Prognostic Value of IGF2 mRNA-Binding Protein 3 (IGF2BP3) Intratumoral Expression in Melanoma Patients at the Time of Diagnosis: Comparative Analysis of RT-qPCR Versus Immunohistochemistry
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Human Melanoma Tissues
2.2. IGF2BP3 Immunohistochemical Analysis
2.3. RNA Extraction
2.4. IGF2BP3 mRNA Quantification by RT-qPCR
2.5. miRNAs Quantification by RT-qPCR
2.6. Statistical Analysis
3. Results
3.1. IGF2BP3 mRNA and Protein Follow the Same Expression Pattern and Correlate with Conventional Clinicopathologic Prognostic Factors in Human Primary Melanomas
3.2. IGF2BP3 Expression in Primary Melanoma Tumors Is Associated with Metastasis Development and Progression and with Melanoma-Specific Survival
3.3. IGF2BP3 mRNA Has a Prognostic Value for DMFS and MSS but Does Not Predict Distant Metastasis Onset
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer Statistics, 2017. CA Cancer J. Clin. 2017, 67, 7–30. [Google Scholar] [CrossRef]
- Frampton, A.E.; Sivakumar, S. A New Combination Immunotherapy in Advanced Melanoma. N. Engl. J. Med. 2022, 386, 91–92. [Google Scholar] [CrossRef]
- Sánchez-Sendra, B.; Martinez-Ciarpaglini, C.; González-Muñoz, J.F.; Murgui, A.; Terrádez, L.; Monteagudo, C. Downregulation of Intratumoral Expression of MiR-205, MiR-200c and MiR-125b in Primary Human Cutaneous Melanomas Predicts Shorter Survival. Sci. Rep. 2018, 8, 17076. [Google Scholar] [CrossRef]
- Amin, M.B.; Greene, F.L.; Edge, S.B.; Compton, C.C.; Gershenwald, J.E.; Brookland, R.K.; Meyer, L.; Gress, D.M.; Byrd, D.R.; Winchester, D.P. The Eighth Edition AJCC Cancer Staging Manual: Continuing to Build a Bridge from a Population-Based to a More “Personalized” Approach to Cancer Staging. CA Cancer J. Clin. 2017, 67, 93–99. [Google Scholar] [CrossRef]
- Latchana, N.; Ganju, A.; Howard, J.H.; Carson, W.E. MicroRNA Dysregulation in Melanoma. Surg. Oncol. 2016, 25, 184–189. [Google Scholar] [CrossRef]
- Glud, M.; Gniadecki, R. MicroRNAs in the Pathogenesis of Malignant Melanoma. J. Eur. Acad. Dermatol. Venereol. 2013, 27, 142–150. [Google Scholar] [CrossRef]
- Mirzaei, H.; Gholamin, S.; Shahidsales, S.; Sahebkar, A.; Jafaari, M.R.; Mirzaei, H.R.; Hassanian, S.M.; Avan, A. MicroRNAs as Potential Diagnostic and Prognostic Biomarkers in Melanoma. Eur. J. Cancer 2016, 53, 25–32. [Google Scholar] [CrossRef]
- Jayawardana, K.; Schramm, S.J.; Tembe, V.; Mueller, S.; Thompson, J.F.; Scolyer, R.A.; Mann, G.J.; Yang, J. Identification, Review, and Systematic Cross-Validation of MicroRNA Prognostic Signatures in Metastatic Melanoma. J. Investig. Dermatol. 2016, 136, 245–254. [Google Scholar] [CrossRef]
- Van Kempen, L.C.; van den Hurk, K.; Lazar, V.; Michiels, S.; Winnepenninckx, V.; Stas, M.; Spatz, A.; van den Oord, J.J. Loss of MicroRNA-200a and c, and MicroRNA-203 Expression at the Invasive Front of Primary Cutaneous Melanoma Is Associated with Increased Thickness and Disease Progression. Virchows Arch. 2012, 461, 441–448. [Google Scholar] [CrossRef]
- Teixido, C.; Castillo, P.; Martinez-Vila, C.; Arance, A.; Alos, L. Molecular Markers and Targets in Melanoma. Cells 2021, 10, 2320. [Google Scholar] [CrossRef]
- Sheen, Y.S.; Liao, Y.H.; Lin, M.H.; Chu, C.Y.; Ho, B.Y.; Hsieh, M.C.; Chen, P.C.; Cha, S.T.; Jeng, Y.M.; Chang, C.C.; et al. IMP-3 Promotes Migration and Invasion of Melanoma Cells by Modulating the Expression of HMGA2 and Predicts Poor Prognosis in Melanoma. J. Investig. Dermatol. 2015, 135, 1065–1073. [Google Scholar] [CrossRef]
- Sheen, Y.S.; Liao, Y.H.; Lin, M.H.; Chiu, H.C.; Jee, S.H.; Liau, J.Y.; Chang, Y.L.; Chue, C.Y. Insulin-like Growth Factor II MRNA-Binding Protein 3 Expression Correlates with Poor Prognosis in Acral Lentiginous Melanoma. PLoS ONE 2016, 11, e0147431. [Google Scholar] [CrossRef]
- Seo, J.W.; Ha, S.M.; Song, K.H. Insulin-like Growth Factor-2 MRNA-Binding Protein 3 as a Novel Prognostic Biomarker for Acral Lentiginous Melanoma. Br. J. Dermatol. 2018, 178, e268–e270. [Google Scholar] [CrossRef]
- Seo, J.W.; Ha, S.M.; Song, K.H. Feasibility of IMP-3 as an Invasiveness Marker for Acral Lentiginous Melanoma. Ann. Dermatol. 2018, 30, 496–499. [Google Scholar] [CrossRef]
- Hanniford, D.; Ulloa-Morales, A.; Karz, A.; Berzoti-Coelho, M.G.; Moubarak, R.S.; Sánchez-Sendra, B.; Kloetgen, A.; Davalos, V.; Imig, J.; Wu, P.; et al. Epigenetic Silencing of CDR1as Drives IGF2BP3-Mediated Melanoma Invasion and Metastasis. Cancer Cell 2020, 37, 55–70. [Google Scholar] [CrossRef]
- Mueller-Pillasch, F.; Pohl, B.; Wilda, M.; Lacher, U.; Beil, M.; Wallrapp, C.; Hameister, H.; Knöchel, W.; Adler, G.; Gress, T.M. Expression of the Highly Conserved RNA Binding Protein KOC in Embryogenesis. Mech. Dev. 1999, 88, 95–99. [Google Scholar] [CrossRef]
- Mancarella, C.; Scotlandi, K. IGF2BP3 From Physiology to Cancer: Novel Discoveries, Unsolved Issues, and Future Perspectives. Front. Cell Dev. Biol. 2020, 7, 363. [Google Scholar] [CrossRef]
- Hoffmann, N.E.; Sheinin, Y.; Lohse, C.M.; Parker, A.S.; Leibovich, B.C.; Jiang, Z.; Kwon, E.D. External Validation of IMP3 Expression as an Independent Prognostic Marker for Metastatic Progression and Death for Patients with Clear Cell Renal Cell Carcinoma. Cancer 2008, 112, 1471–1479. [Google Scholar] [CrossRef]
- Vikesaa, J.; Hansen, T.V.O.; Jønson, L.; Borup, R.; Wewer, U.M.; Christiansen, J.; Nielsen, F.C. RNA-Binding IMPs Promote Cell Adhesion and Invadopodia Formation. EMBO J. 2006, 25, 1456–1468. [Google Scholar] [CrossRef]
- Lu, D.; Yang, X.; Jiang, N.Y.; Woda, B.A.; Liu, Q.; Dresser, K.; Mercurio, A.M.; Rock, K.L.; Jiang, Z. IMP3, a New Biomarker to Predict Progression of Cervical Intraepithelial Neoplasia into Invasive Cancer. Am. J. Surg. Pathol. 2011, 35, 1638–1645. [Google Scholar] [CrossRef]
- Jiang, Z.; Chu, P.G.; Woda, B.A.; Liu, Q.; Balaji, K.C.; Rock, K.L.; Wu, C.L. Combination of Quantitative IMP3 and Tumor Stage: A New System to Predict Metastasis for Patients with Localized Renal Cell Carcinomas. Clin. Cancer Res. 2008, 14, 5579–5584. [Google Scholar] [CrossRef] [PubMed]
- Del Gobbo, A.; Vaira, V.; Ferrari, L.; Patriarca, C.; di Cristofori, A.; Ricca, D.; Caroli, M.; Rampini, P.; Bosari, S.; Ferrero, S. The Oncofetal Protein IMP3: A Novel Grading Tool and Predictor of Poor Clinical Outcome in Human Gliomas. Biomed. Res. Int. 2015, 2015, 413897. [Google Scholar] [CrossRef] [PubMed]
- Pryor, J.G.; Bourne, P.A.; Yang, Q.; Spaulding, B.O.; Scott, G.A.; Xu, H. IMP-3 Is a Novel Progression Marker in Malignant Melanoma. Mod. Pathol. 2008, 21, 431–437. [Google Scholar] [CrossRef]
- Yu, L.; Xu, H.; Wasco, M.J.; Bourne, P.A.; Ma, L. IMP-3 Expression in Melanocytic Lesions. J. Cutan. Pathol. 2010, 37, 316–322. [Google Scholar] [CrossRef] [PubMed]
- Ramos, D.; Pellín-Carcelén, A.; Agustí, J.; Murgui, A.; Jordá, E.; Pellín, A.; Monteagudo, C. Deregulation of glyceraldehyde-3-phosphate dehydrogenase expression during tumor progression of human cutaneous melanoma. Anticancer Res. 2015, 35, 439–444. [Google Scholar] [PubMed]
- Goidin, D.; Mamessier, A.; Staquet, M.J.; Schmitt, D.; Berthier-Vergnes, O. Ribosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and beta-actin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulations. Anal. Biochem. 2001, 295, 17–21. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Envieronment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.r-project.org/ (accessed on 17 December 2020).
- Dimitriou, F.; Krattinger, R.; Ramelyte, E.; Barysch, M.J.; Micaletto, S.; Dummer, R.; Goldinger, S.M. The World of Melanoma: Epidemiologic, Genetic, and Anatomic Differences of Melanoma across the Globe. Curr. Oncol. Rep. 2018, 20, 87. [Google Scholar] [CrossRef]
- Bell, A.W.; Deutsch, E.W.; Au, C.E.; Kearney, R.E.; Beavis, R.; Sechi, S.; Nilsson, T.; Bergeron, J.J.M.; Beardslee, T.A.; Chappell, T.; et al. A HUPO Test Sample Study Reveals Common Problems in Mass Spectrometry-Based Proteomics. Nat. Methods 2009, 6, 423–430. [Google Scholar] [CrossRef]
- Byron, S.A.; van Keuren-Jensen, K.R.; Engelthaler, D.M.; Carpten, J.D.; Craig, D.W. Translating RNA Sequencing into Clinical Diagnostics: Opportunities and Challenges. Nat. Rev. Genet. 2016, 17, 257–271. [Google Scholar] [CrossRef]
- Mook, S.; Veer, L.J.V.; Rugerts, E.J.T.; Piccart-Gebhart, M.J.; Cardoso, F. Individualization of Therapy Using Mammaprint: From Development to the MINDACT Trial. Cancer Genom. Proteom. 2007, 4, 147–155. [Google Scholar]
- Salazar, R.; Roepman, P.; Capella, G.; Moreno, V.; Simon, I.; Dreezen, C.; Lopez-Doriga, A.; Santos, C.; Marijnen, C.; Westerga, J.; et al. Gene Expression Signature to Improve Prognosis Prediction of Stage II and III Colorectal Cancer. J. Clin. Oncol. 2011, 29, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Doebele, R.C.; Davis, L.E.; Vaishnavi, A.; Le, A.T.; Estrada-Bernal, A.; Keysar, S.; Jimeno, A.; Varella-Garcia, M.; Aisner, D.L.; Li, Y.; et al. An Oncogenic NTRK Fusion in a Patient with Soft-Tissue Sarcoma with Response to the Tropomyosin-Related Kinase Inhibitor LOXO-101. Cancer Discov. 2015, 5, 1049–1057. [Google Scholar] [CrossRef] [PubMed]
- Sonu, R.J.; Jonas, B.A.; Dwyre, D.M.; Gregg, J.P.; Rashidi, H.H. Optimal Molecular Methods in Detecting P190 (BCR-ABL) Fusion Variants in Hematologic Malignancies: A Case Report and Review of the Literature. Case Rep. Hematol. 2015, 2015, 458052. [Google Scholar] [CrossRef] [PubMed]
- Gygi, S.P.; Rochon, Y.; Franza, B.R.; Aebersold, R. Correlation between Protein and MRNA Abundance in Yeast. Mol. Cell. Biol. 1999, 19, 1720–1730. [Google Scholar] [CrossRef]
- Kislinger, T.; Cox, B.; Kannan, A.; Chung, C.; Hu, P.; Ignatchenko, A.; Scott, M.S.; Gramolini, A.O.; Morris, Q.; Hallett, M.T.; et al. Global Survey of Organ and Organelle Protein Expression in Mouse: Combined Proteomic and Transcriptomic Profiling. Cell 2006, 125, 173–186. [Google Scholar] [CrossRef]
- Gry, M.; Rimini, R.; Strömberg, S.; Asplund, A.; Pontén, F.; Uhlén, M.; Nilsson, P. Correlations between RNA and Protein Expression Profiles in 23 Human Cell Lines. BMC Genom. 2009, 10, 365. [Google Scholar] [CrossRef]
- Chen, G.; Gharib, T.G.; Huang, C.C.; Taylor, J.M.G.; Misek, D.E.; Kardia, S.L.R.; Giordano, T.J.; Iannettoni, M.D.; Orringer, M.B.; Hanash, S.M.; et al. Discordant Protein and MRNA Expression in Lung Adenocarcinomas. Mol. Cell. Proteom. 2002, 1, 304–313. [Google Scholar] [CrossRef]
- Kosti, I.; Jain, N.; Aran, D.; Butte, A.J.; Sirota, M. Cross-Tissue Analysis of Gene and Protein Expression in Normal and Cancer Tissues. Sci. Rep. 2016, 6, 24799. [Google Scholar] [CrossRef]
- Gao, Y.; Yang, M.; Jiang, Z.; Woda, B.A.; Mercurio, A.M.; Qin, J.; Huang, X.; Zhang, F. IMP3 Expression Is Associated with Poor Outcome and Epigenetic Deregulation in Intrahepatic Cholangiocarcinoma. Hum. Pathol. 2014, 45, 1184–1191. [Google Scholar] [CrossRef]
- Sinn, H.P.; Schneeweiss, A.; Keller, M.; Schlombs, K.; Laible, M.; Seitz, J.; Lakis, S.; Veltrup, E.; Altevogt, P.; Eidt, S.; et al. Comparison of Immunohistochemistry with PCR for Assessment of ER, PR, and Ki-67 and Prediction of Pathological Complete Response in Breast Cancer. BMC Cancer 2017, 17, 124. [Google Scholar] [CrossRef]
- Noske, A.; Loibl, S.; Darb-Esfahani, S.; Roller, M.; Kronenwett, R.; Müller, B.M.; Steffen, J.; von Toerne, C.; Wirtz, R.; Baumann, I.; et al. Comparison of Different Approaches for Assessment of HER2 Expression on Protein and MRNA Level: Prediction of Chemotherapy Response in the Neoadjuvant GeparTrio Trial (NCT00544765). Breast Cancer Res. Treat. 2011, 126, 109–117. [Google Scholar] [CrossRef]
- Mentrikoski, M.J.; Ma, L.; Pryor, J.G.; McMahon, L.A.; Yang, Q.; Spaulding, B.O.; Scott, G.A.; Wang, H.L.; Xu, H. Diagnostic Utility of IMP3 in Segregating Metastatic Melanoma from Benign Nevi in Lymph Nodes. Mod. Pathol. 2009, 22, 1582–1587. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sève, P.; Mackey, J.; Isaac, S.; Trédan, O.; Souquet, P.J.; Pérol, M.; Lai, R.; Voloch, A.; Dumontet, C. Class III β-Tubulin Expression in Tumor Cells Predicts Response and Outcome in Patients with Non-Small Cell Lung Cancer Receiving Paclitaxel. Mol. Cancer Ther. 2005, 4, 2001–2007. [Google Scholar] [CrossRef] [PubMed]
- Booton, R.; Ward, T.; Ashcroft, L.; Morris, J.; Heighway, J.; Thatcher, N. ERCC1 MRNA Expression Is Not Associated with Response and Survival after Platinum-Based Chemotherapy Regimens in Advanced Non-Small Cell Lung Cancer. J. Thorac. Oncol. 2007, 2, 902–906. [Google Scholar] [CrossRef] [PubMed]
- De Castro, G.; Pasini, F.S.; Siqueira, S.A.C.; Ferraz, A.R.; Villar, R.C.; Snitcovsky, I.M.L.; Federico, M.H.H. ERCC1 Protein, MRNA Expression and T19007C Polymorphism as Prognostic Markers in Head and Neck Squamous Cell Carcinoma Patients Treated with Surgery and Adjuvant Cisplatin-Based Chemoradiation. Oncol. Rep. 2011, 25, 693–699. [Google Scholar] [CrossRef]




| Primary Melanomas (n = 70) | |
|---|---|
| Variable | Number of Cases (%) |
| Breslow Thickness (mm) | |
| ≤1 | 32 (45.7) |
| 1.01–2.00 | 14 (20.0) |
| 2.01–4.00 | 8 (11.4) |
| >4 | 16 (22.9) |
| Ulceration | |
| Absent | 53 (75.7) |
| Present | 17 (24.3) |
| Mitosis/mm2 | |
| 0 | 23 (32.9) |
| ≥1 | 47 (67.1) |
| Growth phase | |
| Radial | 22 (31.4) |
| Vertical | 48 (68.6) |
| Location | |
| Limbs | 28 (40.0) |
| Trunk | 35 (50.0) |
| Head and neck | 7 (10.0) |
| Gender | |
| Female | 46 (65.7) |
| Male | 24 (34.3) |
| Histological type * | |
| SSM | 52 (74.29) |
| LMM | 5 (7.14) |
| ALM | 5 (7.14) |
| NM | 8 (11.43) |
| Age at diagnosis (years) | |
| ≤65 | 38 (54.3) |
| >65 | 32 (45.7) |
| In-Transit Metastasis | |
| Absent | 61 (87.1) |
| Present | 9 (12.9) |
| Lymph Node Metastasis | |
| Absent | 56 (80.0) |
| Present | 14 (20.0) |
| Distant Metastasis | |
| Absent | 51 (72.9) |
| Present | 19 (27.1) |
| Any Metastasis | |
| Absent | 48 (68.6) |
| Present | 22 (31.4) |
| Melanoma-specific Survival | |
| Alive | 55 (78.6) |
| Dead | 15 (21.4) |
| Follow-up (months) | |
| Mean, Range | 96.1 (6.6–210.4) |
| Assay Name | Assay ID | Mature miRNA Sequence |
|---|---|---|
| hsa-miR-9–5p | 000583 | UCUUUGGUUAUCUAGCUGUAUGA |
| hsa-miR-21-5p | 000397 | UAGCUUAUCAGACUGAUGUUGA |
| hsa-miR-125b-5p | 000449 | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-137 | 001129 | UUAUUGCUUAAGAAUACGCGUAG |
| hsa-miR-182-5p | 002334 | UUUGGCAAUGGUAGAACUCACACU |
| hsa-miR-191-5p | 002299 | CAACGGAAUCCCAAAAGCAGCUG |
| hsa-miR-200c-3p | 002300 | UAAUACUGCCGGGUAAUGAUGGA |
| hsa-miR-205-5p | 000509 | UCCUUCAUUCCACCGGAGUCUG |
| hsa-miR-211-5p | 000514 | UUCCCUUUGUCAUCCUUCGCCU |
| hsa-miR-221-3p | 000524 | AGCUACAUUGUCUGCUGGGUUUC |
| RNU48 | 001006 | GAUGACCCCAGGUAACUCUGAGUGUGUCG |
| CUGAUGCCAUCACCGCAGCGCUCUGACC |
| IGF2BP3 mRNA (n = 61) | IGF2BP3 Protein (1) (n = 63) | IGF2BP3 Protein (2) (n = 63) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Variable | IGF2BP3 mRNA (2-∆Ct) | p-Value | Correlation Coefficient | IGF2BP3 Protein (H-Score 1) | p-Value | Correlation Coefficient | IGF2BP3 Protein (H-Score 2) | p-Value | Correlation Coefficient | Test |
| IGF2BP3 median value | 0.654 | - | - | 40 | - | - | 22.90 | - | - | - |
| Breslow thickness (mm) | ||||||||||
| Range (0–20) | (0.039–251.701) | <0.001 *** | 0.54 | (0.00–163.33) | 0.06 | 0.24 | (0.00–190.00) | 0.16 | 0.18 | Spearman |
| Breslow thickness categories (mm) | ||||||||||
| ≤1 (T1) | 0.344 | <0.001 *** | - | 31.66 | 0.379 | 6.60 | 0.772 | - | Kruskal-Wallis | |
| 1.01–2.00 (T2) | 0.514 | 30.00 | 29.00 | |||||||
| 2.01–4.00 (T3) | 0.763 | 2.66 | 2.5 | |||||||
| >4 (T4) | 3.426 | 61.66 | 23.30 | |||||||
| Mitosis/mm2 | ||||||||||
| Range (0–27) | (0.039–251.701) | <0.001 *** | 0.43 | (0.00–163.33) | 0.06 | 0.24 | (0.00–190.00) | 0.23 | 0.15 | Spearman |
| Ulceration | ||||||||||
| Absent | 0.453 | <0.001 *** | - | 30.00 | 0.037 * | - | 16.65 | 0.129 | - | Wilcoxon |
| Present | 3.220 | 62.08 | 32.50 | |||||||
| Growth phase | ||||||||||
| Radial | 0.471 | 0.032 * | - | 30.00 | 0.225 | - | 15.80 | 0.63 | - | Wilcoxon |
| Vertical | 1.367 | 40.63 | 22.90 | |||||||
| Metastasis | ||||||||||
| In-transit metastasis | ||||||||||
| Absent | 0.558 | 0.132 | - | 40.00 | 0.268 | - | 25.00 | 0.155 | - | Wilcoxon |
| Present | 1.999 | 7.50 | 2.50 | |||||||
| Lymph node metastasis | ||||||||||
| Absent | 0.471 | <0.001 *** | - | 31.66 | 0.129 | - | 3.30 | 0.944 | - | Wilcoxon |
| Present | 2.291 | 62.50 | 22.50 | |||||||
| Distant metastasis | ||||||||||
| Absent | 0.433 | <0.001 *** | - | 30.00 | 0.031 * | - | 19.15 | 0.372 | - | Wilcoxon |
| Present | 2.354 | 66.25 | 26.25 | |||||||
| Any metastasis | ||||||||||
| Absent | 0.393 | <0.001 *** | - | 30.00 | 0.135 | + | 23.30 | 0.625 | - | Wilcoxon |
| Present | 2.388 | 61.66 | 22.50 | |||||||
| Melanoma-specific survival | ||||||||||
| Alive | 0.534 | 0.009 ** | - | 30.00 | 0.029 * | 16.65 | 0.2336 | - | Wilcoxon | |
| Dead | 2.291 | 83.33 | 32.50 | |||||||
| DMFS | Multivariate | Univariate | |||||
| HR (Exp(B)) | 95% CI | p-Value | HR (Exp(B)) | 95% CI | p-Value | ||
| IGF2BP3 mRNA | Breslow | 1.307 | 1.166–1.466 | <0.001 *** | 1.315 | 1.198–1.443 | <0.001 *** |
| Ulceration | 3.423 | 1.149–10.194 | 0.027 * | 10.360 | 3.773–28.430 | <0.001 *** | |
| IGF2BP3 mRNA | 1.016 | 1.005–1.028 | 0.004 ** | 1.015 | 1.006–1.024 | 0.001 ** | |
| IGF2BP3 protein (H-score 1) | Breslow | 1.299 | 1.158–1.459 | <0.001 *** | 1.332 | 1.213–1.462 | <0.001 *** |
| Ulceration | 4.785 | 1.563–14.643 | 0.006 ** | 11.020 | 4.010–30.310 | <0.001 *** | |
| IGF2BP3 protein | 1.008 | 0.999–1.015 | 0.053 | 1.005 | 0.999–1.011 | 0.078 | |
| IGF2BP3 protein (H-score 2) | Breslow | 1.297 | 1.159–1.458 | <0.001 *** | 1.332 | 1.213–1.462 | <0.001 *** |
| Ulceration | 4.061 | 1.390–11.862 | 0.104 * | 11.020 | 4.010–30.310 | <0.001 *** | |
| IGF2BP3 protein | 1.002 | 0.993–1.010 | 0.651 | 1.003 | 0.9944–1.012 | 0.487 | |
| MSS | Multivariate | Univariate | |||||
| HR (Exp(B)) | 95% CI | p-Value | HR (Exp(B)) | 95% CI | p-Value | ||
| IGF2BP3 mRNA | Breslow | 1.143 | 1.024–1.275 | 0.017 * | 1.171 | 1.077–1.273 | <0.001 *** |
| Ulceration | 3.675 | 1.159–11.647 | 0.027 * | 7.379 | 2.439–22.320 | <0.001 *** | |
| IGF2BP3 mRNA | 1.024 | 1.100–1.048 | 0.044 * | 1.066 | 1.008–1.127 | 0.0243 * | |
| IGF2BP3 protein (H-score 1) | Breslow | 1.123 | 0.999–1.263 | 0.051 | 1.175 | 1.085–1.237 | <0.001 *** |
| Ulceration | 5.396 | 1.644–17.715 | 0.005 ** | 7.840 | 2.590–23.730 | <0.001 *** | |
| IGF2BP3 protein | 1.004 | 0.996–1.013 | 0.322 | 1.005 | 0.999–1.012 | 0.091 | |
| IGF2BP3 protein (H-score 2) | Breslow | 1.146 | 1.024–1.282 | 0.017 * | 1.175 | 1.085–1.273 | <0.001 *** |
| Ulceration | 4.689 | 1.498–14.674 | 0.008 ** | 7.840 | 2.590–23.730 | <0.001 *** | |
| IGF2BP3 protein | 1.002 | 0.993–1.011 | 0.678 | 1.005 | 0.9962–1.014 | 0.258 | |
| Coefficients | Estimate | Std. Error | z Value | p-Value | |
|---|---|---|---|---|---|
| IGF2BP3 mRNA | (Intercept) | −2.951 | 0.645 | −4.547 | <0.001 *** |
| Breslow | 0.435 | 0.171 | 2.550 | 0.011 * | |
| Ulceration | 1.507 | 0.973 | 1.549 | 0.121 | |
| IGF2BP3 mRNA | 0.013 | 0.019 | 0.698 | 0.485 | |
| IGF2BP3 protein (H-score 1) | (Intercept) | −3.453 | 0.839 | −4.118 | <0.001 *** |
| Breslow | 0.720 | 0.294 | 2.449 | 0.014 * | |
| Ulceration | 0.494 | 1.272 | 0.388 | 0.698 | |
| IGF2BP3 protein | 0.005 | 0.007 | 0.663 | 0.508 | |
| IGF2BP3 protein (H-score 2) | (Intercept) | −2.975 | 0.750 | −3.967 | <0.001 *** |
| Breslow | 0.698 | 0.289 | 2.420 | 0.016 * | |
| Ulceration | 0.785 | 1.294 | 0.607 | 0.544 | |
| IGF2BP3 protein | −0.007 | 0.011 | −0.606 | 0.545 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sánchez-Sendra, B.; Pérez-Debén, S.; González-Muñoz, J.F.; Murgui, A.; Monteagudo, C. Prognostic Value of IGF2 mRNA-Binding Protein 3 (IGF2BP3) Intratumoral Expression in Melanoma Patients at the Time of Diagnosis: Comparative Analysis of RT-qPCR Versus Immunohistochemistry. Cancers 2022, 14, 2319. https://doi.org/10.3390/cancers14092319
Sánchez-Sendra B, Pérez-Debén S, González-Muñoz JF, Murgui A, Monteagudo C. Prognostic Value of IGF2 mRNA-Binding Protein 3 (IGF2BP3) Intratumoral Expression in Melanoma Patients at the Time of Diagnosis: Comparative Analysis of RT-qPCR Versus Immunohistochemistry. Cancers. 2022; 14(9):2319. https://doi.org/10.3390/cancers14092319
Chicago/Turabian StyleSánchez-Sendra, Beatriz, Silvia Pérez-Debén, José F. González-Muñoz, Amelia Murgui, and Carlos Monteagudo. 2022. "Prognostic Value of IGF2 mRNA-Binding Protein 3 (IGF2BP3) Intratumoral Expression in Melanoma Patients at the Time of Diagnosis: Comparative Analysis of RT-qPCR Versus Immunohistochemistry" Cancers 14, no. 9: 2319. https://doi.org/10.3390/cancers14092319
APA StyleSánchez-Sendra, B., Pérez-Debén, S., González-Muñoz, J. F., Murgui, A., & Monteagudo, C. (2022). Prognostic Value of IGF2 mRNA-Binding Protein 3 (IGF2BP3) Intratumoral Expression in Melanoma Patients at the Time of Diagnosis: Comparative Analysis of RT-qPCR Versus Immunohistochemistry. Cancers, 14(9), 2319. https://doi.org/10.3390/cancers14092319

