N.; Bello, M.; Rosales-Hernández, M.C.; Correa-Basurto, J. Hydroxamic acid derivatives as HDAC1, HDAC6 and HDAC8 inhibitors with antiproliferative activity in cancer cell lines. Sci. Rep. 2020, 10, 10462. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Shen, S.; Lu, W.; Zhou, Y.; Hou, Y.; Zhang, Y.; Jiang, Y.; Liu, H.; Shao, Y. HDAC1 promoted migration and invasion binding with TCF12 by promoting EMT progress in gallbladder cancer. Oncotarget 2016, 7, 32754–32764. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Li, F.; Pan, L.; Yang, Z.; Shu, Y.; Lv, W.; Dong, P.; Gong, W. BRD4 inhibitor and histone deacetylase inhibitor synergistically inhibit the proliferation of gallbladder cancer in vitro and in vivo. Cancer Sci. 2019, 110, 2493–2506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Tang, Z.; Huang, H.; Zhou, G.; Cui, C.; Weng, Y.; Liu, W.; Kim, S.; Lee, S.; Perez-Neut, M.; et al. Metabolic regulation of gene expression by histone lactylation. Nature 2019, 574, 575–580. [Google Scholar] [CrossRef] [Scilit]
- Liberti, M.V.; Locasale, J.W. The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Y.; Hu, H.; Liu, M.; Zhou, T.; Cheng, X.; Huang, W.; Cao, L. The role and mechanism of histone lactylation in health and diseases. Front. Genet. 2022, 13, 949252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Chai, P.; Xie, M.; Ge, S.; Ruan, J.; Fan, X.; Jia, R. Histone lactylation drives oncogenesis by facilitating m6A reader protein YTHDF2 expression in ocular melanoma. Genome Biol. 2021, 22, 85. [Google Scholar] [CrossRef] [Scilit]
- Pan, L.; Feng, F.; Wu, J.; Fan, S.; Han, J.; Wang, S.; Yang, L.; Liu, W.; Wang, C.; Xu, K. Demethylzeylasteral targets lactate by inhibiting histone lactylation to suppress the tumorigenicity of liver cancer stem cells. Pharmacol. Res. 2022, 181, 106270. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Primer Names | Sequences |
|---|---|
| NUMB BS1 forward | TGGCGTATTGAGAGTTCTCC |
| NUMB BS1 reverse | AACCTGGGAGGCGTAGGTTGC |
| NUMB BS2 forward | TAGCTGGGATTATAGGCATGA |
| NUMB BS2 reverse | GCAGAATTCTCATTTCCAG |
| NUMB BS3 forward | CATGCCTGTTATCCCAGCACT |
| NUMB BS3 reverse | CTTTGTCTCTCTTTCTTCTTTCT |
| Clinicopathological Features | ZFP64 Expression | ||||
|---|---|---|---|---|---|
| Cases | Low | High | p Value | ||
| Age | <60 | 22 | 12 | 10 | 0.569 |
| ≥60 | 28 | 13 | 15 | ||
| Gender | Male | 20 | 11 | 9 | 0.564 |
| Female | 30 | 14 | 15 | ||
| CA19-9 level | ≤37 U/mL | 31 | 21 | 10 | 0.001 |
| >37 U/mL | 19 | 4 | 15 | ||
| Tumor size | ≤3 cm | 30 | 18 | 12 | 0.083 |
| >3 cm | 20 | 7 | 13 | ||
| Hepatic invasion | No | 26 | 19 | 7 | 0.002 |
| Yes | 24 | 6 | 18 | ||
| Lymph node metastasis | No | 26 | 19 | 7 | 0.002 |
| Yes | 24 | 6 | 18 | ||
| Neuro invasion | No | 38 | 24 | 14 | 0.001 |
| Yes | 12 | 1 | 11 | ||
| Vascular invasion | No | 45 | 25 | 0 | 0.059 |
| Yes | 5 | 0 | 5 | ||
| Tumor differentiation | High moderate | 29 | 18 | 11 | 0.045 |
| Low moderate | 21 | 7 | 14 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Z.; Zhong, Y.; Hu, H.; Li, F. ZFP64 Promotes Gallbladder Cancer Progression through Recruiting HDAC1 to Activate NOTCH1 Signaling Pathway. Cancers 2023, 15, 4508. https://doi.org/10.3390/cancers15184508
He Z, Zhong Y, Hu H, Li F. ZFP64 Promotes Gallbladder Cancer Progression through Recruiting HDAC1 to Activate NOTCH1 Signaling Pathway. Cancers. 2023; 15(18):4508. https://doi.org/10.3390/cancers15184508
Chicago/Turabian StyleHe, Zhiqiang, Yuhan Zhong, Haijie Hu, and Fuyu Li. 2023. "ZFP64 Promotes Gallbladder Cancer Progression through Recruiting HDAC1 to Activate NOTCH1 Signaling Pathway" Cancers 15, no. 18: 4508. https://doi.org/10.3390/cancers15184508
APA StyleHe, Z., Zhong, Y., Hu, H., & Li, F. (2023). ZFP64 Promotes Gallbladder Cancer Progression through Recruiting HDAC1 to Activate NOTCH1 Signaling Pathway. Cancers, 15(18), 4508. https://doi.org/10.3390/cancers15184508
