Next Article in Journal
18F-FET PET Uptake Characteristics of Long-Term IDH-Wildtype Diffuse Glioma Survivors
Previous Article in Journal
Global Proteomic Profiling of Pediatric AML: A Pilot Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cancers
Volume 13
Issue 13
10.3390/cancers13133156
cancers-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Quadruplex Ligands in Cancer Therapy

by
Victoria Sanchez-Martin
1,2,3,
Miguel Soriano
1,4,* and
Jose Antonio Garcia-Salcedo
1,2,*
1
Centre for Genomics and Oncological Research, Pfizer-University of Granada-Andalusian Regional Government, PTS Granada, 18016 Granada, Spain
2
Microbiology Unit, Biosanitary Research Institute IBS, University Hospital Virgen de las Nieves, 18014 Granada, Spain
3
Department of Biochemistry, Molecular Biology III and Immunology, University of Granada, 18016 Granada, Spain
4
Centre for Intensive Mediterranean Agrosystems and Agri-Food Biotechnology (CIAMBITAL), University of Almeria, 04001 Almeria, Spain
*
Authors to whom correspondence should be addressed.
Cancers 2021, 13(13), 3156; https://doi.org/10.3390/cancers13133156
Submission received: 31 May 2021 / Revised: 18 June 2021 / Accepted: 20 June 2021 / Published: 24 June 2021
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Four-stranded nucleic acid secondary structures (quadruplexes) including DNA G-quadruplexes, RNA G-quadruplexes and i-Motifs display key regulatory functions in the human genome. Quadruplexes play an important role in telomere lengthening and the expression control of several cancer-related genes. In this context, quadruplex ligands are considered as potential strategies for anticancer drug discovery. Previous reviews are mainly focused on ligands targeting DNA G-quadruplexes, RNA G-quadruplexes and i-Motifs in a separate way, hindering a holistic study. The present review overcomes this limitation by providing a general overview of the recent research on ligands targeting the three different quadruplex structures in cancer.

Abstract

Nucleic acids can adopt alternative secondary conformations including four-stranded structures known as quadruplexes. To date, quadruplexes have been demonstrated to exist both in human chromatin DNA and RNA. In particular, quadruplexes are found in guanine-rich sequences constituting G-quadruplexes, and in cytosine-rich sequences forming i-Motifs as a counterpart. Quadruplexes are associated with key biological processes ranging from transcription and translation of several oncogenes and tumor suppressors to telomeres maintenance and genome instability. In this context, quadruplexes have prompted investigations on their possible role in cancer biology and the evaluation of small-molecule ligands as potential therapeutic agents. This review aims to provide an updated close-up view of the literature on quadruplex ligands in cancer therapy, by grouping together ligands for DNA and RNA G-quadruplexes and DNA i-Motifs.

1. Introduction

Nucleic acids have considerable potential to fold into three-dimensional secondary structures based on particular sequence motifs [1]. Single-stranded guanine-rich DNA sequences can fold into stable intramolecular and intermolecular four-stranded G-quadruplexes (G4s) [2]. G4s arise from Hoogsteen hydrogen bonding of four guanines arranged within a planar quartet, which is further stabilized by interactions between the O-6 lone- pair electrons of each guanine and monovalent or divalent cations. Self-stacking of two or more G-quartets generates a G4 structure [3]. Further studies established that many RNA sequences featuring G-tracts can also fold into G4 structures, sometimes demonstrating increased thermodynamic stability and reduced steric hindrance [4]. Therefore, G4s are found both in DNA and RNA. In addition, single-stranded cytosine-rich sequences can form hemiprotonated cytosine–cytosine base pairs (C–C+), adopting a structure called an i-Motif [5]. This structure is less known than other DNA structures, in part due to its limited stability. Initially, i-Motifs were considered to mainly occur under acidic conditions, but an increasing number of studies demonstrate that these sequences are stable structures even at neutral pH [6]. Although quadruplexes are related to each other in terms of primary sequence, they in fact comprise a diverse family of structures that can fold into different topologies including parallel, antiparallel, and hybrid structures for G4s and R-forms or S-forms for i-Motifs (Figure 1). Each topology is dictated by the pattern of strand polarities and the orientation of interconnecting loops [7]. The topology of RNA G4s is more limited to the parallel conformation due to the steric hindrance imposed by the presence of a 2′-hydroxyl group in the ribose sugar. Nevertheless, according to a recent study, RNA G4s can also adopt different conformations other than the parallel [8]. However, the extent to which distinct topologies can influence quadruplex formation and function in cells is still unknown.
Experiments using computational, chemical, molecular, and cell biology methods have demonstrated that quadruplexes are very numerous in the human genome. The use of computational algorithms to search for the consensus sequence of quadruplexes helped to identify quadruplexes and reveal their enrichment [9]. Recent advances even accommodate certain structural variants, higher-order assemblies and account for flanking sequence effects [10]. Biophysical studies including circular dichroism and ultraviolet melting on different oligonucleotides, were the first to establish that many DNA and RNA sequences can fold into quadruplexes [11]. More sophisticated techniques, such as X-ray crystallography and nuclear magnetic resonance (NMR) spectroscopy, have been used to obtain quadruplex structures at atomic resolution. Interestingly, NMR spectroscopy simultaneously allows for the structure to be determined in physiological solutions, kinetics and dynamics studies, and molecular interaction investigations [12]. In addition, quadruplexes have been identified as cellular features. Given that G4s in DNA or RNA can stall a DNA polymerase or a reverse transcriptase respectively, the comparison of pause sites in G4-stabilizing and non-stabilizing conditions enables the detection of G4s in vitro. In particular, direct G4 sequencing in purified single-stranded human DNA identified more than 700,000 DNA G4s [13]. Furthermore, direct RNA G4 sequencing on poly(A)-enriched RNAs mapped G4 structures in more than 3000 human mRNAs [14]. Although sequencing of i-Motifs has not yet been achieved, C-rich complementary strands always accompany G-rich sequences in the genomic DNA. Therefore, the number of i-Motifs is expected to be similar to that of DNA G4s. Quadruplexes have been also identified using chemical methods by exploiting the different reactivities of nucleobases following the formation of quadruplex structures. For instance, in KMnO4–S1 nuclease footprinting, only single-stranded DNA is digested by S1 nuclease and subsequent computational analyses infer the formation of DNA G4s based on the nuclease footprints [15]. Alternatively, the location of G4s can be deduced because the Hoogsteen hydrogen interactions between the guanines in guanine tetrads provide relative protection from methylation as a result of dimethyl sulfate (DMS) and subsequent cleavage by piperidine [16]. Another method is the selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) which utilizes differences in the acylation kinetics of RNA 2′-hydroxyl groups and the ability of these groups to stall reverse transcription [17]. However, to date, these chemical mapping techniques have no detected RNA G4s in eukaryotic cells [18]. Furthermore, quadruplexes have been visualized by immunofluorescence in cells using specific antibodies. The scFv antibody BG4 revealed both DNA [19] and RNA [20] G4s in human cells. In accordance, the antibody fragment iMab enabled the imaging of i-Motifs in the nuclei of human cells and revealed that their formation was also cell-cycle dependent [21]. In general, quadruplex sequences are non-randomly distributed but are mainly clustered in pivotal genomic regions, such as DNA replication origins, telomeres, gene promoters, and untranslated regions (UTRs). There, quadruplexes either act as physical obstacles, which must be overcome, or as facilitators of normal cellular functions. Interestingly, quadruplexes are primarily found in active promoters associated with elevated transcription. However, the folding of quadruplexes in promoters is favored by an accessible chromatin state but does not necessarily require active transcription. In fact, quadruplexes act as genomic features that enable the recruitment of Polymerase II to promoters [22]. Altogether this evidence suggests that quadruplexes are involved in the regulation of different biological pathways such as replication, transcription, translation, and genome instability [23] (Figure 2A).
In this regard, quadruplexes display key cancer-related functions [24] (Figure 2B). Quadruplexes are linked to the control of the expression of several oncogenes and tumor suppressors, both at the transcriptional and translational levels. In addition, quadruplexes participate in lengthening telomeres and induce genome instability, processes which are frequently altered in cancer in order to sustain limitless replication [25]. In fact, quadruplex-containing genes are involved in all of the six hallmarks of cancer: sustaining proliferative signaling, evading growth suppressors, resisting cell death, enabling replicative immortality, inducing angiogenesis and activating invasion and metastasis [26]. The quadruplex-containing genes related to cancer were comprehensively reviewed in our previous article [27]. In particular, DNA G4s are found in the repetitive (TTAGGG)n telomeric sequence [28], which influences the binding of human telomerase reverse transcriptase hTERT, which is itself responsible for telomere lengthening. Interestingly, the expression level of the hTERT gene is also controlled by DNA G4s [29]. Apart from their association with telomeric function, numerous DNA G4s are harbored in the promoter regions of oncogenes. Within this group, DNA G4s are found in several oncogenic transcription factors and transducers, oncogenic growth factors and respective growth factor receptors. Tumor suppressor genes also contain DNA G4 structures in their promoters [24]. Regarding RNA G4s, they are found in telomeric repeat-containing RNA (TERRA) [30], and in the transcript of hTERT [31], controlling telomeric functions. Moreover, UTRs of certain cancer-related genes possess G4 sequences capable of mediating translation inhibition or activation and interfere with microRNAs (miRNAs) binding. RNA G4s are more abundant in the 5′UTR regions of oncogenes but they are also present in 3′UTRs [32]. Furthermore, RNA G4 structures in introns affect the splicing and expression patterns of several genes [33]. RNA G4s are found in tumorigenesis-involved noncoding RNAs, including both long noncoding RNAs (lncRNAs) and miRNAs. In particular, a G4 folded in a mature miRNA can prevent the miRNA from binding to its target, whilst a G4 within the pre-miRNA either positively or negatively influences its processing and biogenesis [34]. In the same way, C-tracts forming i-Motifs are found in telomeres [35] and extratelomeric regions, including the promoter of several oncogenes and tumor suppressors [36].
In this context, quadruplex ligands have been developed and tested as tools with which to study the complexity of quadruplexes-mediated mechanisms in carcinogenesis. Therefore, thanks to its stabilization properties, the small molecule, pyridostatin, enabled DNA G4 imaging in the nuclei of cells using the G4-recognizing antibody, BG4 [19]. The same occurred for carboxypyridostatin, a stabilizing ligand targeting RNA G4s within a cellular context [20]. Aside from being solely considered tools for improving visualization, quadruplex ligands have emerged as potential strategies for anticancer drug discovery [37].
This study aimed to concisely review the most recent advances in quadruplex targeting in antitumoral therapy. Given that the field of quadruplexes is continuously developing, we cover the current state of the art of quadruplex ligands in cancer research. Finally, we highlight the critical questions that remain to be addressed in the promising “era of quadruplexes”. Moreover, previous reviews separately focus on DNA G4, RNA G4 and i-Motif ligands in cancer. To the best of our knowledge, the present review is the first to bring together these quadruplex ligands, all of which are relevant for cancer therapeutics.

2. Quadruplex Ligands

Enormous efforts are being made to target quadruplexes as a therapeutic approach given their profound implication in carcinogenesis [37]. Ligands are chemical compounds that specifically bind to and stabilize the structure of quadruplexes. Without this mechanism, quadruplexes would unfold immediately after their formation in the cell as a result of helicases [38]. Quadruplexes provide recognition sites for ligands since different quadruplex structures adopt specific conformations (Figure 3). Binders generally have an aromatic surface for π–π stacking interactions with quadruplexes, a positive charge or basic groups to selectively bind to the loops or grooves of the quadruplex, and a steric bulk to prevent intercalation with double-stranded DNA [39].
To date, an arsenal of around 1000 small molecules that target quadruplexes has been reported. In the section below, quadruplex ligands with an anticancer effect are summarized. Furthermore, the respective timeline is shown in Figure 4. To note, this timeline shows the year in which the compounds were first described as quadruplex interactive ligands (not when they were firstly synthesized or discovered). The majority of ligands have emerged in recent years. As a result of the extensive panel of existing ligands and the huge variety of in vitro experiments described in the literature, only the most relevant concluding remarks are included.

2.1. DNA G4 Ligands

Herein we review the plethora of existing small molecules targeting DNA G4s, from classical ligands to the most recently discovered and selective binders, through the main chemo-families (Table 1).

2.1.1. Classical G4 Ligands

Disubstituted amidoanthraquinones were the first G4 ligands to be reported. These interactive agents tightly bind to telomeric G4s and block the telomerase RNA activity by disrupting the base-pairing between G-overhang and the enzyme [61]. One year later, the cationic porphyrin TMPyP4 emerged. TMPyP4 is traditionally known for inducing telomerase inhibition upon binding to telomeric G4s [114]. Broader targets include G4s in oncogenes such as: c-MYC transcription factor [111], VEGF vascular endothelial growth factor [115], PDGFa platelet derived growth factor [113], k-RAS, the GTP-binding protein involved in transduction [112], and BCL2 mitochondrial protein, which regulates apoptosis [110]. However, a major hurdle in the development of TMPyP4 as a G4 ligand is its ability to also bind to duplex DNA [123] and triplex DNA [124]. The naturally occurring antibiotic alkaloid derived from Chinese herbal medicine, berberine, along with its derivatives, bind to DNA G4s and inhibit telomere elongation [47,56]. Interestingly, epiberberin was the first molecule to be reported that specifically recognized the hybrid-2 form, one of the telomeric G4 conformations, and was capable of converting other telomeric G4 forms to hybrid-2 [125]. In addition, berberine can form complexes with G4 k-RAS promoter in a molecular ratio of 1:1 [46]. Moreover, berberine can be encapsulated by a modified b-cyclodextrin, exhibiting a significantly stronger binding to the G4 of the tyrosine kinase receptor c-KIT [45]. Another natural product, telomestatin, isolated from Streptomyces anulatus, was considered a potent telomerase inhibitor due to its ability to facilitate the formation of G4 structures, and thereby sequestering the single-stranded (TTAGGG)n telomeric primer molecules required for telomerase activity [108]. More recently, the (S)-telomestatin stereoisomer was shown to be a potent telomeric G4 binder and telomerase inhibitor [126]. Apart from G4s in telomeres, the transition of duplex to a non-B DNA conformation within the promoter region of the transcription factor c-MYB is induced by telomestatin [107]. The synthetic pentacyclic acridine RHPS4 also acts as a potent inhibitor of human telomerase on the submicromolar range through the stabilization of G4s formed by telomeric DNA in vitro [101]. Since its therapeutic potency is compromised by off-target effects on cardiovascular physiology, novel RHPS4-derivative ligands with improved toxicological profiles and telomere-targeting activities have been developed [127]. Bisquinolinium compounds, such as synthetic Phen-DC3, exhibit an exceptional affinity and selectivity for DNA G4s in human telomeric repeats over DNA duplexes [92] and form complexes with intramolecular G4s derived from the c-MYC promoter [91]. Moreover, pyridostatin is a synthetic small molecule that binds and stabilizes telomeric G4s leading to an alteration of shelterin complex integrity and the activation of DNA damage response [128]. Nevertheless, further studies indicate that, at low concentrations, pyridostatin predominantly interacts with non telomeric DNA loci, including several oncogenes, before targeting telomeres at higher doses [129]. As a result of its pan-quadruplex binding ability, pyridostatin has been used to broadly promote G4 formation in high-throughput sequencing of DNA G4 structures [130]. The 3,6,9-trisubstituted acridine compound, BRACO-19, was the first rationally designed ligand whose biological activity was partially restricted to G4-telomere targeting and interference with the capping and catalytic functions of telomerase [48].
Subsequently, some of these synthetic ligands have entered clinical trials (Figure 5). CX-3543, also named quarfloxin, is a fluoroquinolone that was originally designed to target the G4 found in the c-MYC promoter [131]. Further studies demonstrate that CX-3543 also interacts with a G4 found in ribosomal DNA and disrupts the binding between these G4s and nucleolin complexes in the nucleolus, thereby inhibiting ribosome biogenesis [132]. Although CX-3543 passed phase II trials as a candidate therapeutic agent against several tumors, phase III trials were not completed because of its high binding to albumin. Another fluoroquinolone, CX-5461, was found to selectively inhibit ribosomal RNA synthesis by reducing the binding affinity of the SL1 pre-initiation complex and RNA polymerase I complex to the ribosomal DNA promoter [133]. Very recently, it was shown that SL1 recruitment to ribosomal DNA is performed in a G4-dependent manner and CX-5461 traps such G4 structures, interfering with SL1 DNA binding activity [134]. Similar to CX-3543, CX-5461 selectively binds and stabilizes a broad spectrum of G4 structures, including those harbored in c-MYC, c-KIT, and telomeres [55]. Notably, CX-5461 is currently in phase I clinical trials for patients with BRCA1/2 deficient tumors, constituting the most advanced G4 ligand in the clinics at the moment.

2.1.2. Chemo-Families of G4 Ligands

Many G4 ligands have characteristic cores that can be chemically modified, rendering various analogues whose therapeutic activity in cancer is being investigated (Figure 6). During the last decade, extensive research efforts identified naphthalene diimides (NDIs) as favored chemotypes for G4 binding due to their high target affinity and potential for chemical variability. NDIs were originally reported to bind to telomeric G4s resulting in telomerase inhibition [83], although they display a lower specificity for telomere targeting as compared to RHPS4 [135]. However, after easily tunable synthesis, NDIs were able to target several oncogene promoters, for example c-KIT [80,136] and BCL2 [79]. A recent study further demonstrated that NDI derivatives stabilize the G4 formed in the promoter regions of c-KIT and BCL2 leading to the suppression of their respective protein expression and thus, interfering with their oncogenic signaling pathways [137]. In addition, another NDI derivative binds to G4s in MDM2 oncogene, which is a master regulator of TP53, reducing MDM2 transcription. Such an approach could be used to defeat all tumors in which the restoration of wild-type TP53 is sought [81]. Recently, our research group unveiled G4s in ribosomal DNA as new targets for NDIs [82]. Various NDIs, such as MM41 [138] and CM03 [139] demonstrated promising results in cancer therapeutics in vivo. Importantly, CM03 has potential for clinical use in the treatment of drug-resistant cancer. In particular, gemcitabine-resistant cancer cell lines demonstrate sensitivity to CM03 in the nanomolar range because the pattern of pathways downregulated by CM03 is largely unaffected in the gemcitabine-resistant line [140]. On the other hand, phenanthroline derivatives, originally used as duplex DNA-intercalating agents, have been modified to behave as telomeric G4-stabilizing ligands [90] and to induce the formation of a telomeric G4 antiparallel structure [60]. Aside from telomeres, phenanthrolines exhibit high selectivity for G4 DNA present in the promoter of c-KIT and c-MYC [89]. Inspired by the structure of the natural G4 ligand telomestatin, new insights were utilized in the synthesis of oxazole telomestatin derivatives (OTD), including L2H2-6OTD [86] and L1H1-7OTD [87], which are powerful scaffolds for stabilizing telomeric antiparallel G4s. Benzo[a]phenoxazine (BPO) derivatives have also been identified as new G4 binding molecules with a higher affinity for c-KIT, inhibiting its transcriptional expression [42]. Another benzo[a]phenoxazine, cresyl violet, demonstrates stronger binding activity to the (3+1) hybrid G4 structure formed by the human telomeric sequence as compared to the antiparallel one [43]. Quinazoline and its derivatives, which are building blocks for natural alkaloids, were reported to bind more selectively to c-KIT G4s than to duplex DNA [98]. However, in a more recent study, these compounds efficiently stabilized G4s of different topologies with a very strong preference for the well-characterized parallel c-MYC G4 [99]. Accordingly, the derivative NSC194598 was found to be a G4 interactive agent that interferes with transcriptional activation of the mutated RET gene in cancer, encoding a receptor-type tyrosine kinase [100]. Other naturally occurring alkaloids, indoloquinoline (IQ) derivatives, target G4s at the telomeres and oncogenic promoters, suggesting an inter-G4 selectivity trend: telomeric ≈ k-RAS > c-KIT [69]. In fact, these compounds are considered to be potent and selective k-RAS G4 stabilizers, that preferentially target the mutant form of k-RAS [141]. The rational selection of ligand side chains is crucial for enhancing the affinity or selectivity of IQ derivatives [142]. In this regard, methylated IQ derivatives exhibit a high affinity for the parallel c-MYC G4 in the submicromolar range, with a topology-selective binding and an excellent discrimination against the antiparallel telomeric G4 [70]. Moreover, another quindoline derivative, SYUIQ-05, interacts with the VEGF promoter, stabilizing its G4, thus downregulating its transcription and exhibiting a strong antiangiogenic activity [71]. Within the family of anthraquinone derivatives, mitoxantrone, is currently used in clinics for cancer treatment in combination with other drugs. Interestingly, recent studies revealed a new role for mitoxantrone in G4-dependent telomerase inhibition [76]. Additionally, mitoxantrone was shown to have potential in stabilizing G4s in the gene promoter of WT1, a zinc-finger transcription factor, downregulating its transcription [77].

2.1.3. Selective G4 Ligands

Over the last decade, attention has been focused on the development of G4 binders with selective recognition. Firstly, we would like to note that the majority of ligands have not been evaluated in large panels of quadruplexes or across the human genome. In this regard, many of the ligands described in this section are rather promiscuous. Selectivity is further discussed in the Discussion section.
Initially, research studies were focused on small molecules with G4-depending telomerase inhibitory activity in telomerase-positive tumor cells. Spermine-derivatized tentacle porphyrins, including TCPPSpm4 and its Zn (II) derivative (ZnTCPPSpm4), stabilize telomeric G4 with high stoichiometry and point-to-end stacking or porphyrin self-association as major binding modes [119]. In addition, 4,5-diazafluorenes [121] and stiff-stilbenes [105] emerged as new G4-binding chemotypes displaying selectivity for telomeric G4. The natural compound quercetin even interacts with telomeric G4 in acidic conditions [97]. Novel derivatives of Schizocommunin, an alkaloid from a fungal source, have been also designed for telomeric G4 targeting [104]. Anticancer drugs, such as epirubicin [64] and adriamycin [40] bind as monomers to telomeric G4 with a high affinity. Interestingly, various telomeric G4 ligands have been shown to discriminate between dimeric and monomeric forms of G4s. For instance, the cationic porphyrin derivative m-TMPipEOPP [78], the triaryl-substituted imidazole derivative IZNP-1 [74] and aryl-substituted imidazole DIZ-3 [62] exhibited a highly specific multimeric interaction. Moreover, it is increasingly clear that chiral complexes present a significant enantioselectivity [143]. Metallo-supramolecular Ni-P complexes display selectivity in stabilizing monomeric G4s [85], whilst Ni-M complexes bind to higher-order G4s [84]. Λ-enantiomer of ruthenium complexes can also selectively stabilize human telomeric G4 [122]. Other Ruthenium (II) Schiff base complexes exhibit telomeric G4 targeting and photo-induce cancer cell death with low cytotoxicity in the dark [102]. Recently, G4s served as targets for photopharmacological strategies for the first time. In this regard, a dithienylethene (DTE) ligand demonstrated selectivity for telomeric G4 with a cytotoxic activity modulated according to its photoisomeric state [63].
The identification of compounds that selectively bind to c-MYC G4 has been a priority, as c-MYC was long considered undruggable. An ellipticine analog, GQC-05, was the first-in-class c-MYC selective ligand. GQC-05 alters protein binding to the NHE III1 region within its promoter and decreases c-MYC mRNA, in agreement with a G4 stabilizing action [66]. In fact, GQC-05 synergizes with Navitoclax to induce cytotoxicity [144]. Following that, several ligands were rationally designed with the aim of c-MYC G4-specific recognition and downregulation. Among them, the bis-triazolyl carbazole ligand BTC-f [49], the cell penetrating thiazole peptide TH3 [109], the four-leaf clover-like ligand known as IZCZ-3 [73] and the difluoro-substituted quinoxaline QN-1 [96] have been described. Hybrid molecules with dual DNA-binding components (cIKP-PIP) were also designed for reading out the adjacent local duplex DNA sequence [53]. In addition, BZT-Indolium is a fluorescent and photostable probe that is highly specific for c-MYC G4. BZT-Indolium downregulates c-MYC transcription and can be used for in vitro staining and live cell imaging [50]. Recent strategies to identify new c-MYC G4 ligands include high-throughput screenings. For instance, in a microarray screen of 20,000 small molecules using fluorescently labeled c-MYC G4, a novel c-MYC G4-binding benzofuran scaffold compound was successfully identified [44]. Through affinity selection–mass spectrometry, a library of 50,000 compounds that were previously shown as inhibitors of c-MYC transcription was screened. The results demonstrated that only one ligand (compound 3) functions through c-MYC G4 binding [145]. Other strategies use gold-coated magnetic nanoparticles to assemble c-MYC G4. These nanotemplates facilitate the regioselective formation of triazole products such as Tz1, a high-affinity c-MYC G4 ligand [117].
Exploring the impact of k-RAS ligands on RAS-driven tumors also gained immediate interest. Since TMPyP4 and many of its derivatives suffer from inadequate selectivity, new porphyrin derivatives were designed to discriminate between different G4 topologies, with a preference for the parallel over the antiparallel conformation. In particular, porphyrin-1 (cobalt containing) and porphyrin-2 (palladium containing) [54], were shown to demonstrate high affinity towards k-RAS promoter G4. Furthermore, a porphyrin-based photosensitizer showed preferential binding to the 3′-end of k-RAS G4 [94]. The fluorescent light-up acridine orange C8 also binds and stabilizes k-RAS G4 with modest specificity over duplex DNA [57]. A new chemotype, compound 19, displayed a high affinity for k-RAS G4, with a 1:1 stoichiometry ratio and a remarkable selectivity against duplex DNA. It was also shown to inhibit the transcription of the k-RAS driver oncogene which had been long considered undruggable [58].
Increasing interest has also been directed towards VEGF G4 ligands as antimetastatic therapies. Se2SAP, a core-modified expanded porphyrin analogue with significantly reduced photoreactivity and increased effectivity in G4-binding as compared with TMPyP4, was the first selective VEGF G4 binding compound identified [103]. PM2, a perylene derivative, was demonstrated to be an effective antiangiogenic agent preferentially inducing VEGF intramolecular G4 formation [93]. Lastly, an oligonucleotide named as VEGFq was tested. It contains the 36 nt G-rich sequence capable of forming G4 in the VEGF promoter. VEGFq binds specifically to the C-rich strand, via strand invasion, stabilizing the G4 structure formed by the genomic G-rich sequence, resulting in VEGF transcriptional inhibition [118].
Other G4 ligands targeting “unique” oncogenic promoters have also emerged. An example is carbazole TO, a fluorescent probe that preferentially targets BCL2 G4, whose fluorescence intensity is greatly enhanced in the presence of BCL2 G4 [51]. Moreover, two furopyridazinone derivatives effectively bind to BCL2 G4 with a good selectivity and inhibit BCL2 gene transcription [65]. Topotecan was found to display a high binding affinity to c-MYB in vitro and effectively affects its transcription [116]. Isoalloxazines show selective binding to c-KIT G4 and provide a proof of concept for the inhibition of c-KIT transcription [72]. A small drug-like pharmacological chaperone molecule, GTC365, partially directs the correct hTERT G4 folding pathway, reducing hTERT activity through its transcriptional repression [68]. The ellipticine analog, GSA1129, selectively targets the 3′-end PDGFRb G4, to favor its structure and downregulates the transcription of this growth factor receptor [67]. The natural alkaloid liensinine demonstrates high affinity and selectivity for the G4 formed in the promoter of the growth factor receptor FGFR2, inhibiting its activity [75]. Furthermore, cepharanthine, a nonplanar molecule derived from the Chinese herb Stephania cepharantha, was found to recognize and stabilize the G4 in the 3′-flanking region of the signal transducer STAT3, downregulating its transcription [52].
In contrast, other novel ligands were reported to be selective compounds interacting not only with a unique G4, but also with a narrow-spectrum of G4s. Among them, new substituted diquinolinyl-pyridine ligands show a preference for the parallel conformation of telomeric, c-MYC and c-KIT G4s [59]. The same selectivity pattern was confirmed for APTO-253, a phenanthroline derivative that is in phase I clinical trials for the treatment of acute myeloid leukemia [41]. S4-5, a furobenzoxazine naphthoquinone, behaves as a multi-target ligand with ability to bind to both telomeric and c-MYC extratelomeric structures with promising biological results [106]. The triarylpyridine 20A is another example of ligand shown to affect multiple G4s including telomeric, c-KIT and k-RAS [120]. Lastly, a prolinamide-derived peptidomimetic molecule triggers cell death by synthetic lethality thanks to the simultaneous inhibition of the transcription of c-MYC and BCL2 genes through their respective promoter G4s [95].

2.2. RNA G4 Ligands

As described in the Background Section, increasing evidence suggests that UTRs, coding sequences, and splicing sites of cancer-relevant genes contain putative RNA G4s, which can be targeted. In addition, RNA G4s play important roles associated with telomeric function. For example, TMPyP4 binds to a TERRA G4 dimer, intercalating into the 5′-5′ stacking interface of two G4s blocks with a binding stoichiometry of 1:1 [146]. Hereafter, we compile the published information regarding compounds identified as RNA G4 ligands targeting 5′UTR, splicing sites and miRNAs of relevance in cancer (Table 2).

2.2.1. 5′UTR G4 Ligands

The discovery of RNA G4s in the 5′UTRs of numerous genes led to the proposal that such RNA motifs could be suitable targets for small molecules to modulate mRNA translation. The two quinolinium derivatives, RR82 and RR110, considerably reduced the translational efficiency of the n-RAS 5′UTR [162]. After them, several compounds with this ability were discovered. Both a polyaromatic molecule, RGB-1 [161], and a novel p-(methylthio)styryl-substituted quindoline derivative [160], stabilize n-RAS G4 and subsequently repress n-RAS translation. An anionic phthalocyanine, ZnAPC, is another G4 ligand that even binds to n-RAS in the presence of abundant RNA in mammalian cells, resulting in selective cleavage of the targeted G4 upon photo-irradiation [167]. In addition to n-RAS, its k-RAS counterpart is also targeted by specific G4 ligands. In this regard, the alkyl derivative of TMPyP4 (TMPyP4-C14), binds to G4s in the 5′UTR of k-RAS mRNA and, upon photoactivation, selectively induces mRNA degradation, resulting in k-RAS protein downregulation by approximately 90% [166]. A biotin-streptavidin pull-down assay identified an anthrafurandione as a potent binder for G4s in the 5′UTR of k-RAS transcript, repressing its translation in a dose-dependent manner [148]. In a multitarget strategy attempt, alkyl cationic porphyrins were reported to penetrate the cell membrane and bind to k-RAS and n-RAS mRNAs, while generating reactive oxygen species upon photoirradiation and finally downregulating both k-RAS and n-RAS expression. Therefore, these alkyl porphyrins are efficient photosensitizers for the photodynamic therapy of RAS-driven cancers [147]. Beyond RAS, G4 targeting of other cancer-relevant genes is increasingly required. Three bisquinolinium compounds (360A, Phen-DC3 and Phen-DC6) selectively bind to the telomere shelterin protein TRF2 G4, inhibiting its protein expression in a cellular context [151]. A quinazoline derivative exhibits a significant and specific interaction with the G4 in VEGFa 5′UTR, downregulating VEGFa translation and significantly impeding tumoral cell migration [159]. A series of new methylquinolinium derivatives have been synthesized and among them, C-24 showed selective affinity for the G4 harbored in the metalloproteinase ADAM10 5′UTR, strongly upregulating its translation [153]. Moreover, pyridostatin specifically potentiates the translational suppressing effect of the G4 located at 5′UTR of the nuclear factor HNF4a [158]. A G4 located at the 5’end of the antiapoptotic cochaperone BAG1 5’UTR is stabilized by small-molecule ligands such as carboxypyridostatin and Phen-DC3, which reduce the expression of endogenous BAG1 isoforms [149].

2.2.2. Splicing Site G4 Ligands

G4s are also present at RNA splicing sites, which reveals a novel and significant role in regulating alternative splicing and expression patterns, and thus, makes them a possible target for antitumoral G4 ligands. For example, the ellipticine GQC-05, antagonizes the major 5’ splicing site of BCLX gene, inhibiting the expression of its antiapoptotic isoform, activating the alternative 5’ splicing site, and expressing a proapoptotic isoform. Apparently, these effects are due to specific interactions between GQC-05 and G4s on BCLX pre-mRNA [154]. The aforementioned small molecule, pyridostatin, also binds to G4s in the pre-mRNA of the EWSR1 protein involved in sarcoma translocations, blocking its interaction with the RNA-binding protein HNRNPH1 and regulating its splicing [157]. Similarly, C-12459 induces an alteration of the hTERT splicing pattern, causing the almost complete disappearance of the active transcript and an overexpression of the inactive transcript [31]. In addition, a high-throughput screen identified emetine and its analog, cephaeline, as small molecules that disrupt G4s, resulting in the inhibition of G4-dependent alternative splicing in a genome-wide manner [152].

2.2.3. miRNA G4 Ligands

Recent efforts have focused on the development of ligands targeting miRNAs associated with cancer pathways, as they would allow for the simultaneous regulation of multiple mRNAs involved in carcinogenesis. Various well-known G4 binders were reported to target several miRNAs of relevance in cancer. In this way, TMPyP4 stabilizes G4s in miRNA-1587 [165] and miRNA-149 [164] and Phen-DC3 interacts with pre-miRNA-149 [150]. Moreover, two synthesized jatrorrhizine derivatives with terminal amine groups induce the dimerization of miRNA-1587 G4 forming 1:1 and 2:1 complexes with the dimeric G4, although the derived effect has not yet been studied [155]. Interestingly for TP53-driven tumors, sanguinarine was revealed as a high affinity binder with stabilization effects on the miRNA-3620-5p G4, blocking the base-pairing of miRNA-3620-5p with its target sequence [163]. Moreover, a strategy based on rationally designed locked nucleic acid (LNA) emerged for miRNA targeting. An LNA was designed to bind specifically to the G4 conformation of pre-miRNA-92b and was shown to inhibit its maturation. Consequently, LNA treatment rescues PTEN expression, which is suppressed by the elevated level of miRNA-92b in cancer [156].

2.3. I-Motif Ligands

While there are hundreds of ligands that interact with DNA and RNA G4s, there are very few compounds that target i-Motifs. Several ligands act as dual i-Motif/G4-interactive compounds. Thus, we would like to highlight the importance of evaluating their behavior towards the i-Motif counterpart, when studying G4-targeting compounds. In this section, DNA i-Motif ligands that were reported to exert antitumoral activity are grouped based on telomeric or extratelomeric targeting (Table 3).

2.3.1. Telomeric i-Motif Ligands

The first study of a small molecule binding to an i-Motif was reported for TMPyP4, which promotes the formation of the telomeric i-Motif. This study raised the intriguing possibility that TMPyP4 triggers the formation of non-B DNA structures in both strands of the telomeres through a nonintercalative mechanism [179]. The drug mitoxantrone and some analogues bind to telomeric and c-MYC i-Motif forming sequences, even at physiological pHs [181]. The interaction of well-known G4 ligands, such as berberine, BRACO-19, mitoxantrone, Phen-DC3, pyridostatin and RHPS4, with the i-Motif-forming sequence on telomeric DNA has also been confirmed [168]. Apart from these dual telomeric G4 and i-Motif binders, various compounds have been revealed to interact exclusively with i-Motif in telomeres. Single-walled carbon nanotubes (SWNTs) were the first nanodevice capable of inhibiting DNA duplex association and selectively, thus inducing human telomeric i-Motif formation by binding to the 5-end major groove [178,182]. In addition, phenanthroline derivatives can stabilize the structure of the human telomeric i-Motif [177]. The cyclic tetraoxazole compound (L2H2-4OTD) is the most recent compound to be characterized as a telomeric i-Motif ligand with two molecules binding cooperatively [175].

2.3.2. Extratelomeric i-Motif Ligands

The model ligand TMPyP4 also targets the i-Motif found in the chromatin remodeler SMARCA4, causing its destabilization [180]. To date, several BCL2 i-Motif ligands have been discovered. The first one was a cholestane derivative, compound NSC138948 (IMC-48). IMC-48 traps out the BCL2 i-Motif, shifting the equilibrium of secondary DNA structures and causing transcriptional overexpression of BCL2 [173]. Additionally, three natural flavonoids (P1, P5 and P6) exhibit a clear affinity for BCL2 i-Motif binding at a 1:1 stoichiometry [172]. Enantioselectivity is also important for i-Motif targeting as is the case for the peptidomimetic ligands PBP1 and PBP2. The para-isomer PBP1 exhibits high selectivity for the BCL2 i-Motif whilst the meta-isomer PBP2 selectively binds to BCL2 G4. As a consequence, PBP1 upregulates and PBP2 downregulates BCL2 gene expression in cancer cells [88]. Other oncogenic i-Motifs have gained attention for targeting. In the same study in which the molecule GSA11129 was identified, a benzothiophene-2-carboxamide (NSC309874) demonstrated PDGFRb i-Motif-interactive selectivity, inhibiting PDGFRb promoter activity [67]. In this line, nitidine, a benzophenanthridine alkaloid, dissipates the hairpin species and stabilizes the k-RAS i-Motif. However, nitidine also stabilizes the three existing k-RAS G4s and this combined effect leads to the downregulation of k-RAS gene expression [176]. In contrast, the acridone derivative B19 selectively stabilizes the c-MYC promoter i-Motif without significant binding to the respective G4 and duplex DNA, causing the downregulation of c-MYC transcription [169]. Interestingly, the plant flavonol, fisetin, preferentially binds to the i-Motif from the VEGF promoter region with theranostic applicability. Fisetin does not induce the stabilization of the VEGF i-Motif structure but causes both fluorescence emission and the transformation of the i-Motif into a hairpin-like structure; thus, it can be used to diagnose aberrant formations in i-Motifs. Furthermore, fisetin facilitates the processivity of polymerases and this control of replication by fisetin is therapeutically important and feasible [171]. Very recently, different i-Motif nanotemplates, such as gold-coated magnetic nanoparticles functionalized with the c-MYC and BCL2 i-Motifs, were employed to promote the metal-free synthesis of specific i-Motif ligands. In order to generate selective ligands for i-Motifs over G4s and duplex DNAs, complementary c-MYC and BCL2 G4s and self-complementary duplex DNA functionalized nanotemplates have been used as control templates. Such a strategy generated cell-membrane permeable triazole leads. In vitro studies reveal that the c-MYC i-Motif leads to the downregulation of c-MYC gene expression whereas the BCL2 i-Motif leads to the upregulation of BCL2 gene expression [174]. Thus far, only one compound is considered to be a pan-i-Motif ligand: C343, a coumarin derivative that exhibits its selectivity for i-Motif DNA over G4s and duplexes due to its unique recognition based on hemi-protonated C-bases with negatively charged functionality. Unlike other previously reported i-Motif ligands, C343 stands out due to its detection versatility. It can sense various i-Motifs with different chain lengths, sizes, molecularities, and loop lengths, including both intramolecular and intermolecular structures [170].

3. Discussion

Cancer is a major disease that poses a serious threat to human life and health. As a result of its complex and heterogeneous pathogenesis, there are still many challenges in cancer therapy. Finding novel anti-tumor drugs with high selectivity and few side effects is still the main focus of cancer research. As demonstrated in the present review, an imbalance in quadruplex dynamics contributes to carcinogenesis, and its manipulation by quadruplex ligands provides a novel opportunity to defeat cancer. Initial efforts were mainly focused on targeting telomeric quadruplexes in order to inhibit telomere extension in cancer cells using telomerase, whereas later studies attempted to transcriptionally modulate individual cancer genes by targeting their quadruplexes. Although there is a long way to go in the development of potent drugs, various promising lead compounds have been obtained; however, the results have thus far been limited. Firstly, at this stage, the variety of binding sites for these ligands and the differences in their effects on the quadruplex structures make it difficult to unravel how quadruplexes influence biological function, i.e., whether the stabilization or destabilization of quadruplexes promotes or inhibits gene expression. Secondly, the correlation between stabilization in vitro and cell activity is not straightforward. In particular, a G4 target characterized in vitro may not be the sole G4 targeted in cells. Furthermore, there is also inherent cell variability, which has an impact on the relationship between in vitro and in vivo results. A further point to be addressed for the majority of ligands described thus far is that they are generally characterized by high-molecular weights and protonated side chains, which may affect their cellular uptake. However, the major limitation for the clinical application of quadruplex ligands seems to be directly related to selectivity. In fact, the selectivity pattern of several quadruplex ligands is dose-dependent. Although global or multiple G4 targeting approaches may be effective, targets need to be clearly defined in advance. Other conceivable obstacles are the potential side effects of the ligands on normal tissues. Moreover, the predictive response biomarkers need to be identified if a personalized anticancer management is to be achieved. Nevertheless, given the rapid accumulation of data on quadruplex structures and the related biological functions, and the rapid development of ligands, we are confident that these limitations can be overcome. In this regard, a wealth of new derivatives with lower cytotoxicity and superior selectivity will emerge in the near future.

4. Conclusions

In this review, we give an overview of a range of compounds that target quadruplexes, including DNA G4s, RNA G4s, and i-Motifs, and discuss their limitations. The quadruplex-mediated antitumoral effects reported herein may pave the way for cutting-edge therapeutic approaches in the future treatment of human cancer.

Author Contributions

V.S.-M. wrote the manuscript. Conception, design, and manuscript revision were performed by M.S. and J.A.G.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This project was supported by the Carlos III Health Institute (AC18-00008), under the frame of EuroNanoMed III, with a grant to J.A.G.-S. The Government of Spain granted the PhD fellowship FPU16/05822 to V.S.-M.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

C: cytosine; G: guanine; G4: G-quadruplex; lncRNA: long noncoding RNA; miRNA: microRNA; UTR: untranslated region

References

  1. Choi, J.; Majima, T. Conformational changes of non-B DNA. Chem. Soc. Rev. 2011, 40, 5893–5909. [Google Scholar] [CrossRef]
  2. Burge, S.; Parkinson, G.N.; Hazel, P.; Todd, A.K.; Neidle, S. Quadruplex DNA: Sequence, topology and structure. Nucleic Acids Res. 2006, 34, 5402–5415. [Google Scholar] [CrossRef] [Green Version]
  3. Hänsel-Hertsch, R.; Di Antonio, M.; Balasubramanian, S. DNA G-quadruplexes in the human genome: Detection, functions and therapeutic potential. Nat. Rev. Mol. Cell Biol. 2017, 18, 279–284. [Google Scholar] [CrossRef]
  4. Joachimi, A.; Benz, A.; Hartig, J.S. A comparison of DNA and RNA quadruplex structures and stabilities. Bioorg. Med. Chem. 2009, 17, 6811–6815. [Google Scholar] [CrossRef] [Green Version]
  5. Gehring, K.; Leroy, J.-L.; Guéron, M. A tetrameric DNA structure with protonated cytosine-cytosine base pairs. Nature 1993, 363, 561–565. [Google Scholar] [CrossRef] [PubMed]
  6. Abdelhamid, M.A.S.; Waller, Z.A.E. Tricky Topology: Persistence of Folded Human Telomeric i-Motif DNA at Ambient Temperature and Neutral pH. Front. Chem. 2020, 8, 1–6. [Google Scholar] [CrossRef] [Green Version]
  7. Bugaut, A.; Balasubramanian, S. A sequence-independent study of the influence of short loop lengths on the stability and topology of intramolecular DNA G-quadraplexes. Biochemistry 2008, 47, 689–697. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Xiao, C.D.; Shibata, T.; Yamamoto, Y.; Xu, Y. An intramolecular antiparallel G-quadruplex formed by human telomere RNA. Chem. Commun. 2018, 54, 3944–3946. [Google Scholar] [CrossRef] [PubMed]
  9. Huppert, J.L.; Balasubramanian, S. Prevalence of quadruplexes in the human genome. Nucleic Acids Res. 2005, 33, 2908–2916. [Google Scholar] [CrossRef] [Green Version]
  10. Varizhuk, A.; Ischenko, D.; Tsvetkov, V.; Novikov, R.; Kulemin, N.; Kaluzhny, D.; Vlasenok, M.; Naumov, V.; Smirnov, I.; Pozmogova, G. The expanding repertoire of G4 DNA structures. Biochimie 2017, 135, 54–62. [Google Scholar] [CrossRef] [PubMed]
  11. Mergny, J.L.; Lacroix, L. UV melting of G-quadruplexes. Curr. Protoc. Nucleic Acid Chem. 2009, 17, Unit 17.1. [Google Scholar] [CrossRef]
  12. Adrian, M.; Heddi, B.; Phan, A.T. NMR spectroscopy of G-quadruplexes. Methods 2012, 57, 11–24. [Google Scholar] [CrossRef] [PubMed]
  13. Hänsel-Hertsch, R.; Spiegel, J.; Marsico, G.; Tannahill, D.; Balasubramanian, S. Genome-wide mapping of endogenous G-quadruplex DNA structures by chromatin immunoprecipitation and high-throughput sequencing. Nat. Protoc. 2018, 13, 551–564. [Google Scholar] [CrossRef] [PubMed]
  14. Kwok, C.K.; Marsico, G.; Sahakyan, A.B.; Chambers, V.S.; Balasubramanian, S. RG4-seq reveals widespread formation of G-quadruplex structures in the human transcriptome. Nat. Methods 2016, 13, 841–844. [Google Scholar] [CrossRef] [PubMed]
  15. Kouzine, F.; Wojtowicz, D.; Baranello, L.; Yamane, A.; Nelson, S.; Resch, W.; Kieffer-Kwon, K.R.; Benham, C.J.; Casellas, R.; Przytycka, T.M.; et al. Permanganate/S1 Nuclease Footprinting Reveals Non-B DNA Structures with Regulatory Potential across a Mammalian Genome. Cell Syst. 2017, 4, 344–356.e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Williamson, J.R.; Raghuraman, M.K.; Cech, T.R. Monovalent cation-induced structure of telomeric DNA: The G-quartet model. Cell 1989, 59, 871–880. [Google Scholar] [CrossRef]
  17. Wilkinson, K.A.; Merino, E.J.; Weeks, K.M. Selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE): Quantitative RNA structure analysis at single nucleotide resolution. Nat. Protoc. 2006, 1, 1610–1616. [Google Scholar] [CrossRef]
  18. Guo, J.U.; Bartel, D.P. RNA G-quadruplexes are globally unfolded in eukaryotic cells and depleted in bacteria. Science 2016, 353, aaf5371. [Google Scholar] [CrossRef] [Green Version]
  19. Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S. Quantitative visualization of DNA G-quadruplex structures in human cells. Nat. Chem. 2013, 5, 182–186. [Google Scholar] [CrossRef]
  20. Biffi, G.; Di Antonio, M.; Tannahill, D.; Balasubramanian, S. Visualization and selective chemical targeting of RNA G-quadruplex structures in the cytoplasm of human cells. Nat. Chem. 2014, 6, 75–80. [Google Scholar] [CrossRef]
  21. Zeraati, M.; Langley, D.B.; Schofield, P.; Moye, A.L.; Rouet, R.; Hughes, W.E.; Bryan, T.M.; Dinger, M.E.; Christ, D. I-motif DNA structures are formed in the nuclei of human cells. Nat. Chem. 2018, 10, 631–637. [Google Scholar] [CrossRef]
  22. Shen, J.; Varshney, D.; Simeone, A.; Zhang, X.; Adhikari, S.; Tannahill, D.; Balasubramanian, S. Promoter G-quadruplex folding precedes transcription and is controlled by chromatin. Genome Biol. 2021, 22, 1–14. [Google Scholar] [CrossRef]
  23. Spiegel, J.; Adhikari, S.; Balasubramanian, S. The Structure and Function of DNA G-Quadruplexes. Trends Chem. 2020, 2, 123–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Balasubramanian, S.; Hurley, L.H.; Neidle, S. Targeting G-quadruplexes in gene promoters: A novel anticancer strategy? Nat. Rev. Drug Discov. 2011, 10, 261–275. [Google Scholar] [CrossRef] [Green Version]
  25. De, S.; Michor, F. DNA secondary structures and epigenetic determinants of cancer genome evolution. Nat. Struct. Mol. Biol. 2011, 18, 950–955. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
  27. Sanchez-Martin, V.; Lopez-Pujante, C.; Soriano-Rodriguez, M.; Garcia-Salcedo, J.A. An updated focus on quadruplex structures as potential therapeutic targets in cancer. Int. J. Mol. Sci. 2020, 21, 8900. [Google Scholar] [CrossRef] [PubMed]
  28. Henderson, E.; Hardin, C.C.; Walk, S.K.; Tinoco, I.; Blackburn, E.H. Telomeric DNA oligonucleotides form novel intramolecular structures containing guanine·guanine base pairs. Cell 1987, 51, 899–908. [Google Scholar] [CrossRef]
  29. Monsen, R.C.; DeLeeuw, L.; Dean, W.L.; Gray, R.D.; Sabo, T.M.; Chakravarthy, S.; Chaires, J.B.; Trent, J.O. The hTERT core promoter forms three parallel G-quadruplexes. Nucleic Acids Res. 2020, 48, 5720–5734. [Google Scholar] [CrossRef]
  30. Martadinata, H.; Heddi, B.; Lim, K.W.; Phan, A.T. Structure of long human telomeric RNA (TERRA): G-quadruplexes formed by four and eight UUAGGG repeats are stable building blocks. Biochemistry 2011, 50, 6455–6461. [Google Scholar] [CrossRef]
  31. Gomez, D.; Lamarteleur, T.; Lacroix, L.; Mailliet, P.; Mergny, J.L.; Riou, J.F. Telomerase downregulation induced by the G-quadruplex ligand 12459 in A549 cells is mediated by hTERT RNA alternative splicing. Nucleic Acids Res. 2004, 32, 371–379. [Google Scholar] [CrossRef] [Green Version]
  32. Rouleau, S.; Glouzon, J.P.S.; Brumwell, A.; Bisaillon, M.; Perreault, J.P. 3′ UTR G-quadruplexes regulate miRNA binding. RNA 2017, 23, 1172–1179. [Google Scholar] [CrossRef] [Green Version]
  33. Marcel, V.; Tran, P.L.T.; Sagne, C.; Martel-Planche, G.; Vaslin, L.; Teulade-Fichou, M.P.; Hall, J.; Mergny, J.L.; Hainaut, P.; van Dyck, E. G-quadruplex structures in TP53 intron 3: Role in alternative splicing and in production of p53 mRNA isoforms. Carcinogenesis 2011, 32, 271–278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Pandey, S.; Agarwala, P.; Jayaraj, G.G.; Gargallo, R.; Maiti, S. The RNA Stem-Loop to G-Quadruplex Equilibrium Controls Mature MicroRNA Production inside the Cell. Biochemistry 2015, 54, 7067–7078. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Wolski, P.; Nieszporek, K.; Panczyk, T. G-Quadruplex and I-Motif Structures within the Telomeric DNA Duplex. A Molecular Dynamics Analysis of Protonation States as Factors Affecting Their Stability. J. Phys. Chem. B 2019, 123, 468–479. [Google Scholar] [CrossRef]
  36. Brooks, T.A.; Kendrick, S.; Hurley, L. Making sense of G-quadruplex and i-motif functions in oncogene promoters. FEBS J. 2010, 277, 3459–3469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Neidle, S. Quadruplex nucleic acids as targets for anticancer therapeutics. Nat. Rev. Chem. 2017, 1, 1–10. [Google Scholar] [CrossRef]
  38. Mendoza, O.; Bourdoncle, A.; Boulé, J.B.; Brosh, R.M.; Mergny, J.L. G-quadruplexes and helicases. Nucleic Acids Res. 2016, 44, 1989–2006. [Google Scholar] [CrossRef] [Green Version]
  39. Asamitsu, S.; Bando, T.; Sugiyama, H. Ligand Design to Acquire Specificity to Intended G-Quadruplex Structures. Chem. Eur. J. 2019, 25, 417–430. [Google Scholar] [CrossRef]
  40. Raje, S.; Pandav, K.; Barthwal, R. Binding of anticancer drug adriamycin to parallel G-quadruplex DNA [d-(TTAGGGT)]4 comprising human telomeric DNA leads to thermal stabilization: A multiple spectroscopy study. J. Mol. Recognit. 2020, 33, 1–13. [Google Scholar] [CrossRef]
  41. Local, A.; Zhang, H.; Benbatoul, K.D.; Folger, P.; Sheng, X.; Tsai, C.Y.; Howell, S.B.; Rice, W.G. APTO-253 stabilizes G-quadruplex DNA, inhibits MYC expression, and induces DNA damage in acute myeloid leukemia cells. Mol. Cancer Ther. 2018, 17, 1177–1186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. McLuckie, K.I.E.; Waller, Z.A.E.; Sanders, D.A.; Alves, D.; Rodriguez, R.; Dash, J.; McKenzie, G.J.; Venkitaraman, A.R.; Balasubramanian, S. G-Quadruplex-Binding benzo[a]phenoxazines down-regulate c-KIT expression in human gastric carcinoma cells. J. Am. Chem. Soc. 2011, 133, 2658–2663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Verma, S.D.; Pal, N.; Singh, M.K.; Shweta, H.; Khan, M.F.; Sen, S. Understanding ligand interaction with different structures of g-quadruplex DNA: Evidence of kinetically controlled ligand binding and binding-mode assisted quadruplex structure alteration. Anal. Chem. 2012, 84, 7218–7226. [Google Scholar] [CrossRef]
  44. Felsenstein, K.M.; Saunders, L.B.; Simmons, J.K.; Leon, E.; Calabrese, D.R.; Zhang, S.; Michalowski, A.; Gareiss, P.; Mock, B.A.; Schneekloth, J.S. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression. ACS Chem. Biol. 2016, 11, 138–148. [Google Scholar] [CrossRef] [PubMed]
  45. Suganthi, S.; Sivaraj, R.; Enoch, I.V.M.V. Molecular encapsulation of berberine by a modified β-cyclodextrin and binding of host: Guest complex to G-quadruplex DNA. Nucleosides Nucleotides Nucleic Acids 2019, 38, 858–873. [Google Scholar] [CrossRef] [PubMed]
  46. Wen, L.N.; Xie, M.X. Spectroscopic investigation of the interaction between G-quadruplex of KRAS promoter sequence and three isoquinoline alkaloids. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2017, 171, 287–296. [Google Scholar] [CrossRef]
  47. Ren, J.; Chaires, J.B. Sequence and structural selectivity of nucleic acid binding ligands. Biochemistry 1999, 38, 16067–16075. [Google Scholar] [CrossRef]
  48. Read, M.; Harrison, R.J.; Romagnoli, B.; Tanious, F.A.; Gowan, S.H.; Reszka, A.P.; Wilson, W.D.; Kelland, L.R.; Neidle, S. Structure-based design of selective and potent G quadruplex-mediated telomerase inhibitors. Proc. Natl. Acad. Sci. USA 2001, 98, 4844–4849. [Google Scholar] [CrossRef] [Green Version]
  49. Panda, D.; Debnath, M.; Mandal, S.; Bessi, I.; Schwalbe, H.; Dash, J. A Nucleus-Imaging Probe That Selectively Stabilizes a Minor Conformation of c-MYC G-quadruplex and Down-regulates c-MYC Transcription in Human Cancer Cells. Sci. Rep. 2015, 5, 1–16. [Google Scholar] [CrossRef] [Green Version]
  50. Zheng, B.X.; She, M.T.; Long, W.; Xu, Y.Y.; Zhang, Y.H.; Huang, X.H.; Liu, W.; Hou, J.Q.; Wong, W.L.; Lu, Y.J. A small-sized benzothiazole-indolium fluorescent probe: The study of interaction specificity targeting c-MYC promoter G-quadruplex structures and live cell imaging. Chem. Commun. 2020, 56, 15016–15019. [Google Scholar] [CrossRef]
  51. Gu, Y.; Lin, D.; Tang, Y.; Fei, X.; Wang, C.; Zhang, B.; Zhou, J. A light-up probe targeting for Bcl-2 2345 G-quadruplex DNA with carbazole TO. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2018, 191, 180–188. [Google Scholar] [CrossRef]
  52. Lin, S.; Li, S.; Chen, Z.; He, X.; Zhang, Y.; Xu, X.; Xu, M.; Yuan, G. Formation, recognition and bioactivities of a novel G-quadruplex in the STAT3 gene. Bioorg. Med. Chem. Lett. 2011, 21, 5987–5991. [Google Scholar] [CrossRef]
  53. Asamitsu, S.; Obata, S.; Phan, A.T.; Hashiya, K.; Bando, T.; Sugiyama, H. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex. Chem. Eur. J. 2018, 24, 4428–4435. [Google Scholar] [CrossRef]
  54. Pattanayak, R.; Barua, A.; Das, A.; Chatterjee, T.; Pathak, A.; Choudhury, P.; Sen, S.; Saha, P.; Bhattacharyya, M. Porphyrins to restrict progression of pancreatic cancer by stabilizing KRAS G-quadruplex: In silico, in vitro and in vivo validation of anticancer strategy. Eur. J. Pharm. Sci. 2018, 125, 39–53. [Google Scholar] [CrossRef]
  55. Xu, H.; Di Antonio, M.; McKinney, S.; Mathew, V.; Ho, B.; O’Neil, N.J.; Dos Santos, N.; Silvester, J.; Wei, V.; Garcia, J.; et al. CX-5461 is a DNA G-quadruplex stabilizer with selective lethality in BRCA1/2 deficient tumours. Nat. Commun. 2017, 8, 14432. [Google Scholar] [CrossRef] [PubMed]
  56. Franceschin, M.; Rossetti, L.; D’Ambrosio, A.; Schirripa, S.; Bianco, A.; Ortaggi, G.; Savino, M.; Schultes, C.; Neidle, S. Natural and synthetic G-quadruplex interactive berberine derivatives. Bioorg. Med. Chem. Lett. 2006, 16, 1707–1711. [Google Scholar] [CrossRef] [PubMed]
  57. Carvalho, J.; Pereira, E.; Marquevielle, J.; Campello, M.P.C.; Mergny, J.L.; Paulo, A.; Salgado, G.F.; Queiroz, J.A.; Cruz, C. Fluorescent light-up acridine orange derivatives bind and stabilize KRAS-22RT G-quadruplex. Biochimie 2018, 144, 144–152. [Google Scholar] [CrossRef]
  58. D’Aria, F.; D’Amore, V.M.; Di Leva, F.S.; Amato, J.; Caterino, M.; Russomanno, P.; Salerno, S.; Barresi, E.; De Leo, M.; Marini, A.M.; et al. Targeting the KRAS oncogene: Synthesis, physicochemical and biological evaluation of novel G-Quadruplex DNA binders. Eur. J. Pharm. Sci. 2020, 149, 105337. [Google Scholar] [CrossRef] [PubMed]
  59. Das, R.N.; Chevret, E.; Desplat, V.; Rubio, S.; Mergny, J.L.; Guillon, J. Design, synthesis and biological evaluation of new substituted diquinolinyl-pyridine ligands as anticancer agents by targeting G-Quadruplex. Molecules 2018, 23, 81. [Google Scholar] [CrossRef] [Green Version]
  60. Wang, L.; Wen, Y.; Liu, J.; Zhou, J.; Li, C.; Wei, C. Promoting the formation and stabilization of human telomeric G-quadruplex DNA, inhibition of telomerase and cytotoxicity by phenanthroline derivatives. Org. Biomol. Chem. 2011, 9, 2648–2653. [Google Scholar] [CrossRef]
  61. Sun, D.; Thompson, B.; Cathers, B.E.; Salazar, M.; Kerwin, S.M.; Trent, J.O.; Jenkins, T.C.; Neidle, S.; Hurley, L.H. Inhibition of human telomerase by a G-Quadruplex-Interactive compound. J. Med. Chem. 1997, 40, 2113–2116. [Google Scholar] [CrossRef]
  62. Hu, M.H.; Lin, X.T.; Liu, B.; Tan, J.H. Dimeric aryl-substituted imidazoles may inhibit ALT cancer by targeting the multimeric G-quadruplex in telomere. Eur. J. Med. Chem. 2020, 186, 111891. [Google Scholar] [CrossRef] [PubMed]
  63. O’Hagan, M.P.; Ramos-Soriano, J.; Haldar, S.; Sheikh, S.; Morales, J.C.; Mulholland, A.J.; Galan, M.C. Visible-light photoswitching of ligand binding mode suggests G-quadruplex DNA as a target for photopharmacology. Chem. Commun. 2020, 56, 5186–5189. [Google Scholar] [CrossRef] [PubMed]
  64. Raje, S.; Pandav, K.; Barthwal, R. Dual mode of binding of anti cancer drug epirubicin to G-quadruplex [d-(TTAGGGT)]4 containing human telomeric DNA sequence induces thermal stabilization. Bioorg. Med. Chem. 2019, 27, 115131. [Google Scholar] [CrossRef] [PubMed]
  65. Amato, J.; Pagano, A.; Capasso, D.; Di Gaetano, S.; Giustiniano, M.; Novellino, E.; Randazzo, A.; Pagano, B. Targeting the BCL2 Gene Promoter G-Quadruplex with a New Class of Furopyridazinone-Based Molecules. ChemMedChem 2018, 13, 406–410. [Google Scholar] [CrossRef]
  66. Brown, R.V.; Danford, F.L.; Gokhale, V.; Hurley, L.H.; Brooks, T.A. Demonstration that drug-targeted down-regulation of MYC in non-Hodgkins lymphoma is directly mediated through the promoter G-quadruplex. J. Biol. Chem. 2011, 286, 41018–41027. [Google Scholar] [CrossRef] [Green Version]
  67. Brown, R.V.; Wang, T.; Chappeta, V.R.; Wu, G.; Onel, B.; Chawla, R.; Quijada, H.; Camp, S.M.; Chiang, E.T.; Lassiter, Q.R.; et al. The Consequences of Overlapping G-Quadruplexes and i-Motifs in the Platelet-Derived Growth Factor Receptor β Core Promoter Nuclease Hypersensitive Element Can Explain the Unexpected Effects of Mutations and Provide Opportunities for Selective Targeting of both structures by small molecules to downregulate gene expression. J. Am. Chem. Soc. 2017, 139, 7456–7475. [Google Scholar]
  68. Kang, H.J.; Cui, Y.; Yin, H.; Scheid, A.; Hendricks, W.P.D.; Schmidt, J.; Sekulic, A.; Kong, D.; Trent, J.M.; Gokhale, V.; et al. A Pharmacological Chaperone Molecule Induces Cancer Cell Death by Restoring Tertiary DNA Structures in Mutant hTERT Promoters. J. Am. Chem. Soc. 2016, 138, 13673–13692. [Google Scholar] [CrossRef] [Green Version]
  69. Lavrado, J.; Borralho, P.M.; Ohnmacht, S.A.; Castro, R.E.; Rodrigues, C.M.P.; Moreira, R.; Dos Santos, D.J.V.A.; Neidle, S.; Paulo, A. Synthesis, G-quadruplex stabilisation, docking studies, and effect on cancer cells of indolo[3,2-b]quinolines with one, two, or three basic side chains. ChemMedChem 2013, 8, 1648–1661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  70. Funke, A.; Dickerhoff, J.; Weisz, K. Towards the Development of Structure-Selective G-Quadruplex-Binding Indolo[3,2-b]quinolines. Chem. Eur. J. 2016, 22, 3170–3181. [Google Scholar] [CrossRef]
  71. Wu, Y.; Zan, L.P.; Wang, X.D.; Lu, Y.J.; Ou, T.M.; Lin, J.; Huang, Z.S.; Gu, L.Q. Stabilization of VEGF G-quadruplex and inhibition of angiogenesis by quindoline derivatives. Biochim. Biophys. Acta Gen. Subj. 2014, 1840, 2970–2977. [Google Scholar] [CrossRef]
  72. Bejugam, M.; Sewitz, S.; Shirude, P.S.; Rodriguez, R.; Shahid, R.; Balasubramanian, S. Trisubstituted isoalloxazines as a new class of G-quadruplex binding ligands: Small molecule regulation of c-kit oncogene expression. J. Am. Chem. Soc. 2007, 129, 12926–12927. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Hu, M.H.; Wang, Y.Q.; Yu, Z.Y.; Hu, L.N.; Ou, T.M.; Chen, S.B.; Huang, Z.S.; Tan, J.H. Discovery of a New Four-Leaf Clover-Like Ligand as a Potent c-MYC Transcription Inhibitor Specifically Targeting the Promoter G-Quadruplex. J. Med. Chem. 2018, 61, 2447–2459. [Google Scholar] [CrossRef]
  74. Hu, M.H.; Chen, S.B.; Wang, B.; Ou, T.M.; Gu, L.Q.; Tan, J.H.; Huang, Z.S. Specific targeting of telomeric multimeric G-quadruplexes by a new triaryl-substituted imidazole. Nucleic Acids Res. 2017, 45, 1606–1618. [Google Scholar] [CrossRef] [Green Version]
  75. Zhou, J.; Tan, W.; Zhou, J.; Yuan, G. Investigation of G-quadruplex formation in the FGFR2 promoter region and its transcriptional regulation by liensinine. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 884–891. [Google Scholar] [CrossRef]
  76. Pradeep, T.P.; Tripathi, S.; Barthwal, R. Molecular recognition of parallel quadruplex [d-(TTGGGGT)]4 by mitoxantrone: Binding with 1:4 stoichiometry leads to telomerase inhibition. RSC Adv. 2016, 6, 71652–71661. [Google Scholar] [CrossRef]
  77. Ghazaey Zidanloo, S.; Hosseinzadeh Colagar, A.; Ayatollahi, H.; Bagheryan, Z. G-quadruplex forming region within WT1 promoter is selectively targeted by daunorubicin and mitoxantrone: A possible mechanism for anti-leukemic effect of drugs. J. Biosci. 2019, 44, 1–9. [Google Scholar] [CrossRef]
  78. Huang, X.X.; Zhu, L.N.; Wu, B.; Huo, Y.F.; Duan, N.N.; Kong, D.M. Two cationic porphyrin isomers showing different multimeric G-quadruplex recognition specificity against monomeric G-quadruplexes. Nucleic Acids Res. 2014, 42, 8719–8731. [Google Scholar] [CrossRef] [Green Version]
  79. Gunaratnam, M.; Collie, G.W.; Reszka, A.P.; Todd, A.K.; Parkinson, G.N.; Neidle, S. A naphthalene diimide G-quadruplex ligand inhibits cell growth and down-regulates BCL-2 expression in an imatinib-resistant gastrointestinal cancer cell line. Bioorg. Med. Chem. 2018, 26, 2958–2964. [Google Scholar] [CrossRef]
  80. Marchetti, C.; Minarini, A.; Tumiatti, V.; Moraca, F.; Parrotta, L.; Alcaro, S.; Rigo, R.; Sissi, C.; Gunaratnam, M.; Ohnmacht, S.A.; et al. Macrocyclic naphthalene diimides as G-quadruplex binders. Bioorg. Med. Chem. 2015, 23, 3819–3830. [Google Scholar] [CrossRef]
  81. Lago, S.; Nadai, M.; Ruggiero, E.; Tassinari, M.; Marušič, M.; Tosoni, B.; Frasson, I.; Cernilogar, F.M.; Pirota, V.; Doria, F.; et al. The MDM2 inducible promoter folds into four-tetrad antiparallel G-quadruplexes targetable to fight malignant liposarcoma. Nucleic Acids Res. 2021, 49, 847–863. [Google Scholar] [CrossRef] [PubMed]
  82. Sanchez-Martin, V.; Schneider, D.A.; Ortiz-Gonzalez, M.; Soriano-Lerma, A.; Linde-Rodriguez, A.; Perez-Carrasco, V.; Gutierrez-Fernandez, J.; Cuadros, M.; González, C.; Soriano, M.; et al. Targeting ribosomal G-quadruplexes with naphthalene-diimides as RNA polymerase I inhibitors for colorectal cancer treatment. Cell Chem. Biol. 2021. [Google Scholar] [CrossRef]
  83. Cuenca, F.; Greciano, O.; Gunaratnam, M.; Haider, S.; Munnur, D.; Nanjunda, R.; Wilson, W.D.; Neidle, S. Tri- and tetra-substituted naphthalene diimides as potent G-quadruplex ligands. Bioorg. Med. Chem. Lett. 2008, 18, 1668–1673. [Google Scholar] [CrossRef]
  84. Zhao, C.; Wu, L.; Ren, J.; Xu, Y.; Qu, X. Targeting human telomeric higher-order DNA: Dimeric G-quadruplex units serve as preferred binding site. J. Am. Chem. Soc. 2013, 135, 18786–18789. [Google Scholar] [CrossRef]
  85. Yu, H.; Wang, X.; Fu, M.; Ren, J.; Qu, X. Chiral metallo-supramolecular complexes selectively recognize human telomeric G-quadruplex DNA. Nucleic Acids Res. 2008, 36, 5695–5703. [Google Scholar] [CrossRef]
  86. Tera, M.; Ishizuka, H.; Takagi, M.; Suganuma, M.; Shin-Ya, K.; Nagasawa, K. Macrocyclic hexaoxazoles as sequence- and mode-selective G-quadruplex binders. Angew. Chem. Int. Ed. 2008, 47, 5557–5560. [Google Scholar] [CrossRef]
  87. Tera, M.; Iida, K.; Ishizuka, H.; Takagi, M.; Suganuma, M.; Doi, T.; Shin-Ya, K.; Nagasawa, K. Synthesis of a potent G-quadruplex-binding macrocyclic heptaoxazole. ChemBioChem 2009, 10, 431–435. [Google Scholar] [CrossRef]
  88. Debnath, M.; Ghosh, S.; Chauhan, A.; Paul, R.; Bhattacharyya, K.; Dash, J. Preferential targeting of i-motifs and G-quadruplexes by small molecules. Chem. Sci. 2017, 8, 7448–7456. [Google Scholar] [CrossRef] [Green Version]
  89. Wei, C.; Wang, Y.; Zhang, M. Synthesis and binding studies of novel di-substituted phenanthroline compounds with genomic promoter and human telomeric DNA G-quadruplexes. Org. Biomol. Chem. 2013, 11, 2355–2364. [Google Scholar] [CrossRef] [PubMed]
  90. Reed, J.E.; Neidle, S.; Vilar, R. Stabilisation of human telomeric quadruplex DNA and inhibition of telomerase by a platinum-phenanthroline complex. Chem. Commun. 2007, 42, 4366–4368. [Google Scholar] [CrossRef] [PubMed]
  91. Chung, W.J.; Heddi, B.; Hamon, F.; Teulade-Fichou, M.P.; Phan, A.T. Solution structure of a G-quadruplex bound to the bisquinolinium compound phen-DC3. Angew. Chem. Int. Ed. 2014, 53, 999–1002. [Google Scholar] [CrossRef] [PubMed]
  92. De Cian, A.; DeLemos, E.; Mergny, J.L.; Teulade-Fichou, M.P.; Monchaud, D. Highly efficient G-quadruplex recognition by bisquinolinium compounds. J. Am. Chem. Soc. 2007, 129, 1856–1857. [Google Scholar] [CrossRef] [PubMed]
  93. Taka, T.; Joonlasak, K.; Huang, L.; Randall Lee, T.; Chang, S.W.T.; Tuntiwechapikul, W. Down-regulation of the human VEGF gene expression by perylene monoimide derivatives. Bioorg. Med. Chem. Lett. 2012, 22, 518–522. [Google Scholar] [CrossRef]
  94. Caterino, M.; D’Aria, F.; Kustov, A.V.; Belykh, D.V.; Khudyaeva, I.S.; Starseva, O.M.; Berezin, D.B.; Pylina, Y.I.; Usacheva, T.; Amato, J.; et al. Selective binding of a bioactive porphyrin-based photosensitizer to the G-quadruplex from the KRAS oncogene promoter. Int. J. Biol. Macromol. 2020, 145, 244–251. [Google Scholar] [CrossRef]
  95. Paul, R.; Das, T.; Debnath, M.; Chauhan, A.; Dash, J. G-Quadruplex-Binding Small Molecule Induces Synthetic Lethality in Breast Cancer Cells by Inhibiting c-MYC and BCL2 Expression. ChemBioChem 2020, 21, 963–970. [Google Scholar] [CrossRef]
  96. Hu, M.H.; Wu, T.Y.; Huang, Q.; Jin, G. New substituted quinoxalines inhibit triple-negative breast cancer by specifically downregulating the c-MYC transcription. Nucleic Acids Res. 2019, 47, 10529–10542. [Google Scholar] [CrossRef]
  97. Vinnarasi, S.; Radhika, R.; Vijayakumar, S.; Shankar, R. Structural insights into the anti-cancer activity of quercetin on G-tetrad, mixed G-tetrad, and G-quadruplex DNA using quantum chemical and molecular dynamics simulations. J. Biomol. Struct. Dyn. 2020, 38, 317–339. [Google Scholar] [CrossRef]
  98. Wang, X.; Zhou, C.X.; Yan, J.W.; Hou, J.Q.; Chen, S.B.; Ou, T.M.; Gu, L.Q.; Huang, Z.S.; Tan, J.H. Synthesis and evaluation of quinazolone derivatives as a new class of c-KIT G-quadruplex binding ligands. ACS Med. Chem. Lett. 2013, 4, 909–914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  99. Jamroskovic, J.; Doimo, M.; Chand, K.; Obi, I.; Kumar, R.; Brännström, K.; Hedenström, M.; Nath Das, R.; Akhunzianov, A.; Deiana, M.; et al. Quinazoline Ligands Induce Cancer Cell Death through Selective STAT3 Inhibition and G-Quadruplex Stabilization. J. Am. Chem. Soc. 2020, 142, 2876–2888. [Google Scholar] [CrossRef] [Green Version]
  100. Shin, Y.J.; Kumarasamy, V.; Camacho, D.; Sun, D. Involvement of G-quadruplex structures in regulation of human RET gene expression by small molecules in human medullary thyroid carcinoma TT cells. Oncogene 2015, 34, 1292–1299. [Google Scholar] [CrossRef] [PubMed]
  101. Gowan, S.M.; Heald, R.; Stevens, M.F.G.; Kelland, L.R. Potent inhibition of telomerase by small-molecule pentacyclic acridines capable of interacting with G-quadruplexes. Mol. Pharmacol. 2001, 60, 981–988. [Google Scholar] [CrossRef]
  102. Gillard, M.; Weynand, J.; Bonnet, H.; Loiseau, F.; Decottignies, A.; Dejeu, J.; Defrancq, E.; Elias, B. Flexible RuII Schiff Base Complexes: G-Quadruplex DNA Binding and Photo-Induced Cancer Cell Death. Chem. Eur. J. 2020, 26, 13849–13860. [Google Scholar] [CrossRef]
  103. Sun, D.; Liu, W.J.; Guo, K.; Rusche, J.J.; Ebbinghaus, S.; Gokhale, V.; Hurley, L.H. The proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure that can be targeted by G-quadruplex-interactive agents. Mol. Cancer Ther. 2008, 7, 880–889. [Google Scholar] [CrossRef] [Green Version]
  104. Che, T.; Chen, S.B.; Tu, J.L.; Wang, B.; Wang, Y.Q.; Zhang, Y.; Wang, J.; Wang, Z.Q.; Zhang, Z.P.; Ou, T.M.; et al. Discovery of Novel Schizocommunin Derivatives as Telomeric G-Quadruplex Ligands That Trigger Telomere Dysfunction and the Deoxyribonucleic Acid (DNA) Damage Response. J. Med. Chem. 2018, 61, 3436–3453. [Google Scholar] [CrossRef] [PubMed]
  105. O’Hagan, M.P.; Peñalver, P.; Gibson, R.S.L.; Morales, J.C.; Galan, M.C. Stiff-Stilbene Ligands Target G-Quadruplex DNA and Exhibit Selective Anticancer and Antiparasitic Activity. Chem. Eur. J. 2020, 26, 6224–6233. [Google Scholar] [CrossRef]
  106. Amato, J.; Platella, C.; Iachettini, S.; Zizza, P.; Musumeci, D.; Cosconati, S.; Pagano, A.; Novellino, E.; Biroccio, A.; Randazzo, A.; et al. Tailoring a lead-like compound targeting multiple G-quadruplex structures. Eur. J. Med. Chem. 2019, 163, 295–306. [Google Scholar] [CrossRef]
  107. Miyazaki, T.; Pan, Y.; Joshi, K.; Purohit, D.; Hu, B.; Demir, H.; Mazumder, S.; Okabe, S.; Yamori, T.; Viapiano, M.; et al. Telomestatin impairs glioma stem cell survival and growth through the disruption of telomeric G-quadruplex and inhibition of the proto-oncogene, c-Myb. Clin. Cancer Res. 2012, 18, 1268–1280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  108. Kim, M.Y.; Vankayalapati, H.; Shin-Ya, K.; Wierzba, K.; Hurley, L.H. Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J. Am. Chem. Soc. 2002, 124, 2098–2099. [Google Scholar] [CrossRef] [PubMed]
  109. Dutta, D.; Debnath, M.; Müller, D.; Paul, R.; Das, T.; Bessi, I.; Schwalbe, H.; Dash, J. Cell penetrating thiazole peptides inhibit c-MYC expression via site-specific targeting of c-MYC G-quadruplex. Nucleic Acids Res. 2018, 46, 5355–5365. [Google Scholar] [CrossRef]
  110. Le, V.H.; Nagesh, N.; Lewis, E.A. Bcl-2 Promoter Sequence G-Quadruplex Interactions with Three Planar and Non-Planar Cationic Porphyrins: TMPyP4, TMPyP3, and TMPyP2. PLoS ONE 2013, 8, e72462. [Google Scholar] [CrossRef] [Green Version]
  111. Grand, C.L.; Han, H.; Mũnoz, R.M.; Weitman, S.; Von Hoff, D.D.; Hurley, L.H.; Bearss, D.J. The cationic porphyrin TMPyP4 down-regulates c-MYC and human telomerase reverse transcriptase expression and inhibits tumor growth in vivo. Mol. Cancer Ther. 2002, 1, 565–573. [Google Scholar] [PubMed]
  112. Paramasivam, M.; Membrino, A.; Cogoi, S.; Fukuda, H.; Nakagama, H.; Xodo, L.E. Protein hnRNP A1 and its derivative Up1 unfold quadruplex DNA in the human KRAS promoter: Implications for transcription. Nucleic Acids Res. 2009, 37, 2841–2853. [Google Scholar] [CrossRef] [Green Version]
  113. Qin, Y.; Rezler, E.M.; Gokhale, V.; Sun, D.; Hurley, L.H. Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activity by TMPyP4. Nucleic Acids Res. 2007, 35, 7698–7713. [Google Scholar] [CrossRef] [Green Version]
  114. Wheelhouse, R.T.; Sun, D.; Han, H.; Han, F.X.; Hurley, L.H. Cationic porphyrins as telomerase inhibitors: The interaction of tetra- (N-methyl-4-pyridyl)porphine with quadruplex DNA. J. Am. Chem. Soc. 1998, 120, 3261–3262. [Google Scholar] [CrossRef]
  115. Sun, D.; Guo, K.; Rusche, J.J.; Hurley, L.H. Facilitation of a structural transition in the polypurine/polypyrimidine tract within the proximal promoter region of the human VEGF gene by the presence of potassium and G-quadruplex-interactive agents. Nucleic Acids Res. 2005, 33, 6070–6080. [Google Scholar] [CrossRef]
  116. Li, F.; Zhou, J.; Xu, M.; Yuan, G. Exploration of G-quadruplex function in c-Myb gene and its transcriptional regulation by topotecan. Int. J. Biol. Macromol. 2018, 107, 1474–1479. [Google Scholar] [CrossRef]
  117. Panda, D.; Saha, P.; Das, T.; Dash, J. Target guided synthesis using DNA nano-templates for selectively assembling a G-quadruplex binding c-MYC inhibitor. Nat. Commun. 2017, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
  118. Muench, D.; Rezzoug, F.; Thomas, S.D.; Xiao, J.; Islam, A.; Miller, D.M.; Sedoris, K.C. Quadruplex-forming oligonucleotide targeted to the VEGF promoter inhibits growth of non-small cell lung cancer cells. PLoS ONE 2019, 14, e0211046. [Google Scholar] [CrossRef] [PubMed]
  119. Sabharwal, N.C.; Chen, J.; Lee, J.H.J.; Gangemi, C.M.A.; D’urso, A.; Yatsunyk, L.A. Interactions between spermine-derivatized tentacle porphyrins and the human telomeric DNA G-Quadruplex. Int. J. Mol. Sci. 2018, 19, 3686. [Google Scholar] [CrossRef] [Green Version]
  120. Smith, N.M.; Labrunie, G.; Corry, B.; Tran, P.L.T.; Norret, M.; Djavaheri-Mergny, M.; Raston, C.L.; Mergny, J.L. Unraveling the relationship between structure and stabilization of triarylpyridines as G-quadruplex binding ligands. Org. Biomol. Chem. 2011, 9, 6154–6162. [Google Scholar] [CrossRef] [PubMed]
  121. Zhou, K.; Liu, J.; Xiong, X.; Cheng, M.; Hu, X.; Narva, S.; Zhao, X.; Wu, Y.; Zhang, W. Design, synthesis of 4,5-diazafluorene derivatives and their anticancer activity via targeting telomeric DNA G-quadruplex. Eur. J. Med. Chem. 2019, 178, 484–499. [Google Scholar] [CrossRef]
  122. Sun, D.; Liu, Y.; Yu, Q.; Liu, D.; Zhou, Y.; Liu, J. Selective nuclei accumulation of ruthenium(II) complex enantiomers that target G-quadruplex DNA. J. Inorg. Biochem. 2015, 150, 90–99. [Google Scholar] [CrossRef]
  123. Guliaev, A.B.; Leontis, N.B. Cationic 5,10,15,20-tetrakis (N-methylpyridinium-4-yl) porphyrin fully intercalates at 5′-CG-3′ steps of duplex DNA in solution. Biochemistry 1999, 38, 15425–15437. [Google Scholar] [CrossRef] [Green Version]
  124. Lee, Y.A.; Kim, J.O.; Cho, T.S.; Song, R.; Kim, S.K. Binding of meso-tetrakis(N-methylpyridium-4-yl)porphyrin to triplex oligonucleotides: Evidence for the porphyrin stacking in the major groove. J. Am. Chem. Soc. 2003, 125, 8106–8107. [Google Scholar] [CrossRef]
  125. Lin, C.; Wu, G.; Wang, K.; Onel, B.; Sakai, S.; Shao, Y.; Yang, D. Molecular Recognition of the Hybrid-2 Human Telomeric G-Quadruplex by Epiberberine: Insights into Conversion of Telomeric G-Quadruplex Structures. Angew. Chem. Int. Ed. 2018, 57, 10888–10893. [Google Scholar] [CrossRef] [PubMed]
  126. Doi, T.; Shibata, K.; Yoshida, M.; Takagi, M.; Tera, M.; Nagasawa, K.; Shin-Ya, K.; Takahashi, T. (S)-Stereoisomer of telomestatin as a potent G-quadruplex binder and telomerase inhibitor. Org. Biomol. Chem. 2011, 9, 387–393. [Google Scholar] [CrossRef] [PubMed]
  127. Rizzo, A.; Iachettini, S.; Zizza, P.; Cingolani, C.; Porru, M.; Artuso, S.; Stevens, M.; Hummersone, M.; Biroccio, A.; Salvati, E.; et al. Identification of novel RHPS4-derivative ligands with improved toxicological profiles and telomere-targeting activities. J. Exp. Clin. Cancer Res. 2014, 33, 1–8. [Google Scholar] [CrossRef] [PubMed]
  128. Rodriguez, R.; Müller, S.; Yeoman, J.A.; Trentesaux, C.; Riou, J.F.; Balasubramanian, S. A novel small molecule that alters shelterin integrity and triggers a DNA-damage response at telomeres. J. Am. Chem. Soc. 2008, 130, 15758–15759. [Google Scholar] [CrossRef] [Green Version]
  129. Rodriguez, R.; Miller, K.M.; Forment, J.V.; Bradshaw, C.R.; Nikan, M.; Britton, S.; Oelschlaegel, T.; Xhemalce, B.; Balasubramanian, S.; Jackson, S.P. Small-molecule-induced DNA damage identifies alternative DNA structures in human genes. Nat. Chem. Biol. 2012, 8, 301–310. [Google Scholar] [CrossRef] [Green Version]
  130. Chambers, V.S.; Marsico, G.; Boutell, J.M.; Di Antonio, M.; Smith, G.P.; Balasubramanian, S. High-throughput sequencing of DNA G-quadruplex structures in the human genome. Nat. Biotechnol. 2015, 33, 877–881. [Google Scholar] [CrossRef] [Green Version]
  131. Kim, M.Y.; Duan, W.; Gleason-Guzman, M.; Hurley, L.H. Design, synthesis, and biological evaluation of a series of fluoroquinoanthroxazines with contrasting dual mechanisms of action against topoisomerase II and G-quadruplexes. J. Med. Chem. 2003, 46, 571–583. [Google Scholar] [CrossRef] [PubMed]
  132. Drygin, D.; Siddiqui-Jain, A.; O’Brien, S.; Schwaebe, M.; Lin, A.; Bliesath, J.; Ho, C.B.; Proffitt, C.; Trent, K.; Whitten, J.P.; et al. Anticancer Activity of CX-3543: A Direct Inhibitor of rRNA Biogenesis. Cancer Res. 2009, 69, 7653–7661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  133. Drygin, D.; Lin, A.; Bliesath, J.; Ho, C.B.; O’Brien, S.E.; Proffitt, C.; Omori, M.; Haddach, M.; Schwaebe, M.K.; Siddiqui-Jain, A.; et al. Targeting RNA polymerase I with an oral small molecule CX-5461 inhibits ribosomal RNA synthesis and solid tumor growth. Cancer Res. 2011, 71, 1418–1430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  134. Jackobel, A.J.; Zeberl, B.J.; Glover, D.M.; Fakhouri, A.M.; Knutson, B.A. DNA binding preferences of S. cerevisiae RNA polymerase I Core Factor reveal a preference for the GC-minor groove and a conserved binding mechanism. Biochim. Biophys. Acta Gene Regul. Mech. 2019, 1862, 194408. [Google Scholar] [CrossRef]
  135. Muoio, D.; Berardinelli, F.; Leone, S.; Coluzzi, E.; di Masi, A.; Doria, F.; Freccero, M.; Sgura, A.; Folini, M.; Antoccia, A. Naphthalene diimide-derivatives G-quadruplex ligands induce cell proliferation inhibition, mild telomeric dysfunction and cell cycle perturbation in U251MG glioma cells. FEBS J. 2018, 285, 3769–3785. [Google Scholar] [CrossRef] [PubMed]
  136. Răsădean, D.M.; Sheng, B.; Dash, J.; Pantoş, G.D. Amino-Acid-Derived Naphthalenediimides as Versatile G-Quadruplex Binders. Chem. Eur. J. 2017, 23, 8491–8499. [Google Scholar] [CrossRef] [Green Version]
  137. Recagni, M.; Tassinari, M.; Doria, F.; Cimino-reale, G.; Za, N.; Freccero, M.; Folini, M.; Richter, S.N. The Oncogenic Signaling Pathways in BRAF -Mutant Melanoma Cells Are Modulated by Naphthalene. Cells 2019, 8, 1274. [Google Scholar] [CrossRef] [Green Version]
  138. Ohnmacht, S.A.; Marchetti, C.; Gunaratnam, M.; Besser, R.J.; Haider, S.M.; Di Vita, G.; Lowe, H.L.; Mellinas-Gomez, M.; Diocou, S.; Robson, M.; et al. A G-quadruplex-binding compound showing anti-tumour activity in an in vivo model for pancreatic cancer. Sci. Rep. 2015, 5, 1–11. [Google Scholar] [CrossRef] [Green Version]
  139. Marchetti, C.; Zyner, K.G.; Ohnmacht, S.A.; Robson, M.; Haider, S.M.; Morton, J.P.; Marsico, G.; Vo, T.; Laughlin-Toth, S.; Ahmed, A.A.; et al. Targeting Multiple Effector Pathways in Pancreatic Ductal Adenocarcinoma with a G-Quadruplex-Binding Small Molecule. J. Med. Chem. 2018, 61, 2500–2517. [Google Scholar] [CrossRef]
  140. Ahmed, A.A.; Marchetti, C.; Ohnmacht, S.A.; Neidle, S. A G-quadruplex-binding compound shows potent activity in human gemcitabine-resistant pancreatic cancer cells. Sci. Rep. 2020, 10. [Google Scholar] [CrossRef]
  141. Lavrado, J.; Brito, H.; Borralho, P.M.; Ohnmacht, S.A.; Kim, N.S.; Leitão, C.; Pisco, S.; Gunaratnam, M.; Rodrigues, C.M.P.; Moreira, R.; et al. KRAS oncogene repression in colon cancer cell lines by G-quadruplex binding indolo[3,2-c]quinolines. Sci. Rep. 2015, 5, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  142. Funke, A.; Weisz, K. Thermodynamic signature of indoloquinolines interacting with G-quadruplexes: Impact of ligand side chain. Biochimie 2019, 157, 142–148. [Google Scholar] [CrossRef]
  143. Qin, H.; Zhao, C.; Sun, Y.; Ren, J.; Qu, X. Metallo-supramolecular Complexes Enantioselectively Eradicate Cancer Stem Cells in Vivo. J. Am. Chem. Soc. 2017, 139, 16201–16209. [Google Scholar] [CrossRef] [PubMed]
  144. Montoya, J.J.; Turnidge, M.A.; Wai, D.H.; Patel, A.R.; Lee, D.W.; Gokhale, V.; Hurley, L.H.; Arceci, R.J.; Wetmore, C.; Azorsa, D.O. In vitro activity of a G-quadruplex-stabilizing small molecule that synergizes with Navitoclax to induce cytotoxicity in acute myeloid leukemia cells. BMC Cancer 2019, 19, 1–11. [Google Scholar] [CrossRef]
  145. Flusberg, D.A.; Rizvi, N.F.; Kutilek, V.; Andrews, C.; Saradjian, P.; Chamberlin, C.; Curran, P.; Swalm, B.; Kattar, S.; Smith, G.F.; et al. Identification of G-Quadruplex-Binding Inhibitors of Myc Expression through Affinity Selection–Mass Spectrometry. SLAS Discov. 2019, 24, 142–157. [Google Scholar] [CrossRef] [PubMed]
  146. Qi, Q.; Yang, C.; Xia, Y.; Guo, S.; Song, D.; Su, H. Preferential Binding of π-Ligand Porphyrin Targeting 5′-5′ Stacking Interface of Human Telomeric RNA G-Quadruplex Dimer. J. Phys. Chem. Lett. 2019, 10, 2143–2150. [Google Scholar] [CrossRef]
  147. Ferino, A.; Nicoletto, G.; D’Este, F.; Zorzet, S.; Lago, S.; Richter, S.N.; Tikhomirov, A.; Shchekotikhin, A.; Xodo, L.E. Photodynamic Therapy for ras-Driven Cancers: Targeting G-Quadruplex RNA Structures with Bifunctional Alkyl-Modified Porphyrins. J. Med. Chem. 2020, 63, 1245–1260. [Google Scholar] [CrossRef] [PubMed]
  148. Miglietta, G.; Cogoi, S.; Marinello, J.; Capranico, G.; Tikhomirov, A.S.; Shchekotikhin, A.; Xodo, L.E. RNA G-Quadruplexes in Kirsten Ras (KRAS) Oncogene as Targets for Small Molecules Inhibiting Translation. J. Med. Chem. 2017, 60, 9448–9461. [Google Scholar] [CrossRef] [PubMed]
  149. Jodoin, R.; Carrier, J.C.; Rivard, N.; Bisaillon, M.; Perreault, J.P. G-quadruplex located in the 5′UTR of the BAG-1 mRNA affects both its cap-dependent and cap-independent translation through global secondary structure maintenance. Nucleic Acids Res. 2019, 47, 10247–10266. [Google Scholar] [CrossRef] [PubMed]
  150. Carvalho, J.; Santos, T.; Carrilho, R.; Sousa, F.; Salgado, G.F.; Queiroz, J.A.; Cruz, C. Ligand screening to pre-miRNA 149 G-quadruplex investigated by molecular dynamics. J. Biomol. Struct. Dyn. 2020, 38, 2276–2286. [Google Scholar] [CrossRef] [PubMed]
  151. Halder, K.; Largy, E.; Benzler, M.; Teulade-Fichou, M.P.; Hartig, J.S. Efficient Suppression of Gene Expression by Targeting 5′-UTR-Based RNA Quadruplexes with Bisquinolinium Compounds. ChemBioChem 2011, 12, 1663–1668. [Google Scholar] [CrossRef]
  152. Zhang, J.; Harvey, S.E.; Cheng, C. A high-throughput screen identifies small molecule modulators of alternative splicing by targeting RNA G-quadruplexes. Nucleic Acids Res. 2019, 47, 3667–3679. [Google Scholar] [CrossRef] [Green Version]
  153. Dai, J.; Liu, Z.Q.; Wang, X.Q.; Lin, J.; Yao, P.F.; Huang, S.L.; Ou, T.M.; Tan, J.H.; Li, D.; Gu, L.Q.; et al. Discovery of small molecules for up-regulating the translation of antiamyloidogenic secretase, a disintegrin and metalloproteinase 10 (ADAM10), by binding to the G-quadruplex-forming sequence in the 5′ untranslated region (UTR) of its mRNA. J. Med. Chem. 2015, 58, 3875–3891. [Google Scholar] [CrossRef]
  154. Weldon, C.; Dacanay, J.G.; Gokhale, V.; Boddupally, P.V.L.; Behm-Ansmant, I.; Burley, G.A.; Branlant, C.; Hurley, L.H.; Dominguez, C.; Eperon, I.C. Specific G-quadruplex ligands modulate the alternative splicing of Bcl-X. Nucleic Acids Res. 2018, 46, 886–896. [Google Scholar] [CrossRef] [PubMed]
  155. Tan, W.; Yi, L.; Zhu, Z.; Zhang, L.; Zhou, J.; Yuan, G. Hsa-miR-1587 G-quadruplex formation and dimerization induced by NH4+, molecular crowding environment and jatrorrhizine derivatives. Talanta 2018, 179, 337–343. [Google Scholar] [CrossRef]
  156. Mirihana Arachchilage, G.; Kharel, P.; Reid, J.; Basu, S. Targeting of G-Quadruplex Harboring Pre-miRNA 92b by LNA Rescues PTEN Expression in NSCL Cancer Cells. ACS Chem. Biol. 2018, 13, 909–914. [Google Scholar] [CrossRef]
  157. Neckles, C.; Boer, R.E.; Aboreden, N.; Cross, A.M.; Walker, R.L.; Kim, B.H.; Kim, S.; Schneekloth, J.S.; Caplen, N.J. HNRNPH1-dependent splicing of a fusion oncogene reveals a targetable RNA G-quadruplex interaction. RNA 2019, 25, 1731–1750. [Google Scholar] [CrossRef] [Green Version]
  158. Guo, S.; Lu, H. Conjunction of potential G-quadruplex and adjacent cis-elements in the 5′ UTR of hepatocyte nuclear factor 4-Alpha strongly inhibit protein expression. Sci. Rep. 2017, 7, 1–12. [Google Scholar] [CrossRef] [PubMed]
  159. Wang, S.K.; Wu, Y.; Wang, X.Q.; Kuang, G.T.; Zhang, Q.; Lin, S.L.; Liu, H.Y.; Tan, J.H.; Huang, Z.S.; Ou, T.M. Discovery of Small Molecules for Repressing Cap-Independent Translation of Human Vascular Endothelial Growth Factor (hVEGF) as Novel Antitumor Agents. J. Med. Chem. 2017, 60, 5306–5319. [Google Scholar] [CrossRef] [PubMed]
  160. Peng, W.; Sun, Z.Y.; Zhang, Q.; Cheng, S.Q.; Wang, S.K.; Wang, X.N.; Kuang, G.T.; Su, X.X.; Tan, J.H.; Huang, Z.S.; et al. Design, Synthesis, and Evaluation of Novel p-(Methylthio)styryl Substituted Quindoline Derivatives as Neuroblastoma RAS (NRAS) Repressors via Specific Stabilizing the RNA G-Quadruplex. J. Med. Chem. 2018, 61, 6629–6646. [Google Scholar] [CrossRef]
  161. Katsuda, Y.; Sato, S.I.; Asano, L.; Morimura, Y.; Furuta, T.; Sugiyama, H.; Hagihara, M.; Uesugi, M. A Small Molecule That Represses Translation of G-Quadruplex-Containing mRNA. J. Am. Chem. Soc. 2016, 138, 9037–9040. [Google Scholar] [CrossRef]
  162. Bugaut, A.; Rodriguez, R.; Kumari, S.; Hsu, S.T.D.; Balasubramanian, S. Small molecule-mediated inhibition of translation by targeting a native RNA G-quadruplex. Org. Biomol. Chem. 2010, 8, 2771–2776. [Google Scholar] [CrossRef]
  163. Tan, W.; Zhou, J.; Gu, J.; Xu, M.; Xu, X.; Yuan, G. Probing the G-quadruplex from hsa-miR-3620-5p and inhibition of its interaction with the target sequence. Talanta 2016, 154, 560–566. [Google Scholar] [CrossRef]
  164. Ghosh, A.; Ekka, M.K.; Tawani, A.; Kumar, A.; Chakraborty, D.; Maiti, S. Restoration of miRNA-149 Expression by TmPyP4 Induced Unfolding of Quadruplex within Its Precursor. Biochemistry 2019, 58, 514–525. [Google Scholar] [CrossRef] [PubMed]
  165. Li, F.; Tan, W.; Chen, H.; Zhou, J.; Xu, M.; Yuan, G. Up- and downregulation of mature miR-1587 function by modulating its G-quadruplex structure and using small molecules. Int. J. Biol. Macromol. 2019, 121, 127–134. [Google Scholar] [CrossRef]
  166. Faudale, M.; Cogoi, S.; Xodo, L.E. Photoactivated cationic alkyl-substituted porphyrin binding to g4-RNA in the 5′-UTR of KRAS oncogene represses translation. Chem. Commun. 2012, 48, 874–876. [Google Scholar] [CrossRef] [PubMed]
  167. Kawauchi, K.; Sugimoto, W.; Yasui, T.; Murata, K.; Itoh, K.; Takagi, K.; Tsuruoka, T.; Akamatsu, K.; Tateishi-Karimata, H.; Sugimoto, N.; et al. An anionic phthalocyanine decreases NRAS expression by breaking down its RNA G-quadruplex. Nat. Commun. 2018, 9, 1–12. [Google Scholar] [CrossRef]
  168. Pagano, A.; Iaccarino, N.; Abdelhamid, M.A.S.; Brancaccio, D.; Garzarella, E.U.; Di Porzio, A.; Novellino, E.; Waller, Z.A.E.; Pagano, B.; Amato, J.; et al. Common G-quadruplex binding agents found to interact with i-motif-forming DNA: Unexpected multi-target-directed compounds. Front. Chem. 2018, 6, 1–13. [Google Scholar] [CrossRef]
  169. Shu, B.; Cao, J.; Kuang, G.; Qiu, J.; Zhang, M.; Zhang, Y.; Wang, M.; Li, X.; Kang, S.; Ou, T.M.; et al. Syntheses and evaluation of new acridone derivatives for selective binding of oncogene c-: Myc promoter i-motifs in gene transcriptional regulation. Chem. Commun. 2018, 54, 2036–2039. [Google Scholar] [CrossRef]
  170. Satpathi, S.; Sappati, S.; Das, K.; Hazra, P. Structural characteristics requisite for the ligand-based selective detection of i-motif DNA. Org. Biomol. Chem. 2019, 17, 5392–5399. [Google Scholar] [CrossRef] [PubMed]
  171. Takahashi, S.; Bhattacharjee, S.; Ghosh, S.; Sugimoto, N.; Bhowmik, S. Preferential targeting cancer-related i-motif DNAs by the plant flavonol fisetin for theranostics applications. Sci. Rep. 2020, 10, 1–13. [Google Scholar] [CrossRef] [PubMed]
  172. Yang, Y.; Fu, H.; Qian, C.; Li, H.; Chen, D.D.Y. Characterization of interaction between Bcl-2 oncogene promoter I-Motif DNA and flavonoids using electrospray ionization mass spectrometry and pressure-assisted capillary electrophoresis frontal analysis. Talanta 2020, 215, 120885. [Google Scholar] [CrossRef] [PubMed]
  173. Kendrick, S.; Kang, H.J.; Alam, M.P.; Madathil, M.M.; Agrawal, P.; Gokhale, V.; Yang, D.; Hecht, S.M.; Hurley, L.H. The dynamic character of the BCL2 promoter i-motif provides a mechanism for modulation of gene expression by compounds that bind selectively to the alternative DNA hairpin structure. J. Am. Chem. Soc. 2014, 136, 4161–4171. [Google Scholar] [CrossRef] [PubMed]
  174. Saha, P.; Panda, D.; Müller, D.; Maity, A.; Schwalbe, H.; Dash, J. In situ formation of transcriptional modulators using non-canonical DNA i-motifs. Chem. Sci. 2020, 11, 2058–2067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  175. Sedghi Masoud, S.; Yamaoki, Y.; Ma, Y.; Marchand, A.; Winnerdy, F.R.; Gabelica, V.; Phan, A.T.; Katahira, M.; Nagasawa, K. Analysis of Interactions between Telomeric i-Motif DNA and a Cyclic Tetraoxazole Compound. ChemBioChem 2018, 19, 2268–2272. [Google Scholar] [CrossRef]
  176. Kaiser, C.E.; Van Ert, N.A.; Agrawal, P.; Chawla, R.; Yang, D.; Hurley, L.H. Insight into the Complexity of the i-Motif and G-Quadruplex DNA Structures Formed in the KRAS Promoter and Subsequent Drug-Induced Gene Repression. J. Am. Chem. Soc. 2017, 139, 8522–8536. [Google Scholar] [CrossRef]
  177. Gao, N.; Wang, Y.; Wei, C. Interactions of phenanthroline compounds with i-motif DNA. Chem. Res. Chin. Univ. 2014, 30, 495–499. [Google Scholar] [CrossRef]
  178. Li, X.; Peng, Y.; Ren, J.; Qu, X. Carboxyl-modified single-walled carbon nanotubes selectively induce human telomeric i-motif formation. Proc. Natl. Acad. Sci. USA 2006, 103, 19658–19663. [Google Scholar] [CrossRef] [Green Version]
  179. Fedoroff, O.Y.; Rangan, A.; Chemeris, V.V.; Hurley, L.H. Cationic porphyrins promote the formation of i-motif DNA and bind peripherally by a nonintercalative mechanism. Biochemistry 2000, 39, 15083–15090. [Google Scholar] [CrossRef] [PubMed]
  180. Benabou, S.; Aviñó, A.; Lyonnais, S.; González, C.; Eritja, R.; De Juan, A.; Gargallo, R. i-motif structures in long cytosine-rich sequences found upstream of the promoter region of the SMARCA4 gene. Biochimie 2017, 140, 20–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  181. Wright, E.P.; Day, H.A.; Ibrahim, A.M.; Kumar, J.; Boswell, L.J.E.; Huguin, C.; Stevenson, C.E.M.; Pors, K.; Waller, Z.A.E. Mitoxantrone and analogues bind and stabilize i-motif forming DNA sequences. Sci. Rep. 2016, 6, 4–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  182. Chen, Y.; Qu, K.; Zhao, C.; Wu, L.; Ren, J.; Wang, J.; Qu, X. Insights into the biomedical effects of carboxylated single-wall carbon nanotubes on telomerase and telomeres. Nat. Commun. 2012, 3, 1074. [Google Scholar] [CrossRef] [PubMed]
Cancers 13 03156 g001 550
Figure 1. Quadruplex structures. (A) Chemical structure of a G4 and schematic representation of various G4 topologies. (B) Chemical structure of an i-Motif and schematic representation of various i-Motif topologies.
Figure 1. Quadruplex structures. (A) Chemical structure of a G4 and schematic representation of various G4 topologies. (B) Chemical structure of an i-Motif and schematic representation of various i-Motif topologies.
Cancers 13 03156 g001
Cancers 13 03156 g002 550
Figure 2. Quadruplex functions. (A) Schematic diagram of the multiple roles of quadruplexes in several cellular events. (B) Representation of antitumoral effects mediated by quadruplex ligands for cancer therapy.
Figure 2. Quadruplex functions. (A) Schematic diagram of the multiple roles of quadruplexes in several cellular events. (B) Representation of antitumoral effects mediated by quadruplex ligands for cancer therapy.
Cancers 13 03156 g002
Cancers 13 03156 g003 550
Figure 3. Quadruplex ligands with different binding modes. (A) NMR structure from different rotation angles of human C-MYC G4 (TGAGGGTGGGTAGGGTGGGTAA) bound to a carbazole derivative (Protein Data Bank: 6JJ0). (B) NMR structure from different rotation angles of the same human C-MYC G4 than (A) bound to a benzofuran-containing compound (Protein Data Bank: 5W77).
Figure 3. Quadruplex ligands with different binding modes. (A) NMR structure from different rotation angles of human C-MYC G4 (TGAGGGTGGGTAGGGTGGGTAA) bound to a carbazole derivative (Protein Data Bank: 6JJ0). (B) NMR structure from different rotation angles of the same human C-MYC G4 than (A) bound to a benzofuran-containing compound (Protein Data Bank: 5W77).
Cancers 13 03156 g003
Cancers 13 03156 g004 550
Figure 4. Timeline for quadruplex interactive ligands. Timeline showing the year in which the small-molecule compounds were first described as quadruplex interactive ligands. DNA G4 ligands are in black, RNA G4 ligands are in red and i-Motif ligands are in green.
Figure 4. Timeline for quadruplex interactive ligands. Timeline showing the year in which the small-molecule compounds were first described as quadruplex interactive ligands. DNA G4 ligands are in black, RNA G4 ligands are in red and i-Motif ligands are in green.
Cancers 13 03156 g004
Cancers 13 03156 g005 550
Figure 5. Chemical structure of quadruplex ligands used in clinical trials. CX-3543 and CX-5461 are included.
Figure 5. Chemical structure of quadruplex ligands used in clinical trials. CX-3543 and CX-5461 are included.
Cancers 13 03156 g005
Cancers 13 03156 g006 550
Figure 6. Chemical structure of the main chemo-families of G4 ligands. Anthraquinones, Benzo[a]phenoxazines, Indoloquinolines, Naphtahlene diimides, Phenantrolines, Quinazolines and Telomestatin derivatives are shown.
Figure 6. Chemical structure of the main chemo-families of G4 ligands. Anthraquinones, Benzo[a]phenoxazines, Indoloquinolines, Naphtahlene diimides, Phenantrolines, Quinazolines and Telomestatin derivatives are shown.
Cancers 13 03156 g006
Table
Table 1. DNA G4-interacting ligands reported to exhibit antitumoral effect and their targets. Ligands that have been demonstrated to possess antitumoral activity in vivo are marked with an asterisk.
Table 1. DNA G4-interacting ligands reported to exhibit antitumoral effect and their targets. Ligands that have been demonstrated to possess antitumoral activity in vivo are marked with an asterisk.
LigandTargetEffect
Adriamycin *Tel [40]Telomere dysfunction
APTO-253 *c-KIT [41]; c-MYC [41]; Tel [41]Inhibition of oncogene transcription and telomere dysfunction
Benzo[a]phenoxazinesc-KIT [42]; Tel [43]Inhibition of oncogene transcription and telomere dysfunction
Benzofuranc-MYC [44]Inhibition of oncogene transcription
Berberine *c-KIT [45]; k-RAS [46]; Tel [47]Inhibition of oncogene transcription and telomere dysfunction
BRACO-19 *Tel [48]Telomere dysfunction
BTC-fTel [49]Telomere dysfunction
BZT-Indoliumc-MYC [50]Inhibition of oncogene transcription
Carbazole TOBCL2 [51]Inhibition of oncogene transcription
CepharanthineSTAT3 [52]Inhibition of oncogene transcription
cIKP-PIPc-MYC [53]Inhibition of oncogene transcription
Co- and Pd-porphyrins *k-RAS [54]Inhibition of oncogene transcription
CX-3543 *Pan-binder [55]Inhibition of oncogene transcription
CX-5461 *Pan-binder [55]Inhibition of oncogene transcription
C-3c-MYC [56]Inhibition of oncogene transcription
C8k-RAS [57]Inhibition of oncogene transcription
C-19k-RAS [58]Inhibition of oncogene transcription
Diquinolinyl-pyridinesc-KIT [59]; c-MYC [60] Tel [59]Inhibition of oncogene transcription and telomere dysfunction
Disubstituted amidoanthraquinonesTel [61]Telomere dysfunction
DIZ-3Tel [62]Telomere dysfunction
DTETel [63]Telomere dysfunction
Epirubicin *Tel [64]Telomere dysfunction
FuropyridazinonesBCL2 [65]Inhibition of oncogene transcription
GQC-05c-MYC [66]Inhibition of oncogene transcription
GSA1129PDGFRb [67]Inhibition of oncogene transcription
dGTC365hTERT [68]Telomere dysfunction
Indoloquinolines *c-KIT [69]; c-MYC [70]; k-RAS [69];
Tel [69]; VEGF [71]		Inhibition of oncogene transcription and telomere dysfunction
Isoalloxazinesc-KIT [72]Inhibition of oncogene transcription
IZCZ-3 *c-MYC [73]Inhibition of oncogene transcription
IZNP-1Tel [74]Telomere dysfunction
Liensinine *FGFR2 [75]Inhibition of oncogene transcription
Mitoxantrone *Tel [76]; WT1 [77]Inhibition of oncogene transcription and telomere dysfunction
m-TMPipEOPPTel [78]Telomere dysfunction
Naphthalene diimides *BCL2 [79]; c-KIT [80]; MDM2 [81]; Ribosomal DNA [82]; Tel [83]Inhibition of oncogene transcription and telomere dysfunction
Ni-MTel [84]Telomere dysfunction
Ni-PTel [85]Telomere dysfunction
Nitidine *k-RAS [73]Inhibition of oncogene transcription
Oxazole telomestatinsTel [86,87]Telomere dysfunction
PBP2BCL2 [88]Inhibition of oncogene transcription
Phenanthrolinesc-KIT [89]; c-MYC [89]; Tel [90]Inhibition of oncogene transcription and telomere dysfunction
Phen-DC3c-MYC [91]; Tel [92]Inhibition of oncogene transcription and telomere dysfunction
PM2VEGF [93]Inhibition of oncogene transcription
Porphyrin- photosensitizerk-RAS [94]Inhibition of oncogene transcription
Prolinamide- peptidomimeticBCL2 [95]; c-MYC [95]Inhibition of oncogene transcription
Pyridostatin *Pan-binder [19]Inhibition of oncogene transcription
QN-1c-MYC [96]Inhibition of oncogene transcription
Quercetin *Tel [97]Telomere dysfunction
Quinazolinesc-KIT [98]; c-MYC [99]; RET [100]Inhibition of oncogene transcription
RHPS4 *Tel [101]Telomere dysfunction
Ru-SchiffTel [102]Telomere dysfunction
Se2SAPVEGF [103]Inhibition of oncogene transcription
Schizocommunins *Tel [104]Telomere dysfunction
Stiff-stilbenesTel [105]Telomere dysfunction
S4-5c-MYC [106]; Tel [106]Inhibition of oncogene transcription and telomere dysfunction
Telomestatin *c-MYB [107]; Tel [108]Inhibition of oncogene transcription and telomere dysfunction
TH3c-MYC [109]Inhibition of oncogene transcription
TMPyP4 *BCL2 [110]; c-MYC [111]; k-RAS [112]; PDGFa [113]; Tel [114]; VEGF [115]Inhibition of oncogene transcription and telomere dysfunction
Topotecan *c-MYB [116]Inhibition of oncogene transcription
Tz1c-MYC [117]Inhibition of oncogene transcription
VEGFq oligoVEGF [118]Inhibition of oncogene transcription
(Zn)TCPPSpm4Tel [119]Telomere dysfunction
20A *c-KIT [120], k-RAS [120], Tel [120]Inhibition of oncogene transcription and telomere dysfunction
4,5-diazafluorenesTel [121]Telomere dysfunction
Λ-RuTel [122]Telomere dysfunction
Table
Table 2. RNA G4-interacting ligands reported to exhibit antitumoral effect and their targets. Ligands that have been demonstrated to possess antitumoral activity in vivo are marked with an asterisk.
Table 2. RNA G4-interacting ligands reported to exhibit antitumoral effect and their targets. Ligands that have been demonstrated to possess antitumoral activity in vivo are marked with an asterisk.
LigandTargetEffect
Alkyl porphyrins *k-RAS [147]; n-RAS [147]Inhibition of oncogene translation
Anthrafurandionek-RAS [148]Inhibition of oncogene translation
BisquinoliniumsBAG1 [149]; pre-miRNA149 [150]; TRF2 [151]Inhibition of oncogene translation and alteration of miRNA biogenesis
CarboxypyridostatinBAG1 [149]Inhibition of oncogene translation
CephaelinePan-binder [152]Inhibition of oncogene translation
C-12459hTERT [31]Telomere dysfunction
C-14ADAM10 [153]Inhibition of oncogene translation
Emetine *Pan-binder [152]Inhibition of oncogene translation
GQC-05BCLX [154]Inhibition of oncogene translation
JatrorrhizinesmiRNA-1587 [155]Alteration of miRNA targeting
LNApre-miRNA-92b [156]Alteration of miRNA biogenesis
Pyridostatin *EWSR1 [157]; HNF4a [158]Inhibition of oncogene translation
Quinazolines *VEGF [159]Inhibition of oncogene translation
Quindolinesn-RAS [160]Inhibition of oncogene translation
RGB-1n-RAS [161]Inhibition of oncogene translation
RR82 and RR110n-RAS [162]Inhibition of oncogene translation
Sanguinarine *miRNA-3620-5p [163]Alteration of miRNA targeting
TMPyP4 *miRNA-149 [164]; miRNA-1587 [165]; TERRA [146]Alteration of miRNA targeting and telomere dysfunction
TMPyP4-C14k-RAS [166]Inhibition of oncogene translation
ZnAPCn-RAS [167]Inhibition of oncogene translation
Table
Table 3. I-Motif-interacting ligands reported to exhibit antitumoral effect and their targets. Ligands that have been demonstrated to possess antitumoral activity in vivo are marked with an asterisk.
Table 3. I-Motif-interacting ligands reported to exhibit antitumoral effect and their targets. Ligands that have been demonstrated to possess antitumoral activity in vivo are marked with an asterisk.
LigandTargetEffect
Berberine *Tel [168]Telomere dysfunction
BRACO-19 *Tel [168]Telomere dysfunction
B19c-MYC [169]Inhibition of oncogene transcription
C343Pan-binder [170]Inhibition of oncogene transcription
FisetinVEGF [171]Inhibition of oncogene transcription
FlavonoidsBCL2 [172]Inhibition of oncogene transcription
IMC-48 *BCL2 [173]Inhibition of oncogene transcription
iM nanoparticlesBCL2 [174]; c-MYC [174]Inhibition of oncogene transcription
L2H2-4OTDTel [175]Telomere dysfunction
Mitoxantrone *Tel [168]Telomere dysfunction
Nitidine *k-RAS [176]Inhibition of oncogene transcription
NSC309874PDGFRb [67]Inhibition of oncogene transcription
PBP1BCL2 [88]Inhibition of oncogene transcription
PhenanthrolinesTel [177]Telomere dysfunction
Phen-DC3Tel [168]Telomere dysfunction
Pyridostatin *Tel [168]Telomere dysfunction
RHPS4 *Tel [168]Telomere dysfunction
SWNTs *Tel [178]Telomere dysfunction
TMPyP4 *Tel [179]; SMARCA4 [180]Inhibition of oncogene transcription and telomere dysfunction
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sanchez-Martin, V.; Soriano, M.; Garcia-Salcedo, J.A. Quadruplex Ligands in Cancer Therapy. Cancers 2021, 13, 3156. https://doi.org/10.3390/cancers13133156

AMA Style

Sanchez-Martin V, Soriano M, Garcia-Salcedo JA. Quadruplex Ligands in Cancer Therapy. Cancers. 2021; 13(13):3156. https://doi.org/10.3390/cancers13133156

Chicago/Turabian Style

Sanchez-Martin, Victoria, Miguel Soriano, and Jose Antonio Garcia-Salcedo. 2021. "Quadruplex Ligands in Cancer Therapy" Cancers 13, no. 13: 3156. https://doi.org/10.3390/cancers13133156

APA Style

Sanchez-Martin, V., Soriano, M., & Garcia-Salcedo, J. A. (2021). Quadruplex Ligands in Cancer Therapy. Cancers, 13(13), 3156. https://doi.org/10.3390/cancers13133156

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop