Local Immune Changes in Early Stages of Inflammation and Carcinogenesis Correlate with the Collagen Scaffold Changes of the Colon Mucosa
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Design of the Experiment
2.2. Histopathological and Histochemical Evaluation
Confocal Microscopy Analysis
2.3. Isolation of RNA and RT-PCR Analysis
2.4. Isolation of Proteins
2.5. ELISA Assay
2.6. Statistical Evaluation
3. Results
3.1. Evaluation of Changes in the Colon Mucosa Scaffold
3.2. Selected Cytokine Production and Gene Expression in the Colon Mucosa 1 Month after DSS or AOM Inductions
3.2.1. ELISA Results
3.2.2. RT-PCR Results
3.2.3. Regional and Systemic Immune Responses: Mesenteric Lymph Nodes and Spleen
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- de Visser, K.E.; Coussens, L.M. The inflammatory tumor microenvironment and its impact on cancer development. Contrib. Microbiol. 2006, 13, 118–137. [Google Scholar] [CrossRef]
- Hui, L.; Chen, Y. Tumor microenvironment: Sanctuary of the devil. Cancer Lett. 2015, 368, 7–13. [Google Scholar] [CrossRef]
- Chiarugi, P.; Cirri, P. Metabolic exchanges within tumor microenvironment. Cancer Lett. 2016, 380, 272–280. [Google Scholar] [CrossRef]
- Yun, C.C. Lysophosphatidic Acid and Autotaxin-associated Effects on the Initiation and Progression of Colorectal Cancer. Cancers 2019, 11, 658. [Google Scholar] [CrossRef] [Green Version]
- Patidar, A.; Selvaraj, S.; Sarode, A.; Chauhan, P.; Chattopadhyay, D.; Saha, B. DAMP-TLR-cytokine axis dictates the fate of tumor. Cytokine 2018, 104, 114–123. [Google Scholar] [CrossRef]
- Marelli, G.; Sica, A.; Vannucci, L.; Allavena, P. Inflammation as target in cancer therapy. Curr. Opin. Pharmacol. 2017, 35, 57–65. [Google Scholar] [CrossRef]
- Vannucci, L. Stroma as an Active Player in the Development of the Tumor Microenvironment. Cancer Microenviron. Off. J. Int. Cancer Microenviron. Soc. 2015, 8, 159–166. [Google Scholar] [CrossRef] [Green Version]
- Zhang, D.; Li, L.; Jiang, H.; Li, Q.; Wang-Gillam, A.; Yu, J.; Head, R.; Liu, J.; Ruzinova, M.B.; Lim, K.H. Tumor-Stroma IL1beta-IRAK4 Feedforward Circuitry Drives Tumor Fibrosis, Chemoresistance, and Poor Prognosis in Pancreatic Cancer. Cancer Res. 2018, 78, 1700–1712. [Google Scholar] [CrossRef] [Green Version]
- Gordon, I.O.; Agrawal, N.; Willis, E.; Goldblum, J.R.; Lopez, R.; Allende, D.; Liu, X.; Patil, D.Y.; Yerian, L.; El-Khider, F.; et al. Fibrosis in ulcerative colitis is directly linked to severity and chronicity of mucosal inflammation. Aliment. Pharmacol. Ther. 2018, 47, 922–939. [Google Scholar] [CrossRef]
- Dubois, B.; Goubier, A.; Joubert, G.; Kaiserlian, D. Oral tolerance and regulation of mucosal immunity. Cell. Mol. Life Sci. CMLS 2005, 62, 1322–1332. [Google Scholar] [CrossRef]
- Hill, D.A.; Artis, D. Intestinal bacteria and the regulation of immune cell homeostasis. Annu. Rev. Immunol. 2010, 28, 623–667. [Google Scholar] [CrossRef] [Green Version]
- Tlaskalova-Hogenova, H.; Stepankova, R.; Kozakova, H.; Hudcovic, T.; Vannucci, L.; Tuckova, L.; Rossmann, P.; Hrncir, T.; Kverka, M.; Zakostelska, Z.; et al. The role of gut microbiota (commensal bacteria) and the mucosal barrier in the pathogenesis of inflammatory and autoimmune diseases and cancer: Contribution of germ-free and gnotobiotic animal models of human diseases. Cell. Mol. Immunol. 2011, 8, 110–120. [Google Scholar] [CrossRef]
- Vannucci, L.; Stepankova, R.; Grobarova, V.; Kozakova, H.; Rossmann, P.; Klimesova, K.; Benson, V.; Sima, P.; Fiserova, A.; Tlaskalova-Hogenova, H. Colorectal carcinoma: Importance of colonic environment for anti-cancer response and systemic immunity. J. Immunotoxicol. 2009, 6, 217–226. [Google Scholar] [CrossRef]
- Yang, Q.; Wang, Y.; Jia, A.; Wang, Y.; Bi, Y.; Liu, G. The crosstalk between gut bacteria and host immunity in intestinal inflammation. J. Cell. Physiol. 2021, 236, 2239–2254. [Google Scholar] [CrossRef]
- Elson, C.O.; Sartor, R.B.; Tennyson, G.S.; Riddell, R.H. Experimental models of inflammatory bowel disease. Gastroenterology 1995, 109, 1344–1367. [Google Scholar] [CrossRef]
- Takahashi, M.; Wakabayashi, K. Gene mutations and altered gene expression in azoxymethane-induced colon carcinogenesis in rodents. Cancer Sci. 2004, 95, 475–480. [Google Scholar] [CrossRef]
- Vannucci, L.; Fiserova, A.; Horvath, O.; Rossmann, P.; Mosca, F.; Pospisil, M. Cancer evolution and immunity in a rat colorectal carcinogenesis model. Int. J. Oncol. 2004, 25, 973–981. [Google Scholar]
- Solomon, L.; Mansor, S.; Mallon, P.; Donnelly, E.; Hoper, M.; Loughrey, M.; Kirk, S.; Gardiner, K. The dextran sulphate sodium (DSS) model of colitis: An overview. Comp. Clin. Pathol. 2010, 19, 235–239. [Google Scholar] [CrossRef]
- Laroui, H.; Ingersoll, S.A.; Liu, H.C.; Baker, M.T.; Ayyadurai, S.; Charania, M.A.; Laroui, F.; Yan, Y.; Sitaraman, S.V.; Merlin, D. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS ONE 2012, 7, e32084. [Google Scholar] [CrossRef]
- Atreya, R.; Neurath, M.F. Involvement of IL-6 in the pathogenesis of inflammatory bowel disease and colon cancer. Clin. Rev. Allergy Immunol. 2005, 28, 187–196. [Google Scholar] [CrossRef]
- Cooper, H.S.; Murthy, S.N.; Shah, R.S.; Sedergran, D.J. Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab. Investig. A J. Tech. Methods Pathol. 1993, 69, 238–249. [Google Scholar]
- Cui, L.; Chen, S.Y.; Lerbs, T.; Lee, J.W.; Domizi, P.; Gordon, S.; Kim, Y.H.; Nolan, G.; Betancur, P.; Wernig, G. Activation of JUN in fibroblasts promotes pro-fibrotic programme and modulates protective immunity. Nat. Commun. 2020, 11, 2795. [Google Scholar] [CrossRef]
- Gaudio, E.; Taddei, G.; Vetuschi, A.; Sferra, R.; Frieri, G.; Ricciardi, G.; Caprilli, R. Dextran sulfate sodium (DSS) colitis in rats: Clinical, structural, and ultrastructural aspects. Dig. Dis. Sci. 1999, 44, 1458–1475. [Google Scholar] [CrossRef]
- Chowdhury, A.; Fukuda, R.; Fukumoto, S. Growth factor mRNA expression in normal colorectal mucosa and in uninvolved mucosa from ulcerative colitis patients. J. Gastroenterol. 1996, 31, 353–360. [Google Scholar] [CrossRef]
- Wirtz, S.; Popp, V.; Kindermann, M.; Gerlach, K.; Weigmann, B.; Fichtner-Feigl, S.; Neurath, M.F. Chemically induced mouse models of acute and chronic intestinal inflammation. Nat. Protoc. 2017, 12, 1295–1309. [Google Scholar] [CrossRef]
- Chen, J.; Huang, X.F. The signal pathways in azoxymethane-induced colon cancer and preventive implications. Cancer Biol. Ther. 2009, 8, 1313–1317. [Google Scholar] [CrossRef] [Green Version]
- Santaolalla, R.; Sussman, D.A.; Ruiz, J.R.; Davies, J.M.; Pastorini, C.; Espana, C.L.; Sotolongo, J.; Burlingame, O.; Bejarano, P.A.; Philip, S.; et al. TLR4 activates the beta-catenin pathway to cause intestinal neoplasia. PLoS ONE 2013, 8, e63298. [Google Scholar] [CrossRef] [Green Version]
- Ghirardi, M.; Nascimbeni, R.; Villanacci, V.; Fontana, M.G.; Di Betta, E.; Salerni, B. Azoxymethane-induced aberrant crypt foci and colorectal tumors in F344 rats: Sequential analysis of growth. European surgical research. Europaische chirurgische Forschung. Eur. Surg. Res. 1999, 31, 272–280. [Google Scholar] [CrossRef]
- Raju, J. Azoxymethane-induced rat aberrant crypt foci: Relevance in studying chemoprevention of colon cancer. World J. Gastroenterol. 2008, 14, 6632–6635. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, M.; Mutoh, M.; Kawamori, T.; Sugimura, T.; Wakabayashi, K. Altered expression of beta-catenin, inducible nitric oxide synthase and cyclooxygenase-2 in azoxymethane-induced rat colon carcinogenesis. Carcinogenesis 2000, 21, 1319–1327. [Google Scholar]
- Jurcovicova, J.; Vigas, M.; Klir, P.; Jezova, D. Response of prolactin, growth hormone and corticosterone secretion to morphine administration or stress exposure in Wistar-AVN and Long Evans rats. Endocrinol. Exp. 1984, 18, 209–214. [Google Scholar]
- Stepankova, R.; Mara, M.; Ocenaskova, J. Prolonged survival of AVN Wistar rats with transplanted Yoshida sarcoma and increase of granular lymphocytes after administration of Bacillus firmus and their crude lipids. Folia Microbiol. 1995, 40, 413–416. [Google Scholar]
- Zidek, Z. Karyotypes of four inbred strains of rats: AVN, BP, LEW, WP. Folia Biol. 1968, 14, 74–79. [Google Scholar]
- Chernyavskiy, O.; Vannucci, L.; Bianchini, P.; Difato, F.; Saieh, M.; Kubinova, L. Imaging of mouse experimental melanoma in vivo and ex vivo by combination of confocal and nonlinear microscopy. Microsc. Res. Tech. 2009, 72, 411–423. [Google Scholar] [CrossRef]
- Feroze-Merzoug, F.; Berquin, I.M.; Dey, J.; Chen, Y.Q. Peptidylprolyl isomerase A (PPIA) as a preferred internal control over GAPDH and beta-actin in quantitative RNA analyses. BioTechniques 2002, 32, 776–778, 780, 782. [Google Scholar] [CrossRef] [Green Version]
- Gong, Z.K.; Wang, S.J.; Huang, Y.Q.; Zhao, R.Q.; Zhu, Q.F.; Lin, W.Z. Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development. Mol. Genet. Genom. MGG 2014, 289, 1157–1169. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Kuczek, D.E.; Larsen, A.M.H.; Thorseth, M.L.; Carretta, M.; Kalvisa, A.; Siersbaek, M.S.; Simoes, A.M.C.; Roslind, A.; Engelholm, L.H.; Noessner, E.; et al. Collagen density regulates the activity of tumor-infiltrating T cells. J. Immunother. Cancer 2019, 7, 68. [Google Scholar] [CrossRef] [Green Version]
- Van Goethem, E.; Poincloux, R.; Gauffre, F.; Maridonneau-Parini, I.; Le Cabec, V. Matrix architecture dictates three-dimensional migration modes of human macrophages: Differential involvement of proteases and podosome-like structures. J. Immunol. 2010, 184, 1049–1061. [Google Scholar] [CrossRef]
- Atreya, R.; Mudter, J.; Finotto, S.; Mullberg, J.; Jostock, T.; Wirtz, S.; Schutz, M.; Bartsch, B.; Holtmann, M.; Becker, C.; et al. Blockade of interleukin 6 trans signaling suppresses T-cell resistance against apoptosis in chronic intestinal inflammation: Evidence in crohn disease and experimental colitis in vivo. Nat. Med. 2000, 6, 583–588. [Google Scholar] [CrossRef]
- Becker, C.; Fantini, M.C.; Schramm, C.; Lehr, H.A.; Wirtz, S.; Nikolaev, A.; Burg, J.; Strand, S.; Kiesslich, R.; Huber, S.; et al. TGF-beta suppresses tumor progression in colon cancer by inhibition of IL-6 trans-signaling. Immunity 2004, 21, 491–501. [Google Scholar] [CrossRef] [Green Version]
- Becker, C.; Fantini, M.C.; Wirtz, S.; Nikolaev, A.; Lehr, H.A.; Galle, P.R.; Rose-John, S.; Neurath, M.F. IL-6 signaling promotes tumor growth in colorectal cancer. Cell Cycle 2005, 4, 217–220. [Google Scholar]
- Fenton, J.I.; Hursting, S.D.; Perkins, S.N.; Hord, N.G. Interleukin-6 production induced by leptin treatment promotes cell proliferation in an Apc (Min/+) colon epithelial cell line. Carcinogenesis 2006, 27, 1507–1515. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, T.; Yoshinaga, N.; Tanabe, S. Interleukin-6 (IL-6) regulates claudin-2 expression and tight junction permeability in intestinal epithelium. J. Biol. Chem. 2011, 286, 31263–31271. [Google Scholar] [CrossRef] [Green Version]
- Caja, F.; Vannucci, L. TGFbeta: A player on multiple fronts in the tumor microenvironment. J. Immunotoxicol. 2015, 12, 300–307. [Google Scholar] [CrossRef]
- Seoane, J. Escaping from the TGFbeta anti-proliferative control. Carcinogenesis 2006, 27, 2148–2156. [Google Scholar] [CrossRef]
- Akhurst, R.J.; Derynck, R. TGF-beta signaling in cancer—A double-edged sword. Trends Cell Biol. 2001, 11, S44–S51. [Google Scholar]
- Feagins, L.A. Role of transforming growth factor-beta in inflammatory bowel disease and colitis-associated colon cancer. Inflamm. Bowel Dis. 2010, 16, 1963–1968. [Google Scholar] [CrossRef]
- Yang, L.; Pang, Y.; Moses, H.L. TGF-beta and immune cells: An important regulatory axis in the tumor microenvironment and progression. Trends Immunol. 2010, 31, 220–227. [Google Scholar] [CrossRef] [Green Version]
- Engle, S.J.; Ormsby, I.; Pawlowski, S.; Boivin, G.P.; Croft, J.; Balish, E.; Doetschman, T. Elimination of colon cancer in germ-free transforming growth factor beta 1-deficient mice. Cancer Res. 2002, 62, 6362–6366. [Google Scholar]
- Landskron, G.; De la Fuente, M.; Thuwajit, P.; Thuwajit, C.; Hermoso, M.A. Chronic inflammation and cytokines in the tumor microenvironment. J. Immunol. Res. 2014, 2014, 149185. [Google Scholar] [CrossRef] [Green Version]
- Guda, K.; Claffey, K.P.; Dong, M.; Nambiar, P.R.; Rosenberg, D.W. Defective processing of the transforming growth factor-beta1 in azoxymethane-induced mouse colon tumors. Mol. Carcinog. 2003, 37, 51–59. [Google Scholar] [CrossRef]
- Sheth, R.U.; Li, M.; Jiang, W.; Sims, P.A.; Leong, K.W.; Wang, H.H. Spatial metagenomic characterization of microbial biogeography in the gut. Nat. Biotechnol. 2019, 37, 877–883. [Google Scholar] [CrossRef]
- Sohn, O.S.; Fiala, E.S.; Requeijo, S.P.; Weisburger, J.H.; Gonzalez, F.J. Differential effects of CYP2E1 status on the metabolic activation of the colon carcinogens azoxymethane and methylazoxymethanol. Cancer Res. 2001, 61, 8435–8440. [Google Scholar]
- Tropini, C.; Earle, K.A.; Huang, K.C.; Sonnenburg, J.L. The Gut Microbiome: Connecting Spatial Organization to Function. Cell Host Microbe 2017, 21, 433–442. [Google Scholar] [CrossRef] [Green Version]
- Yasuda, K.; Oh, K.; Ren, B.; Tickle, T.L.; Franzosa, E.A.; Wachtman, L.M.; Miller, A.D.; Westmoreland, S.V.; Mansfield, K.G.; Vallender, E.J.; et al. Biogeography of the intestinal mucosal and lumenal microbiome in the rhesus macaque. Cell Host Microbe 2015, 17, 385–391. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.; Yi, H.; Guo, Z.; Qian, C.; Xia, S.; Yao, Y.; Cao, X. Splenic stroma-educated regulatory dendritic cells induce apoptosis of activated CD4 T cells via Fas ligand-enhanced IFN-gamma and nitric oxide. J. Immunol. 2012, 188, 1168–1177. [Google Scholar] [CrossRef] [Green Version]
- Kobaek-Larsen, M.; Fenger, C.; Ritskes-Hoitinga, J. Secondary effects induced by the colon carcinogen azoxymethane in BDIX rats. APMIS Acta Pathol. Microbiol. Immunol. Scand. 2004, 112, 319–329. [Google Scholar] [CrossRef]
- Ni, J.; Chen, S.F.; Hollander, D. Effects of dextran sulphate sodium on intestinal epithelial cells and intestinal lymphocytes. Gut 1996, 39, 234–241. [Google Scholar] [CrossRef] [Green Version]
- Nakanishi, M.; Tazawa, H.; Tsuchiya, N.; Sugimura, T.; Tanaka, T.; Nakagama, H. Mouse strain differences in inflammatory responses of colonic mucosa induced by dextran sulfate sodium cause differential susceptibility to PhIP-induced large bowel carcinogenesis. Cancer Sci. 2007, 98, 1157–1163. [Google Scholar] [CrossRef]
- Suzuki, R.; Kohno, H.; Sugie, S.; Nakagama, H.; Tanaka, T. Strain differences in the susceptibility to azoxymethane and dextran sodium sulfate-induced colon carcinogenesis in mice. Carcinogenesis 2006, 27, 162–169. [Google Scholar] [CrossRef]
- Guinane, C.M.; Cotter, P.D. Role of the gut microbiota in health and chronic gastrointestinal disease: Understanding a hidden metabolic organ. Ther. Adv. Gastroenterol. 2013, 6, 295–308. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Pitmon, E.; Wang, K. Microbiome, inflammation and colorectal cancer. Semin. Immunol. 2017, 32, 43–53. [Google Scholar] [CrossRef]
- Jakobsson, H.E.; Rodriguez-Pineiro, A.M.; Schutte, A.; Ermund, A.; Boysen, P.; Bemark, M.; Sommer, F.; Backhed, F.; Hansson, G.C.; Johansson, M.E. The composition of the gut microbiota shapes the colon mucus barrier. EMBO Rep. 2015, 16, 164–177. [Google Scholar] [CrossRef]
- Klimesova, K.; Kverka, M.; Zakostelska, Z.; Hudcovic, T.; Hrncir, T.; Stepankova, R.; Rossmann, P.; Ridl, J.; Kostovcik, M.; Mrazek, J.; et al. Altered gut microbiota promotes colitis-associated cancer in IL-1 receptor-associated kinase M-deficient mice. Inflamm. Bowel Dis. 2013, 19, 1266–1277. [Google Scholar] [CrossRef] [Green Version]
- Birk, J.W.; Tadros, M.; Moezardalan, K.; Nadyarnykh, O.; Forouhar, F.; Anderson, J.; Campagnola, P. Second harmonic generation imaging distinguishes both high-grade dysplasia and cancer from normal colonic mucosa. Dig. Dis. Sci. 2014, 59, 1529–1534. [Google Scholar] [CrossRef]
- Blockhuys, S.; Agarwal, N.R.; Hildesjo, C.; Jarlsfelt, I.; Wittung-Stafshede, P.; Sun, X.F. Second harmonic generation for collagen I characterization in rectal cancer patients with and without preoperative radiotherapy. J. Biomed. Opt. 2017, 22, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Li, L.H.; Jiang, W.Z.; Kang, D.Y.; Liu, X.; Li, H.S.; Guan, G.X.; Zhuo, S.M.; Chen, Z.F.; Chen, J.X. Second-harmonic imaging microscopy for identifying colorectal intraepithelial neoplasia. J. Microsc. 2018, 271, 31–35. [Google Scholar] [CrossRef]
- Byun, J.S.; Gardner, K. Wounds that will not heal: Pervasive cellular reprogramming in cancer. Am. J. Pathol. 2013, 182, 1055–1064. [Google Scholar] [CrossRef] [Green Version]
- Caja, F.; Stakheev, D.; Chernyavskiy, O.; Krizan, J.; Dvorak, J.; Rossmann, P.; Stepankova, R.; Makovicky, P.; Makovicky, P.; Kozakova, H.; et al. Immune activation by microbiome shapes the colon mucosa: Comparison between healthy rat mucosa under conventional and germ-free conditions. J. Immunotoxicol. 2021, 18, 37–49. [Google Scholar] [CrossRef]
- Egeblad, M.; Rasch, M.G.; Weaver, V.M. Dynamic interplay between the collagen scaffold and tumor evolution. Curr. Opin. Cell Biol. 2010, 22, 697–706. [Google Scholar] [CrossRef] [Green Version]
- Miles, F.L.; Sikes, R.A. Insidious changes in stromal matrix fuel cancer progression. Mol. Cancer Res. Mcr. 2014, 12, 297–312. [Google Scholar] [CrossRef] [Green Version]
- Krieglstein, C.F.; Cerwinka, W.H.; Sprague, A.G.; Laroux, F.S.; Grisham, M.B.; Koteliansky, V.E.; Senninger, N.; Granger, D.N.; de Fougerolles, A.R. Collagen-binding integrin alpha1beta1 regulates intestinal inflammation in experimental colitis. J. Clin. Investig. 2002, 110, 1773–1782. [Google Scholar] [CrossRef]
- Ondeck, M.G.; Kumar, A.; Placone, J.K.; Plunkett, C.M.; Matte, B.F.; Wong, K.C.; Fattet, L.; Yang, J.; Engler, A.J. Dynamically stiffened matrix promotes malignant transformation of mammary epithelial cells via collective mechanical signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 3502–3507. [Google Scholar] [CrossRef] [Green Version]
- Burke, K.; Smid, M.; Dawes, R.P.; Timmermans, M.A.; Salzman, P.; van Deurzen, C.H.; Beer, D.G.; Foekens, J.A.; Brown, E. Using second harmonic generation to predict patient outcome in solid tumors. BMC Cancer 2015, 15, 929. [Google Scholar] [CrossRef] [Green Version]
- Keikhosravi, A.; Bredfeldt, J.S.; Sagar, A.K.; Eliceiri, K.W. Second-harmonic generation imaging of cancer. Methods Cell Biol. 2014, 123, 531–546. [Google Scholar] [CrossRef]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Balkwill, F.; Charles, K.A.; Mantovani, A. Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell 2005, 7, 211–217. [Google Scholar] [CrossRef] [Green Version]
- Mantovani, A.; Romero, P.; Palucka, A.K.; Marincola, F.M. Tumour immunity: Effector response to tumour and role of the microenvironment. Lancet 2008, 371, 771–783. [Google Scholar] [CrossRef]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Il1a | AAGACAAGCCTGTGTTGCTGAAGG | TCCCAGAAGAAAATGAGGTCGGTC |
Il1b | CACCTCTCAAGCAGAGCACAG | GGGTTCCATGGTGAAGTCAAC |
Ifng | ACTGGCAAAAGGACGGTAAC | ATCAGGTGCGATTCGATGAC |
Tgfb1 | TGAGTGGCTGTCTTTTGACG | TCTGTGGAGCTGAAGCAGTA |
Ppia | TACAGGTCCTGGCATCTTGT | AGTTGTCCACAGTCGGAGAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Čaja, F.; Stakheev, D.; Chernyavskiy, O.; Kubinová, L.; Křížan, J.; Dvořák, J.; Rossmann, P.; Štěpánková, R.; Makovický, P.; Makovický, P.; et al. Local Immune Changes in Early Stages of Inflammation and Carcinogenesis Correlate with the Collagen Scaffold Changes of the Colon Mucosa. Cancers 2021, 13, 2463. https://doi.org/10.3390/cancers13102463
Čaja F, Stakheev D, Chernyavskiy O, Kubinová L, Křížan J, Dvořák J, Rossmann P, Štěpánková R, Makovický P, Makovický P, et al. Local Immune Changes in Early Stages of Inflammation and Carcinogenesis Correlate with the Collagen Scaffold Changes of the Colon Mucosa. Cancers. 2021; 13(10):2463. https://doi.org/10.3390/cancers13102463
Chicago/Turabian StyleČaja, Fabián, Dmitry Stakheev, Oleksandr Chernyavskiy, Lucie Kubinová, Jiří Křížan, Jiří Dvořák, Pavel Rossmann, Renata Štěpánková, Peter Makovický, Pavol Makovický, and et al. 2021. "Local Immune Changes in Early Stages of Inflammation and Carcinogenesis Correlate with the Collagen Scaffold Changes of the Colon Mucosa" Cancers 13, no. 10: 2463. https://doi.org/10.3390/cancers13102463